Sage Journals: Discover world-class research

Abstract

The incidence rate of diminished ovarian reserve (DOR) is increasing, which is a difficult problem in the field of reproductive biology. The Ziyin Buyang Formula (ZYBYF), an empirical prescription for traditional Chinese medicine, is often used to improve the ovarian function of women with DOR. However, the underlying mechanism of this phenomenon remains unclear. This study was designed to identify the active components of ZYBYF and to further investigate the mechanism by which ZYBYF treats DOR through network pharmacological analysis and in vivo experiments. The network-based relationships between drug targets and disease-related proteins were screened, predicted, and constructed using a database. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were conducted using R software. AutoDock Vina 1.1.2 was used to perform the molecular docking analysis. In vivo experimental verification was carried out by enzyme-linked immunosorbent assay, histological observation and reverse transcription-polymerase chain reaction. A total of 137 common targets were identified between ZYBYF and DOR. GO and KEGG enrichment analyses suggested that these compounds were associated with the PI3K/AKT signaling pathway and MAPK signaling pathway. Furthermore, the molecular docking analysis revealed that quercetin strongly binds to MAPK1, AKT1, MYC, EGFR, and BCL2; luteolin strongly binds to EGFR, AKT1, and MAPK1; and kaempferol strongly binds to AKT1 and BCL2. In addition, in vivo experiments confirmed that ZYBYF can regulate the serum sex hormone levels, improve the ovarian function of DOR model rats, downregulate the expression of Mapk1 and Mapk14, and increase the levels of Akt1, Egfr, Myc, and Bcl2. ZYBYF improved ovarian function in DOR model rats by regulating the MAPK and PI3K/AKT signaling pathways. This study provides objective evidence that supports the use of ZYBYF in the clinical application of DOR.

Keywords

network pharmacology DOR PI3K/AKT MAPK molecular docking

Introduction

Diminished ovarian reserve (DOR) refers to a decrease in the number and/or quality of oocytes in the ovaries, accompanied by a decrease in the antral follicle count (AFC) and anti-Mullerian hormone (AMH) level as well as an increase in the follicle-stimulating hormone (FSH) level.^1,2 DOR represents a major challenge in reproductive medicine and may contribute to poor fertility outcomes. The concept of DOR is widely accepted, but its diagnostic criteria remain unclear. A review of the literature revealed that serum FSH level, AFC, and serum AMH level are the most commonly used indicators for evaluating ovarian reserve function.^3‐6 According to the Bologna criteria, an abnormal ovarian reserve test (AFC<5-7 follicles or AMH<0.5-1.1 ng/mL) could indicate a decrease in ovarian reserve function.⁷

In September 2021, the National Bureau of Statistics of China data showed that the incidence of infertility was as high as 12% to 18%, and the proportion of women aged 35 years and above who were older than the optimal reproductive age and who were registering for marriage in China was increasing annually. The trends in late marriage and infertility strongly correlated with one another. The liberalization of the “three-child policy” has gradually increased the proportion of patients with DOR in the infertile population. At present, in vitro fertilization-embryo transfer (IVF-ET) is widely used for clinical pregnancy assistance in DOR patients, but IVF cycle outcomes can be poor. DOR can progress to premature ovarian failure (POF) without timely intervention, which is an important cause of female infertility and affects female quality of life.

Currently, Western medicine-based therapies for DOR are based mainly on primary ovarian insufficiency therapies, such as hormone replacement therapy (HRT), which is an effective approach for alleviating the symptoms of hypoestrogenism, improving ovarian function and mitigating long-term health risks.⁸ However, there are concerns about the side effects of long-term HRT, such as an increased risk of breast cancer,⁹ endometrial hyperplasia and cancer,¹⁰ thrombotic stroke,¹¹ and venous thromboembolism.¹² In clinical settings, several traditional Chinese medicine(TCM) formulas are usually used to treat ovarian dysfunction and are believed to have curative effects. For example, the Erzhi Tiangui recipe could obviously improve ovarian reactivity and oocyte quality in elderly sterile women receiving IVF-ET¹³; Jian-Pi-Yi-Shen decoration could improve mitochondrial function and alleviate apoptosis through the apoptosis signal-regulating kinase 1/c-Jun N-terminal kinase (ASK1/JNK) pathway in a rat model of POF,¹⁴ and the Zuogui pill improved immune inflammatory injury in the ovary and exerted therapeutic effects on POF.¹⁵

Successful DOR treatment according to Professor Xia, a master of TCM, requires the restoration of the yin-yang balance in the patient's body. Professor Xia proposed the concept of “precise regulation of the menstrual cycle” based on the theoretical concepts of yin and yang from Yi Ching: that is, under normal physiological conditions, the female menstrual cycle should be divided into 4 phases (yin growing and yang declining in the late follicular phase; yang growing and yin declining in the luteal phase; extreme yang turning to yin in the menstrual period; and extreme yin turning to yang in the ovulatory phase). The growth and decline of yin and yang in the menstrual cycle are closely related to the changes that occur during the female reproductive and menstrual cycles. The dynamic balance between yin and yang may be required for a normal menstrual cycle and oocyte maturation as well as fertilization. Therefore, the treatment of female reproductive endocrine diseases should be grounded in reconstructing the menstrual cycle. Professor Xia reported that in the initial stage of DOR, egg development is delayed due to a deficiency of yin in the body in clinical practice. Over time, yin deficiency affects yang, so yin and yang may be impaired, resulting in follicular development stagnation and primordial follicle pool exhaustion.^16,17

