Sage Journals: Discover world-class research

Abstract

BACKGROUND:

It is well known that some circulating microRNAs (miRNAs) are highly stable and might serve as promising biomarkers for many types of human cancer including glioblastoma (GBM). However, the potential clinical significance of serum miR-100 in GBM remained unknown.

OBJECTIVE:

We aimed to detect the expression level of serum miR-100 in patients with GBM and assess its potential diagnostic and prognostic value.

METHODS:

Quantitative real-time PCR was performed to measure serum miR-100 levels in 95 GBM patients and 60 healthy volunteers. The association between serum miR-100 level and clinicopathological parameters as well survival of GBM patients was evaluated.

RESULTS:

Our results revealed that serum miR-100 levels were significantly decreased in GBM patients compared with the healthy controls. Additionally, miR-100 levels were significantly elevated after treatment. Low miR-100 expression was closely correlated with worse clinicopathological characteristics. Further receiver operating characteristic (ROC) curve analysis showed that serum miR-100 could effectively discriminate GBM cases from normal controls. Moreover, survival analyses revealed that patients with high serum miR-100 levels had significantly longer survival time than those with low serum miR-100 levels. Finally, multivariate analysis identified serum miR-100 as an independent prognostic indicator for GBM.

CONCLUSIONS:

Our findings suggested that serum miR-100 might serve as promising biomarker for GBM diagnosis and prognosis.

Keywords

Glioblastoma serum miR-100 prognosis biomarker

1. Introduction

Glioblastoma (GBM) is the most aggressive type of glioma, and the most common brain malignant tumor in both adults and young patients [1]. Despite advances in surgical excision, radiotherapy and chemotherapy, the prognosis of GBM patients remains very unfavorable, with a median overall survival of 15 months or less [2, 3, 4]. To improve the clinical outcome of GBM patients, it is urgent to identify novel biomarkers for diagnosis and prognosis of this malignancy.

MicroRNAs (miRNAs) are a class of small endogenous noncoding RNA molecules that are 18–25 nucleotides in length [5, 6]. Growing evidence have showed that miRNAs participate in a variety of biologic processes including cell growth, migration, invasion and apoptosis [7, 8]. Recently, more and more studies have demonstrated that some circulating miRNAs in serum, plasma or cerebrospinal fluid (CSF) are differentially expressed in GBM patients, and serve as biomarkers for diagnosis and prognosis in GBM. For example, loss of miR-106a [9], miR-485-3p [10], miR-328 [11], miR-137 [12] were strongly correlated with poor prognosis of GBM, while miR-196b [13] and miR-15b [14] were significantly upregulated in GBM patients.

MiR-100 has been reported to be aberrantly dysregulated in GBM. Luan et al. revealed miR-100 was significantly downregulated in both GBM cell lines and tissue. Overexpression of miR-100 resulted in decreased cell growth, migration, and increasing chemosensitivity to cisplatin in vitro and in vivo [15]. Moreover, miR-100 upregulation and subsequent elevated expression of SMRT/NCOR2 reduced cell proliferation and stimulated cell apoptosis in vitro. In vivo evidence showed re-expression of miR-100 greatly inhibited GBM tumorigenicity and improved animal survival [16]. These data suggested that miR-100 was a powerful tumor suppressor in GBM. However, the potential clinical significance of serum miR-100 was unknown. The present study aimed to detect serum miR-100 expression levels in GBM patients and analyze its association with clinical variables as well as survival.

2. Materials and methods

2.1 Ethics statement

This study was approved by the Ethics Committee of Xianyang Hospital of Yan’an University (Xianyang, China), and written informed consent was provided by each participant. All specimens were handled and made anonymous according to the ethical and legal standards.

Table 1
Correlation of serum miR-100 expression with clinicopathological characteristics of 95 GBM cases

Clinicopathological	Cases	Serum miR-100 expression		$p$ -value
features		High	Low
Gender				NS
Male	62	30	32
Female	33	21	12
Age (years)				NS
$<$ 50	27	12	15
$\geqslant$ 50	68	39	29
KPS				0.0207
$<$ 80	71	43	28
$\geqslant$ 80	24	8	16
Tumor size (cm)				NS
$<$ 6	45	22	23
$\geqslant$ 6	50	29	21
IDH1/2 mutation
Wide type	67	30	37	0.0071
Mutation	28	21	7
MGMT methylation
Yes	42	28	14	0.0239
No	53	23	30

MGMT, O6-methylguanine-DNA methyltransferase; IDH1/2, isocitrate dehydrogenase; KPS, karnofsky performance scale; NS, not significant.