Using “the method of regulating menstruation cycle” invented by Professor Xia, Professor Tan emphasized the core role of the balance of yin and yang in the female reproductive cycle and streamlined the concept of “precise regulation of the menstrual cycle” to the treatment of 2 core periods through clinical practice and experimental research, combined with the modern medical understanding of female reproductive endocrinology. The Ziyin Buyang Formula (ZYBYF) nourishes yin in the late follicular phase (postmenstrual phase) and tonifies yang in the luteal phase (premenstrual phase). According to TCM theory, the Ziyin Formula (ZYF), which consists of Angelicae Sinensis Radix, Paeoniae Radix Alba, Rehmanniae Radix Praeparata, Corni Fructus, and Semen Cuscutae, can promote oocyte development and improve oocyte quality by nourishing yin of the kidney, and the Buyang Formula (BYF), which consists of Morindae officinalis Radix, Dipsaci Radix, Psoraleae Fructus, Epimedii Folium, and Dioscoreae Rhizoma, can improve endometrial receptivity by tonifying yang of the kidney.^18,19 The components of ZYBYF are described in Table 1, with reference to the Chinese Pharmacopoeia of PR China (Chinese Pharmacopoeia Commission, 2010).

Table 1.

Name of Component, Source, and Pharmacological Characteristics.

Formula	Chinese name	Latin name	Source	Pharmacological characteristics
Ziyin Formula	Dang Gui	Angelicae Sinensis Radix	Angelica sinensis (Oliv.) Diels	To tonify blood and activate blood circulation, regulate menstruation and relieve pain, moisten intestines to relieve constipation
	Bai Shao	Paeoniae Radix Alba	Paeonia lactiflora Pall.	To tonify blood and regulate menstruation, constrain Yin and check sweating, soften the liver and relieve pain, calm liver Yang
	Di Huang	Rehmanniae Radix Praeparata	Rehmanniae glutinosa Libosch.	To nourish Yin and blood, tonify the kidney essence and fill lean marrow
	Shan Zhu Yu	Corni Fructus	Cornus officinalis Sieb. et Zucc	To tonify the liver and kidney, arrest discharge and relieve depletion
	Tu Si Zi	Cuscutae Semen	Cuscuta australis R. Br.	To tonify the liver and kidney, astringent essence, and reduce urination, brighten the eyes. Antidiarrheal, tocolysis. To dispel wind and eliminate spots by administered topically
Buyang Formula	Ba Ji Tian	Morindae Officinalis Radix	Morinda officinalis How	To tonify kidney Yang, strengthen tendons and bones, dispel rheumatism
	Xu Duan	Dipsaci Radix	Dipsacus asper Wall. ex Henry	To tonify the liver and kidney, strengthen tendons and bones, treat fracture, treat menometrorrhagia
	Bu Gu Zhi	Psoraleae Fructus	Psoralea corylifolia L.	To warm the kidney and activate Yang, normal inspiration and relieve asthma, warm spleen to antidiarrheal, dispel wind and eliminate spots by administered topically
	Yin Yang Huo	Epimedii Folium	Epimedium brevicornu Maxim.	To tonify kidney Yang, strengthen tendons and bones, dispel rheumatism
	Shan Yao	Dioscoreae Rhizoma	Dioscorea opposita Thunb.	To strengthen spleen and nourish stomach, generate fluid and tonify lung, nourish kidney and astringent essence

The ZYBYF has been proven to have satisfactory clinical efficacy against DOR,^20,21 but the mechanism of action of ZYBYF has not been determined. In our previous work, a competing endogenous RNA network for ovarian aging and a subnetwork of ZYBYF intervention were constructed to explore the underlying mechanism of ZYBYF in treating ovarian aging via bioinformatics methods.²² TCM compounds are rich in various active ingredients and are usually modulated through various pathways and targets. Therefore, elucidating the mechanism underlying the therapeutic effect of ZYBYF on DOR is necessary. Network pharmacology integrates multidisciplinary elements such as systems biology, multidirectional pharmacology, and network analysis to predict potential active ingredients and targets of action of Chinese medicines and to elucidate the mechanism of action of Chinese medicines.²³ Using these approaches, this study revealed the potential mechanisms through which ZYBYF treats DOR and provided relevant references for follow-up research and further evidence for the use of ZYBYF as a treatment for DOR.

Materials and Methods

Network Pharmacology Analysis

Compound Composition, Collection, and Screening

All of the bioactive compounds of ZYF (Angelicae Sinensis Radix, Paeoniae Radix Alba, Rehmanniae Radix Praeparata, Corni Fructus, Semen Cuscutae) and BYF (Morindae officinalis Radix, Dipsaci Radix, Psoraleae Fructus, Epimedii Folium, Dioscoreae Rhizoma) were obtained from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (http://old.tcmsp-e.com/tcmsp.php). The active components and potential targets were screened, using the following screening criteria: oral bioavailability ≥ 30% and drug likelihood ≥ 0.18. The reported active ingredients were verified a literature search. The selected protein targets were annotated by UniProt database (https://www.uniprot.org/).

Identifying the Targets of DOR

DOR-related targets were obtained from the Human Gene Database (GeneCards, https://www.genecards.org/), the DrugBank Database (https://go.drugbank.com/), the DisGeNET Database (https://www.disgenet.org/), the Pharmacogenetics and Pharmacogenomics Knowledge Base (PharmGkb, https://www.pharmgkb.org/), and the Online Mendelian Inheritance in Man database (https://www.omim.org/) with the keyword of “Diminished Ovarian Reserve”. The DOR targets were identified by removing duplicated targets after merging the results from searching the 5 disease databases. To identify the common targets between ZYBYF and DOR and to show the logical connections among them, Venn diagrams were constructed. The above results were visualized using Cytoscape 3.7.1 software.

PPI Network Construction and Hub Gene Screening

The common targets were imported into STRING (https://string-db.org/) to analyze the protein-protein interaction network (PPI). The biological specie was set as “Homosapiens”. The minimum interaction threshold was set as “highest confidence” (> 0.900), and the free nodes were hidden. The TSV file was downloaded and imported into the CytoNCA plug-in in CytoScape 3.7.1 to analyze the topology of the PPI network. The targets above the median of “degree center (DC)”, “intermediate center (BC)”, “near center (CC)”, “feature vector center (EC)”, “network center (NC)”, and “local average connection (LAC)” were selected as the core targets and screened twice.

GO and KEGG Enrichment Analyses

The biological processes and regulatory signaling pathways associated with ZYBYF treatment of DOR were explored using R software. The data package org.hs.eg. db in R language was used to convert the shared targets into Enterz IDs. Then, Gene Ontology (GO) functional (cell component, molecular function, and biological process) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the shared targets were conducted. The limiting conditions were set at a P value cutoff of 0.05, and a q value cutoff of 0.05.

Molecular Docking

Molecular docking, a technique that explores the interactions between receptors and ligands, was performed using AutoDock Vina 1.1.2.²⁴ On the basis of previous results from network pharmacology screening, the target proteins and the core components were identified. The protein receptor file, which contains the structure of the target protein, was obtained from the Protein Database Bank (PDB, http://www.rcsb.org/). The structures of the drug ligands were downloaded from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/). AutoDockTools 1.5.6 was used to prepare PDBQT files of macromolecule receptors and ligands. A rectangular cuboid grid box large enough to encompass any possible ligand was defined around the target protein to accommodate the free motion of ligands. The PyMOL Molecular Graphics System (Schrödinger, LLC.) was used to visualize the 20 highest-scoring docking conformations, and the conformers of the minimized free energy were selected as the actual binding mode.

Animal Experiments

Drug Preparation

ZYF (Angelicae Sinensis Radix 12 g, Paeoniae Radix Alba 12 g, Rehmanniae Radix Praeparata 10 g, Corni Fructus 10 g, and Semen Cuscutae 12 g) and BYF (Morindae officinalis Radix 15 g, Dipsaci Radix 12 g, Psoraleae Fructus 12 g, Epimedii Folium 10 g, and Dioscoreae Rhizoma 10 g) were purchased from the Affiliated Hospital of Nanjing University of Chinese Medicine. A mixture of herbs was soaked in distilled water for 30 min, heated to boiling, decocted for 30 min, and filtered. The filtrate was subsequently evaporated and concentrated to 1 g/mL of crude drug by a rotary evaporator and preserved at 4 °C.

DOR Rat Model Establishment

A total of 27 female Sprague-Dawley (SD) rats were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (SYXK 2021-0011). The rats were raised in a specific pathogen-free animal laboratory at 22 °C to 24 °C and 55% to 70% humidity and fed a standard diet. Vaginal smears were monitored daily to determine the regularity of the estrous cycle. The stage of the estrous cycle was determined as follows: proestrus (nucleated epithelial cell dominant), estrous (cornified epithelial cell dominant), metestrus (similar proportion of nucleated epithelial cells, cornified epithelial cells, and leukocytes), and diestrus (leukocyte dominant).²⁵ After 1 week of rearing balance, the rats were divided into 3 groups at random: the normal group, DOR group, and ZYBYF group (n=9/group). The rats in the DOR and ZYBYF groups received a single intraperitoneal injection of 90 mg/kg cyclophosphamide (CTX, Shanghai Yuanye Bio-Technology Co., Ltd, S30563—1 g).^26,27 The model was considered successfully if the estrous cycle was disrupted or prolonged. The rats in ZYBYF group were given ZYBYF for 21 days after CTX administration. During proestrus and estrus periods, 5.88 mg/kg of ZYF was given daily via intragastric administration based the difference in surface area between rats and humans. During the metestrus and diestrus periods, 6.195 mg/kg of BYF was given daily by intragastric administration. DOR model and normal rats were gavaged with a normal saline solution of equivalent volume. Research protocols for all of the experiments were reviewed and approved by Nanjing University of Chinese Medicine's Committee on Laboratory Animal Research (protocol number: 202201A002).