2.2 Patients and samples

Blood samples were obtained from 95 patients with diagnosed GBM before surgery, 2 weeks after surgery and 30 days after radiotherapy combined with chemotherapy, respectively. None of the patients had received any treatment prior to blood sampling. All the GBM patients were confirmed and classified based on 2016 WHO classification of tumours of the central nervous system. Detailed characteristics of all patients were listed in Table 1. The average age of GBM patients was 58.6 y (36.2 y $\pm$ 85.2 y), with 62 males and 33 females. Four known risk factors (tumor volume $>$ 6 cm, KPS score $>$ 80, IDH wide type, without MGMT promoter methylation) were closely associated with the prognosis of GBM. We defined that the GBM patients with three or four risk factors were considered as high combined risk factors group ( $n=$ 67), while the remaining GBM patients ( $n=$ 28) were included into low combined risk factors group. Moreover, 60 healthy individuals were enrolled as controls. The GBM patients and the healthy controls were matched by age, gender, and all the participants were Han Chinese. All subjects received routine follow-up. The last follow-up time of GBM patients was 30.8 months and updated until July 2017. Overall survival (OS) was calculated from the date of surgery to the date of death or last follow-up. Progression-free survival (PFS) was calculated from the date of surgery to the date of relapse or death or last follow-up. Serum was collected following centrifugation of blood at 3,000 rpm for 20 min and at 12,000 rpm for 10 min at 4 ${}^{\circ}$ C, then the supernatant was aliquoted and stored at $-$ 80 ${}^{\circ}$ C.

2.3 RNA extraction and real-time PCR (qRT-PCR)

Total RNA was isolated from 250 $\mu$ L serum using a Qiagen miRNeasy Mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The concentrations of total RNA in the samples were determined by a NanoDrop ND-1000 spectrophotometer (Wilmington, DE, USA). Quantitative PCR was performed using SYBR Premix Ex Taq (Takara, Dalian, China) on an ABI 7900 QPCR system (Applied Biosystems, Foster City, CA, USA). Each amplification reaction was repeated in triplicate. The relative serum miR-100 expression was calculated by the equation 2 ${}^{-\Delta\Delta\text{Ct}}$ , with cer-miR-39 as an internal control. The specific primers were presented in Table 2.

Table 2
Primer sequences used in real-time PCR analysis of miR-100

miR-100	F-primer: ATGGTTGGGAACCCGTAGATCCGAA
	R-primer: CGTATCCAGTGCAGGGTCCG
cer-miR-39	F-primer: CAGAGTCACCGGGTGTAAAT
	R-primer: CCAGTGCGTGTCGTGGAGTC

Figure 1.

(a) Serum miR-100 levels were significantly lower in GBM patients in high combined risk factors (CRF) group. (b) A significant increase in serum miR-100 levels was noted in the blood samples collected after treatment.

2.4 Statistical analysis

Statistical analyses were conducted using GraphPad Prism version 4 (GraphPad Software, San Diego, CA, USA). Statistical significance was defined as $P<$ 0.05. The data was not subjected to normal distribution, thus the median value of serum miR-100 in the GBM patients was used to divide the GBM patients into high and low expression group. The Mann-Whitney U test or Kruskal-Wallis test were used to evaluate statistical significance between groups. The Chi-square test was performed to assess the association between serum miR-100 expression and clinical features of GBM patients. Receiver-operator characteristic (ROC) curve analysis was used to assess the diagnostic accuracy of miR-100. Furthermore, the prognostic value of miR-100 expression in GBM was analyzed with Kaplan-Meier method as well as multivariate analysis.

3. Results

3.1 Down-regulation of miR-100 in GBM patients and the alterations of miR-100 levels

The serum miR-100 levels in all participants were detected by qRT-PCR. As shown in Fig. 1a, the relative serum miR-100 levels were significantly lower in GBM patients from the high CRF group compared with those in the low CRF group ( $P<$ 0.05) or healthy controls ( $P<$ 0.01). Furthermore, the miR-100 levels in post-treatment blood samples were dramatically increased in comparison with the pre-treatment samples (Fig. 1b, $P<$ 0.01).