Enzyme-Linked Immunosorbent Assay

At the end of the experiment, the rats were intraperitoneally anesthetized with 20% sodium Ulatan (0.6 mL/100 g) while they were in diestrus. Blood was taken from the abdominal aorta, incubated at room temperature for 30 min, and then centrifuged at 3500 rpm for 15 min. The supernatant was removed. The serum levels of E₂, LH, FSH, and AMH were measured using enzyme-linked immunosorbent assay (ELISA) kits following the manufacturer's instructions (Jiangsu Jingmei Biological Technology).

General Histology of the Ovary: Histological Observation of Hematoxylin and Eosin-Stained Ovary Sections

After harvesting and cleaning, one ovary from each rat was formalin-fixed, paraffin embedded, and sectioned (5 µm). Hematoxylin and eosin (HE) staining of ovary samples was performed following standard HE staining procedures.

Reverse Transcription-Polymerase Chain Reaction

The other ovary of each rat was harvested and stored in a freezer at −80 °C for reverse transcription-polymerase chain reaction (RT-PCR). TRIzol reagent (Vazyme) was used to extract the total RNA according to the manufacturer's protocol. The RNA concentration was measured after TRIzol extraction, and reverse transcription was performed in a 20 µL reaction mixture, followed by RT-PCR. The mixture contained 2 µL of complementary DNA (cDNA) and primers at a concentration of 0.3 µmol/L. The cDNA was predenatured at 95 °C for 30 s, denatured at 95 °C for 5 s, annealed at 60 °C, and extended for 34 s for 40 cycles. The relative messenger RNA (mRNA) expression was analyzed using the 2^−ΔΔCt method, and β-actin was used as the internal reference. The primers were designed and synthesized by General Biosystems, Inc. The sequences of the primers used in this experiment are shown in Table 2.

Table 2.

List of Primer Sequences for RT-PCR.

Gene	Primer sequence
Mapk1	F- CAGTTCTTGACCCCTGGTCC
Mapk1	R- GTACATACTGCCGCAGGTCA
Mapk14	F- GCATAATGGCCGAGCTGTTG
Mapk14	R- TCATGGCTTGGCATCCTGTT
Egfr	F- GGTGAGTGGCTTGTCTGGAA
Egfr	R- CCTTACGCCCTTCACTGTGT
Myc	F- ACTAACATCCCACGCTCTGA
Myc	R- AAACCGCATCCTTGTCCTGT
Bcl2	F- AAAAATACAACATCACAGAGGAAGT
Bcl2	R- GTTTCCCCCTTGGCATGAGA
Akt1	F- GAAGACGGGAGCAGGCG
Akt1	R- CGCTCCCCGAGCCCA
GAPDH	F- CAGCCTCAAGATCATCAGCA
GAPDH	R- TGTGGTCATGAGTCCTTCCA

Abbreviations: F, forward primer; R, revise primer; RT-PCR, reverse transcription-polymerase chain reaction.

Statistical Methods

Statistical analyses were performed using one-way analysis of variance test with SPSS 23.0 (IBM SPSS, Version 23.0). GraphPad Prism 6 (GraphPad Software) was used for graphing. A statistically significant difference was defined as P < 0.05.

Results

Network Pharmacology-Based Analysis

he DOR-Related Targets of ZYBYF

After screening the databases and literature and deleting duplicate data, a total of 96 kinds of active components (3 active components of Psoraleae Fructus according to the literature)^28‐30 were obtained, as shown in Supplemental Tables 1 and 2. A total of 239 potential ZYBYF targets were obtained. A total of 1346 targets related to DOR were obtained, and a Venn diagram was constructed, as shown in Figure 1A. A total of 137 common targets were identified between ZYBYF and DOR, as shown in Figure 1B and Supplemental Table 3.

Figure 1.

Drug-disease target network construction. (A) DOR disease targets. (B) The common target of ZYBYF and DOR. (C) The network models of ZYBYF-DOR.

Construction of the ZYBYF Component-DOR-Related Target Network

After the import of the 137 common targets into CytoScape 3.7.1, the “ZYBYF components-DOR targets” network was constructed. In the network shown in Figure 1C, the circular nodes represent the active ingredients of ZYBYF (blue for ZYF and red for BYF). The square nodes represent the DOR-related targets of ZYBYF. This network comprehensively recapitulates the proteins involved in the treatment of DOR by ZYBYF. The topological analysis results are shown in Supplemental Table 4. The core targets with larger degree values are believed to play a major role in the treatment of DOR.