3.2 Diagnostic accuracy of miR-100 in GBM patients

ROC curve analysis demonstrated that serum miR-100 expression was a promising indicator for identifying GBM cases from normal controls, with the area under the ROC curve (AUC) of 0.839. In addition, the specificity and sensitivity were 83.33% and 77.89%, respectively (Fig. 2).

Table 3
Multivariate analysis of prognostic factors for OS and PFS in GBM patients

Prognostic factors	Overall survival		Progression free survival
	RR (95% CI)	$P$	RR (95% CI)	$P$
Combined risk factors, high vs. low	3.18 (1.22–5.19)	0.013	3.52 (1.43–5.78)	0.009
KPS, $<$ 80 vs. $\geqslant$ 80	2.47 (1.06–3.97)	0.022	2.83 (1.14–4.65)	0.016
Serum miR-100, low vs. high	3.75 (1.54–6.18)	0.007	4.21 (1.67–7.13)	0.001

CI, confidence interval; RR, risk ratio.

Figure 2.

The diagnostic value of serum miR-100.

Figure 3.

(a) Kaplan-Meier plot of overall survival for patients with GBM. (b) Kaplan-Meier plot of progression-free survival for patients with GBM.

3.3 Association of miR-100 expression with the clinicopathological features of GBM

Next, whether serum miR-100 expression correlated with clinical characteristics of GBM patients was investigated. All 95 GBM subjects were divided into two groups based on median expression levels of miR-100. As presented in Table 1, low serum miR-100 expression was significantly correlated with Karnofsky Performance Scale (KPS) ( $P=$ 0.0207), IDH1/2 mutation status ( $P=$ 0.0071) and MGMT methylation status ( $P=$ 0.0239). However, no association was observed between serum miR-100 expression with other clinical features such as gender, age or tumor size (all $P>$ 0.05).

3.4 Association between miR-100 expression and prognosis in GBM patients

The association between serum miR-100 expression and OS/PFS in patients with GBM was evaluated by Kaplan-Meier method. GBM patients with high serum miR-100 had significantly longer OS ( $P=$ 0.018, Fig. 3a) and PFS ( $P=$ 0.011, Fig. 3b) than those with low serum miR-100 levels.

Multivariate analysis was used to explore the impact of clinical parameters on OS and PFS. In GBM patients, low serum miR-100 expression was strongly correlated with worse OS (RR $=$ 3.75, 95% CI $=$ 1.54–6.18, $P=$ 0.007) and PFS (RR $=$ 4.21, 95% CI $=$ 1.67–7.13, $P=$ 0.001). Meanwhile, other clinical variables including combined risk factors (OS: RR $=$ 3.18, 95% CI $=$ 1.22–5.19, $P=$ 0.013; PFS: RR $=$ 3.52, 95% CI $=$ 1.43–5.78, $P=$ 0.009), KPS (OS: RR $=$ 2.47, 95% CI $=$ 1.06–3.97, $P=$ 0.022; PFS: RR $=$ 2.83, 95% CI $=$ 1.14–4.65, $P=$ 0.016) were also significant independent prognostic factors for OS or PFS (Table 3).

4. Discussion

In the current study, we have demonstrated that serum miR-100 expression levels were dramatically downregulated in GBM compared to the healthy controls. Furthermore, serum miR-100 levels were significantly increased following treatment, indicating that serum miR-100 levels might be sensitive to treatment response. ROC analysis revealed serum miR-100 had a good performance to differentiate GBM patients from healthy controls. In addition, low serum miR-100 was closely correlated with shorter survival, and serum miR-100 was identified as an independent prognostic biomarker for GBM patients. In consistent with previous reports, miR-100 exhibited tumor suppressive properties in GBM [15, 16]. To the best of our knowledge, our study demonstrated for the first time that serum miR-100 might serve as a diagnostic and prognostic prediction biomarker for GBM. There are two possible mechanisms accounting for the deceased miR-100 in the serum. First, miR-100 might be highly methylated in the GBM, thus the level of miR-100 is significantly downregulated in GBM cells, resulting less miR-100 is secreted into the circulation system. In addition, exosome is very important for the substance transmission between cancer cells and cancer cells, or cancer cells and other cell types in the tumor microenvironment. It is possible that less miR-100 is packaged into the exosomes, leading to the downregulation of miR-100 in the serum. MiR-100 functions as a tumor suppressor in GBM and serum miR-100 might be a good indicator of the miR-100 levels in the cancer cells. Therefore, it is reasonable to observe that decreased serum miR-100 level is associated with unfavorable clinical outcome in GBM.