Topological Analysis of the PPI Network and Screening of Hub Gene

The STRING database platform was used to construct a PPI network and predict the related biological processes. After 137 common target genes were introduced into STRING, a PPI network was constructed to determine the ZYBYF-related PPI networks that act on DOR. The tab-separated values (TSV) file was downloaded, and CytoNCA was used to analyze the topology of the PPI network in CytoScape3.7.1. A total of 35 nodes and 167 interactive connections were screened from the PPI network according to the median (BC > 64.401, CC > 0.112, DC > 5.000, EC > 0.037, LAC > 1.333, and NC > 2.250). Subsequently, 12 nodes and 45 interactive connections were further screened based on the first screening results (BC > 14.888, CC > 0.548, DC > 8.000, EC > 0.133, LAC > 3.714, and NC > 4.667). The final results showed that MAPK14, MYC, ESR1, IL2, HIF1A, AKT1, STAT1, CDKN1A, MAPK1, EGFR, JUN, and HSP90AA1 were the hub genes of ZYBYF in the treatment of DOR. In addition, the CytoHubba app was used to search for the core targets. The results revealed 15 hub genes. According to 2 different screening methods, a total of 10 final hub genes were obtained, MAPK1, MAPK14, MYC, STAT1, AKT1, CDKN1A, ESR1, HIF1A, HSP90AA1, and JUN. The process of hub gene screening is shown in Figure 2.

Figure 2.

Core gene screening in the PPI network.

GO Functional and KEGG Pathway Enrichment Analysis

GO functional enrichment analysis of 137 common targets was conducted with the condition of P < 0.05. A total of 2194 biological processes (BPs), 65 cell components (CCs), and 127 molecular functions (MFs) were enriched. Twenty most significant differentially expressed genes (DEGs) were enriched in response to oxidative stress, reactive oxygen species, cellular response to chemical stress, and regulation of response to a steroid hormone. In addition, the main enriched cell components included vesicle, lumen, and secretory granule lumen. The enriched molecular function terms were associated with steroid hormone receptor binding and activity. A GO enrichment network diagram is shown in Figure 3A.

Figure 3.

GO and KEGG enrichment analyses. (A) GO enrichment of ZYBYF active components in the treatment of common targets of DOR. (B) Enriched KEGG pathways of potential targets for treating DOR from the main active ingredients of ZYBYF. (C) Expression of ZYBYF-DOR common genes in related pathways. Red indicates apoptosis-related gene expression level, pink indicates cellular senescence-related gene expression level, yellow indicates endocrine resistance-related gene expression level, blue indicates estrogen signaling pathway-related gene expression level, purple indicates MAPK signaling pathway-related gene expression level, brown indicates NF-kB signaling pathway-related gene expression level, orange indicates p53 signaling pathway-related gene expression level, green indicate PI3K/AKT signaling pathway-related gene expression level. Abbreviations: BP, biological process; CC, cellular component; DOR, diminished ovarian reserve; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; MF, molecular function; ZYBYF, Ziyin Buyang Formula.

KEGG pathway enrichment analysis of 137 common targets was also conducted with the criterion of P < 0.05. The results revealed 166 enriched pathways. Among the top 50 signaling pathways shown in Figure 3B, endocrine resistance, the phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) signaling pathway, apoptosis, the nuclear factor kappa-B (NF-κB) signaling pathway, the p53 signaling pathway, the mitogen-activated protein kinase (MAPK) signaling pathway, cellular senescence, and the estrogen signaling pathway were closely related to the mechanism of ZYBYF in the treatment of DOR.

Pathway Analysis of ZYBYF Treatment of DOR

After introducing 137 common target genes into STRING and downloading the TSV file, the analysis results were visualized by CytoScape 3.7.1. The results showed that 8 hub genes (MAPK1, AKT1, EGFR, MYC, BCL2, HSP90AA1, IL2, and CDKN1A) were enriched mainly in the PI3K/AKT signaling pathway, while 6 hub genes (MAPK1, AKT1, EGFR, MYC, MAPK14, and JUN) were enriched mainly in the MAPK signaling pathway, as shown in Figure 3C.

Multiple studies have shown that the PI3K/AKT and MAPK signaling pathways are closely related to the occurrence and progression of DOR.^27,31 In the present study, the PI3K/AKT and MAPK signaling pathways were further analyzed to explore the mechanism by which ZYBYF treats DOR. The results showed that MAPK1, AKT1, EGFR, and MYC were enriched mainly in the PI3K/AKT and MAPK signaling pathways. BCL2 and MAPK14 are important members of these 2 signaling pathways. Therefore, the expression levels of Mapk1, Akt1, Egfr, Myc, Bcl2, and Mapk14 were evaluated in vivo to verify the mechanism of ZYBYF in the treatment of DOR.

Molecular Docking Analysis

Ten key genes, namely, MAPK1, MAPK14, MYC, STAT1, AKT1, CDKN1A, ESR1, HIF1A, HSP90AA1, and JUN, were identified by screening the core targets. The core genes were selected for small-molecule-protein molecular docking with the active ingredients of quercetin, luteolin, and kaempferol, whose number of effect targets was currently top 3. Molecular docking algorithms perform quantitative prediction based on binding energetics,³² which allows the comparison of the binding affinities of molecular ligands and protein receptors. Molecular docking algorithms also rank docked compounds based on binding energy. The lower the binding energy is, the stronger the interaction between the ligand and the receptor. The minimum binding energies of each active compound and target were recorded and are shown in Table 3. The docking process of quercetin with 9, luteolin with 6, and kaempferol with 5 core targets are shown in Figure 4. The molecular docking analysis revealed that quercetin strongly binds to MAPK1, AKT1, MYC, EGFR, and BCL2, luteolin strongly binds to EGFR, AKT1, and MAPK1, and kaempferol strongly binds to AKT1 and BCL2.

Figure 4.

Molecular docking of compounds with core targets. (A)-(I) Docking progress of quercetin with EGFR, MAPK1, HIF1A, MYC, HSP90AA1, AKT1, JUN, STAT1, and BCL2. (J)-(O) Docking progress of luteolin with HSP90AA1, EGFR, AKT1, CDKN1A, MAPK1, and JUN. (P)-(T) Docking progress of kaempferol with HSP90AA1, AKT1, JUN, STAT1, and BCL2.

Table 3.

Binding Energy of Active Compounds and Targets.

Target	Compound	Binding energy (kcal/mol)
EGFR	Quercetin	−5.3
MAPK1	Quercetin	−8.4
HIF1A	Quercetin	−7.3
MYC	Quercetin	−8.1
HSP90AA1	Quercetin	−7.0
AKT1	Quercetin	−5.6
JUN	Quercetin	−8.3
STAT1	Quercetin	−7.1
BCL2	Quercetin	−6.7
HSP90AA1	Luteolin	−7.9
EGFR	Luteolin	−6.0
AKT1	Luteolin	−6.1
CDKN1A	Luteolin	−5.5
MAPK1	Luteolin	−8.5
JUN	Luteolin	−8.2
HSP90AA1	Kaempferol	−7.8
AKT1	Kaempferol	−5.8
JUN	Kaempferol	−9.2
STAT1	Kaempferol	−7.5
BCL2	Kaempferol	−7.8

In Vivo Study Results

Sex Hormone Levels

The results showed that the AMH and E₂ levels of rats in the DOR group were significantly lower than those in the normal group, while the FSH level was significantly higher (P < 0.05). The AMH and E₂ levels in the ZYBYF group were significantly higher than those in the DOR group, while the FSH level was significantly lower. Moreover, there was no significant difference in the LH level among the 3 groups (Figure 5A). These data suggested that ZYBYF had a modest effect on cyclophosphamide-induced DOR.

Figure 5.

Validation of animal experiments. (A) Serum hormone levels of AMH, E₂, LH, and FSH. The concentrations of serum AMH, E₂, LH, and FSH levels were measured by ELISA. N = 9, error bars indicate SD. *P < 0.05. The data are analyzed by one-way ANOVA test. (B) Expression of related mRNA. N = 9, data are expressed as the mean± SD, *P < 0.05. (C) Hematoxylin and eosin staining of ovarian tissues in each group. Scale bar= 200 µm / 50 µm.

General Histology of the Ovary

HE staining of the ovarian tissues from each group is shown in Figure 5C. Histopathological analysis revealed that ovaries from the normal group had standard ovarian histoarchitecture with numerous ovarian follicles in different stages of development, including primary follicles, gonadal follicles with cumulus oophori, corpora lutea, and a few atretic follicles. In the DOR group, the number of mature follicles was significantly reduced, and the number of atretic follicles was increased. There were fewer granule cell layers, and the layers were arranged loosely and irregularly. The ovarian interstitial structure was also disrupted by fibrosis. The number of follicles and corpora lutea in the ZYBYF group was higher than that in the DOR group. These results confirmed the protective effect of ZYBYF on the ovarian reserve.

The mRNA Expressions of the Key Targets

Compared with those in the normal group, the expression levels of Mapk1 and Mapk14 mRNA in the rat ovarian tissue of the DOR group were significantly increased (P < 0.05), while the expression levels of Akt, Egfr, Myc, and Bcl2 mRNA were significantly decreased (P < 0.05). Compared with those in the DOR group, the expression levels of Mapk1 and Mapk14 mRNAs in the rat ovarian tissue of the ZYBYF group were significantly decreased (P < 0.05), while the expression levels of Akt, Egfr, Myc, and Bcl2 mRNAs were significantly increased (P < 0.05), as shown in Figure 5B.

Discussion

Currently, DOR infertility is a common and difficult-to-treat disease worldwide. Although rapid advances in assisted reproductive technology have been made, the overall pregnancy outcomes of DOR patients are still unsatisfactory. IVF-ET cycles in women with DOR have been reported to be associated with a low ovarian response, cycle cancelation, and poor pregnancy outcomes. These phenomena might be related to mitochondrial degeneration and the decreased repair capacity of oocytes. The age of the mother has been demonstrated to impact oocyte and DNA damage repair capacities. DNA repair capacities decline with age.^33,34 Professor Xia suggested that the use of a large amount of exogenous gonadotropins for ovarian stimulation in IVF may induce the secretion of large quantities of Tiangui (a product of the kidney Qi in TCM) within a short period of time, which may consume kidney yin, the substance required for egg development. Therefore, DOR patients have few retrieved oocytes, oocytes, and embryos of poor quality, and, in some cases, no transplantable embryos. On the other hand, oocyte retrieval could lead to luteal insufficiency and failure of deficient kidney yang, which leads to low pregnancy rates after embryo transfer. Professor Tan used ZYF in the process of controlled ovarian stimulation to compensate for the damaging effects of exogenous gonadotropins on kidney yin and to increase the number and quality of retrieved oocytes. After oocyte retrieval, BYF is used to improve luteal function and the pregnancy rate.