It seems that downregulation of miR-100 expression was also a frequent event in multiple cancer types. In bladder cancer, the expression level of miR-100 was remarkably lower in cancerous tissues compared with normal adjacent tissues, and miR-100 downregulation was strongly associated with tumor stage, tumor grade, regional lymph node involvement and shorter survival [17, 18]. Moreover, Xu and colleagues reported miR-100 was frequently underexpressed in bladder cancer tissues. Upregulation of miR-100 significantly decreased cell proliferation, motility and stimulated cell-cycle arrest in vitro, as well as suppressed the tumor growth in vivo by targeting mTOR [19]. Chen et al. found miR-100 expression was decreased in BC tissues compared with normal specimens. MiR-182/miR-100 ratio showed good performance for discriminating BC patients from controls and was confirmed to be a prognostic factor [20]. In hepatocellular carcinoma (HCC), an under-expression of miR-100 was found in cancerous tissues and ectopic expression of miR-100 greatly restrained cell growth in HCC mouse xenograft models. In addition, both mTOR and IGF-1R were demonstrated to be its downstream targets [21]. Zhou et al. found that loss of miR-100 in HCC tissues was closely correlated with aggressive clinical variables. MiR-100 upregulation significantly inhibited carcinogenesis in vitro and suppressed HCC cell metastasis in vivo [22]. Also, Liu and colleagues revealed that miR-100 levels were decreased in non-small cell lung cancer tissues, and low miR-100 levels predicted shorter survival of patients. MiR-100 mimics significantly reduced cancer cell growth, stimulated cell apoptosis and G2/M cell cycle arrest via regulating polo-like kinase 1 [23]. In oral squamous cell carcinoma, decreased miR-100 expression was observed both in tumor and cell lines, miR-100 downregulation resulted in a decreased cell proliferation [24]. In epithelial ovarian cancer, Azizmohammadi and colleagues reported the level of miR-100 was relatively lower in cancerous tissues compared with non-cancerous specimens, and reduction of miR-100 predicted worse prognosis [25]. Moreover, Sun et al. showed miR-100 expression was significantly lower in nasopharyngeal carcinoma tissues than that in healthy tissues, and miR-100 upregulation markedly decreased the oncogenic activities of cancer cell lines by regulating IGF1R [26]. Likewise, a significant reduction in miR-100 expression was observed in tissues of gastric cancer (GC), and the deregulated miR-100 was correlated with shorter survival and aggressive clinical parameters. Furthermore, in vitro analysis revealed enforced miR-100 expression or suppression of CXCR7 dramatically attenuated GC cell proliferation [27].

In addition, the oncogenic property of miR-100 in acute myeloid leukemia (AML) was reported by some studies. MiR-100 exhibited elevated levels in AML, and in vitro and in vivo analysis revealed high miR-100 expression contributed to invasive nature of AML cells. RBSP3 was confirmed to be the target gene [28]. Likewise, Bai et al. found miR-100 expression was highly expressed in pediatric AML patients than in controls. Its expression was closely associated with poor phenotypes and worse survival of patients [29]. More importantly, the role of miR-100 in cancer development and progression remained controversial in some cancer types. In osteosarcoma, significantly lower miR-100 levels were found in cancerous specimens, and loss of miR-100 promoted U2OS cell growth and increased cell survival against Doxorubicin by inversely regulating ZNRF2 [30]. However, Kubota et al. demonstrated elevated miR-100 expression in MNNG/HOS, 143B, MG63 cell lines promoted tumorigenicity and resistance to chemotherapeutic drugs [31]. Similarly, in breast cancer (BC), ectopic expression of miR-100 suppressed the oncogenic activities of BC cells and enhanced the sensitivity of cancer cells to cisplatin treatment [32, 33, 34]. Conversely, miR-100 levels were specifically increased in SK-BR-3 BC cell lines. In addition, miR-100 silencing induced apoptosis in SK-BR-3 cells and inhibited tumorigenicity in vitro and in vivo through the MTMR3-p27 pathway [35]. These findings indicated that the role of miR-100 in tumorigenesis might be associated with tumor type and tumor microenvironment.