Based on the results of network pharmacology and molecular docking, quercetin, luteolin and kaempferol were found to be the active components of ZYBYF whose number of effect targets was top 3. Quercetin has been shown to have anti-inflammatory, antiapoptotic, and antioxidative effects. Quercetin is also involved in cell cycle progression and mitochondrial protein synthesis.^35‐39 Animal experiments have confirmed that quercetin can increase ovarian volume and the number of primary follicles and prevent morphological changes such as follicular cell degeneration hemorrhage, vascular congestion, and edema.^40,41,42 Luteolin has been reported to alleviate polycystic ovary syndrome in rats by resolving insulin resistance and oxidative stress.⁴³ Also, luteolin could increase serum estradiol levels and improve the histological structure of ovaries in lactating female rats.⁴⁴ Kaempferol has been shown to have antioxidant effects, scavenge reactive oxygen species (ROS), inhibit apoptosis, and contribute to cellular protection.^45,46

Topological analysis confirmed that MAPK14, MYC, ESR1, IL2, HIF1A, AKT1, STAT1, CDKN1A, MAPK1, EGFR, JUN, and HSP90AA1 were the hub genes associated with ZYBYF treatment of DOR. GO functional enrichment analysis revealed that the main biological processes included oxidative stress and the stress response. KEGG pathway enrichment analysis revealed that BCL2 participated in the PI3K/AKT signaling pathway, apoptosis, endocrine resistance, the NF-κB signaling pathway, the p53 signaling pathway, and the estrogen signaling pathway. The PI3K/AKT signaling pathway is a key pathway involved in the regulation of ovarian function and can regulate the quiescence, activation, and development of primordial follicles. It can also induce granulosa cell proliferation and differentiation, meiosis, and the maturation of oocytes to govern primordial follicle recruitment and growth.^47,48 Several recent studies demonstrated that excessive activation of the PI3K/AKT signaling pathway reduces DNA repair and accelerates ovarian aging.³³ However, Akt knockout mice develop multiple severe growth abnormalities, indicating the pivotal role of Akt in cell survival and differentiation.⁴⁹ In addition, the inhibition of PI3K/AKT signaling in class I cumulus-oocyte complex (COC) significantly decreases the development of embryos by reducing oocyte maturation and initiating apoptosis.^50,51,52 Previous reports have shown that the antioxidant activity of melatonin improves embryo development through the enhancement of oocyte maturation, cumulus cell expansion, and protection from DNA fragmentation under the stress of AKT inhibition.⁵³ On the basis of these findings, as well as our own study, we considered that the inhibition of PI3K/AKT signaling may be associated with decreased oocyte quality and reduced fecundability in DOR patients. The MAPK signaling pathway is closely related to the inflammatory response and apoptosis and is involved in follicular development and ovulation.⁵⁴

It has been found that Bcl-2-associated X protein (BAX), a proapoptotic factor, can promote follicular atresia by initiating apoptosis, while BCL2 can antagonize the proapoptotic effect of BAX to inhibit granulosa cell apoptosis.⁵⁵ Therefore, BCL2, a negative regulator of apoptosis, is a positive regulator of ovarian function. The BCL2/BAX ratio plays key role in ovarian granulocyte apoptosis. The results of our study showed that the expression of Bcl-2 mRNA in the ovarian tissue of rats in the DOR group was significantly downregulated compared to that in the normal group and that treatment with ZYBYF could upregulate the expression of Bcl-2.

A study has proven that MYC silencing retarded Drosophila oocyte maturation and delayed DNA replication progression.⁵⁶ At present, most scholars believe that the absence of MYC accelerates oocyte loss and results in diminished ovarian reserve.⁵⁷ The present study showed that the expression level of Myc mRNA in the ovarian tissue of rats in the DOR group was significantly lower than that in the normal group, and ZYBYF intervention increased the expression level of Myc to a certain extent.

The AKT1 protein plays a role in regulating cell growth, survival, and proliferation. In vitro, AKT1 inhibition led to poor embryo quality.⁵³ EGFR is involved in the recruitment, development, and maturation of follicles through the MAPK and PI3K/AKT signaling pathways.⁵⁸ Melatonin can increase the level of Egfr to improve the ovarian reserve.⁵⁹ In our study, the expression of the Akt1 and Egfr mRNAs in the DOR group was significantly lower than that in the normal group, and treatment with ZYBYF upregulated the expression of both Akt1 and Egfr.

MAPK1 (also known as ERK2) is a downstream effector of EGFR. Cd treatment enhances oxidative stress, damages ovarian function, and significantly decreases oocyte quality in rats through the overexpression of ERK2.⁶⁰ High-fat and high-sugar diets can induce a mouse model of premature ovarian failure through upregulating the expression of Mapk14 in the mouse ovary.⁶¹ The expression of Mapk1 and Mapk14 mRNAs was upregulated in the DOR group, while both were downregulated in the ZYBYF group.