Currently, deregulated serum miR-100 has been associated with esophageal squamous cell carcinoma, chronic obstructive pulmonary disease and hepatocellular carcinoma [36, 37, 38]. Single biomarker is not enough to accurately detect and predict the prognosis of GBM. Combination of several serum biomarkers and molecular events (IDH1/2 mutation status, MGMT methylation etc.) might contribute to avoid the false positive and negative findings.

5. Conclusions

Taken together, our data provided compelling evidence that serum miR-100 might serve as a promising biomarker for the diagnosis and prognosis prediction of GBM. Further studies with larger cohort are warranted to confirm our findings.

Footnotes

Acknowledgments

This study was supported by the Grants from Bureau of Science and Technology of Xianyang City (No: 2017k02-91) and Yan’an University (No: YDY2017-12).

Conflict of interest

We deny any conflict of interest.

References

Alifieris

and Trafalis

D.T.

, Glioblastoma multiforme: Pathogenesis and treatment, Pharmacol Ther 152 (2015), 63–82.

Liu

et al., MiR-212-3p inhibits glioblastoma cell proliferation by targeting SGK3, J Neurooncol 122(3) (2015), 431–439.

Omuro

and DeAngelis

L.M.

, Glioblastoma and other malignant gliomas: A clinical review, JAMA 310(17) (2013), 1842–1850.

et al., Birth of MTH1 as a therapeutic target for glioblastoma: MTH1 is indispensable for gliomatumorigenesis, Am J Transl Res 8(6) (2016), 2803–2811.

Chen

J.J.

Zhao

and Li

, Potential roles of exosomal microRNAs as diagnostic biomarkers and therapeutic application in Alzheimer’s disease, Neural Plast 2017 (2017), 7027380.

Zhang

et al., MiR-218 inhibited growth and metabolism of human glioblastoma cells by directly targeting E2F2, Cell Mol Neurobiol 35(8) (2015), 1165–1173.

Kong

Y.W.

Ferland-McCollough

Jackson

T.J.

and Bushell

, MicroRNAs in cancer management, Lancet Oncol 13(6) (2012), e249–58.

Hoareau-Aveilla

and Meggetto

, Crosstalk between microRNA and DNA methylation offers potential biomarkers and targeted therapies in ALK-Positive lymphomas, Cancers (Basel) 9(8) (2017).

Zhao

et al., MiR-106a is an independent prognostic marker in patients with glioblastoma, Neuro Oncol 15(6) (2013), 707–717.

10.

Wang

Z.Q.

et al., Low serum level of miR-485-3p predicts poor survival in patients with glioblastoma, PLoS One 12(9) (2017), e0184969.

11.

Z.F.

et al., MiR-328 expression is decreased in high-grade gliomas and is associated with worse survival in primary glioblastoma, PLoS One 7(10) (2012), e47270.

12.

H.Y.

et al., Circulating microRNA-137 is a potential biomarker for human glioblastoma, Eur Rev Med Pharmacol Sci 20(17) (2016), 3599–3604.

13.

et al., Upregulation of miR-196b confers a poor prognosis in glioblastoma patients via inducing a proliferative phenotype, PLoS One 7(6) (2012), e38096.

14.

D’Urso

et al., MiR-15b and miR-21 as circulating biomarkers for diagnosis of glioma, Curr Genomics 16(5) (2015), 304–311.

15.

Luan

Zhang

Zuo

and Zhou

, Overexpression of miR-100 inhibits cell proliferation, migration, and chemosensitivity in human glioblastoma through FGFR3, Onco Targets Ther 8 (2015), 3391–3400.

16.

Alrfaei

B.M.

Vemuganti

and Kuo

J.S.

, MicroRNA-100 targets SMRT/NCOR2, reduces proliferation, and improves survival in glioblastoma animal models, PLoS One 8(11) (2013), e80865.

17.

Cao

Y.H.

et al., Prognostic role of microRNA-100 in patients with bladder cancer, Genet Mol Res 14(4) (2015), 15948–15954.

18.

Wang

et al., Reduced expression of microRNA-100 confers unfavorable prognosis in patients with bladder cancer, Diagn Pathol 7 (2012), 159.

19.

et al., MiRNA-100 inhibits human bladder urothelial carcinogenesis by directly targeting mTOR, Mol Cancer Ther 12(2) (2013), 207–219.

20.

Chen

Lin

Shi

Lin

and Shi

, Evaluation of miR-182/miR-100 ratio for diagnosis and survival prediction in bladder cancer, Arch Iran Med 19(9) (2016), 645–651.

21.

Y.Y.

et al., MicroRNA-100 promotes the autophagy of hepatocellular carcinoma cells by inhibiting the expression of mTOR and IGF-1R, Oncotarget 5(15) (2014), 6218–6228.

22.

Zhou

H.C.

et al., Downregulation of microRNA-100 enhances the ICMT-Rac1 signaling and promotes metastasis of hepatocellular carcinoma cells, Oncotarget 5(23) (2014), 12177–12188.

23.

Liu

et al., MicroRNA-100 is a potential molecular marker of non-small cell lung cancer and functions as a tumor suppressor by targeting polo-like kinase 1, BMC Cancer 12 (2012), 519.

24.

Henson

B.J.

Bhattacharjee

O’Dee

D.M.

Feingold

and Gollin

S.M.

, Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy, Genes Chromosomes Cancer 48(7) (2009), 569–582.

25.

Azizmohammadi

et al., The role and expression of miR-100 and miR-203 profile as prognostic markers in epithelial ovarian cancer, Am J Transl Res 8(5) (2016), 2403–2410.

26.

Sun

et al., MiR-100 inhibits the migration and invasion of nasopharyngeal carcinoma by targeting IGF1R, Oncol Lett 15(6) (2018), 8333–8338.

27.

Cao

et al., MicroRNA-100 suppresses human gastric cancer cell proliferation by targeting CXCR7, Oncol Lett 15(1) (2018), 453–458.

28.

Zheng

Y.S.

et al., MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia, Oncogene 31(1) (2012), 80–92.

29.

Bai

Guo

Hong

and Kuai

, Upregulation of microRNA-100 predicts poor prognosis in patients with pediatric acute myeloid leukemia, Onco Targets Ther 5 (2012), 213–219.

30.

Xiao

Yang

and Qi

, MicroRNA-100 suppresses human osteosarcoma cell proliferation and chemo-resistance via ZNRF2, Oncotarget 8(21) (2017), 34678–34686.

31.

Kubota

et al., MiR-125b and miR-100 are predictive biomarkers of response to induction chemotherapy in osteosarcoma, Sarcoma 2016 (2016), 1390571.

32.

Gebeshuber

C.A.

and Martinez

, MiR-100 suppresses IGF2 and inhibits breast tumorigenesis by interfering with proliferation and survival signaling, Oncogene 32(27) (2013), 3306–3310.

33.

Chen

et al., MiR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion, PLoS Genet 10(2) (2014), e1004177.

34.

et al., MiR-100 reverses cisplatin resistance in breast cancer by suppressing HAX-1, Cell Physiol Biochem 47(5) (2018), 2077–2087.

35.

Gong

et al., The role of miR-100 in regulating apoptosis of breast cancer cells, Sci Rep 5 (2015), 11650.

36.

Zhang

et al., Circulating miRNA profile in esophageal adenocarcinoma, Am J Cancer Res 6(11) (2016), 2713–2721.

37.

Akbas

et al., Analysis of serum micro-RNAs as potential biomarker in chronic obstructive pulmonary disease, Exp Lung Res 38(6) (2012), 286–94.

38.

Wang

et al., Profiles of differential expression of circulating microRNAs in hepatitis B virus-positive small hepatocellular carcinoma, Cancer Biomark 15(2) (2015), 171–80.

Serum miR-100 is a potential biomarker for detection and outcome prediction of glioblastoma patients

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

1. Introduction

2. Materials and methods

2.1 Ethics statement

Table 1 Correlation of serum miR-100 expression with clinicopathological characteristics of 95 GBM cases

2.3 RNA extraction and real-time PCR (qRT-PCR)

Table 2 Primer sequences used in real-time PCR analysis of miR-100

3. Results

3.1 Down-regulation of miR-100 in GBM patients and the alterations of miR-100 levels

3.2 Diagnostic accuracy of miR-100 in GBM patients

Table 3 Multivariate analysis of prognostic factors for OS and PFS in GBM patients

3.4 Association between miR-100 expression and prognosis in GBM patients

4. Discussion

5. Conclusions

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
Correlation of serum miR-100 expression with clinicopathological characteristics of 95 GBM cases

Table 2
Primer sequences used in real-time PCR analysis of miR-100

Table 3
Multivariate analysis of prognostic factors for OS and PFS in GBM patients