As a preliminary exploration, this study has several limitations. First, the targets obtained from the network pharmacology of ZYBYF were determined by superimposing the predicted targets of each Chinese medicine component. However, the practical components of TCM prescriptions used in actual experiments or in clinical application are more complex than the single components of TCM because of differences in the methods used for drug preparation. This phenomenon needs to be studied further. We will conduct experiments in the later stage to further explore the mechanism of ZYBYF through screening the bioactive compounds by the chemical identification of plasma in rats after drug administrated and targeted identification of components in ZYBTF using standards for compounds. Second, we merely performed in vivo experiments, and in vitro as well as large-sample multicenter controlled clinical trials will be performed in our future studies.

In summary, our study preliminarily explored the underlying mechanisms of ZYBYF in the treatment of DOR. Treatment with ZYBYF increased the serum levels of AMH and E₂, decreased the serum level of FSH and improved the development of follicles by inhibiting overactivation of the MAPK signaling pathway and activating the PI3K/AKT signaling pathway.

Conclusions

In this study, network pharmacological analysis combined with molecular docking and in vivo verification were conducted to explore the underlying mechanism of action of ZYBYF against DOR. Ninety-six kinds of active components with 239 potential targets were obtained from the database and the literature. Topological analysis and pathway enrichment analysis revealed that ZYBYF acts on the PI3K/AKT and MAPK signaling pathways and other signaling pathways. The molecular docking analysis revealed that quercetin strongly binds to MAPK1, AKT1, MYC, EGFR, and BCL2, luteolin strongly binds to EGFR, AKT1, and MAPK1, and kaempferol strongly binds to AKT1 and BCL2. Furthermore, in vivo experiments confirmed that ZYBYF acts on DOR by inhibiting the overactivation of MAPK signaling pathways and activating the PI3K/AKT signaling pathway. This research provides objective evidence supporting the use of ZYBYF in the clinical treatment of DOR. Moreover, this study demonstrated that ZYBYF embodied the of multicomponent, multitarget, and multipathway characteristics of TCM. The present study provides theoretical support and objective data for the clinical application of ZYBYF in the treatment of DOR and offers a basis for future in-depth research on the mechanism of ZYBYF in DOR treatment.

Supplemental Material

sj-docx-1-npx-10.1177_1934578X241242281 - Supplemental material for Network Pharmacology and In Vivo Validation to Explore the Potential Active Ingredients and Mechanisms of Ziyin Buyang Formula in Diminished Ovarian Reserve

Supplemental material, sj-docx-1-npx-10.1177_1934578X241242281 for Network Pharmacology and In Vivo Validation to Explore the Potential Active Ingredients and Mechanisms of Ziyin Buyang Formula in Diminished Ovarian Reserve by Ruxin Wang, Haixia Huang, Wenchen Du, Guicheng Xia and Yong Tan in Natural Product Communications

Footnotes

Acknowledgments

We are grateful to Professor Xia and Professor Tan for their guidance and assistance with our studies.

Authors Contributions

RW and HH designed the study, conducted experimental work, analyzed the data and drafted the manuscript. WD provided assistance on the experimental work. YT and GX provided critical comments. YT revised the manuscript. All authors read and approved the final version of the manuscript.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by National Natural Science Foundation of China (82330125 and 82174425); Jiangsu Province Graduate Student Practice innovation program (SJCX23_0797); and Jiangsu Provincial Health Planning Commission Science, Education, and Health Strengthening Project: Jiangsu Provincial Clinical Medical Center of Gynecology of Traditional Chinese Medicine (YXZXB2016006).

Ethical Approval

Ethical approval to report this case was obtained from Nanjing University of Chinese Medicine's Committee on Laboratory Animal Research, Jiangsu Province, China.

Informed Consent

There are no human subjects in this article and informed consent is not applicable.

Statement of Human and Animal Rights

Research protocols for all of the experiments were reviewed and approved by Nanjing University of Chinese Medicine's Committee on Laboratory Animal Research Jiangsu Province, China (protocol number: 202201A002).

ORCID iD

Ruxin Wang

Supplemental Material

Supplemental material for this article is available online.

References

Practice Committee of the American Society for Reproductive Medicine. Electronic address AAO, practice committee of the American Society for reproductive M. Testing and interpreting measures of ovarian reserve: a committee opinion. Fertil Steril. 2020;114(6):1151‐1157.

Chen

Tian

Qiao

, et al. Chinese expert consensus on premature ovarian insufficiency. Chin J Obstet Gynecol. 2017;52(9):577–581.

Kara

Aydin

Aran

Turktekin

Ozdemir

. Does dehydroepiandrosterone supplementation really affect IVF-ICSI outcome in women with poor ovarian reserve? Eur J Obstet Gynecol Reprod Biol. 2014;173(2):63‐65.

Check

Summers-Chase

Yuan

Horwath

Wilson

. Effect of embryo quality on pregnancy outcome following single embryo transfer in women with a diminished egg reserve. Fertil Steril. 2007;87(4):749‐756.

Zhang

, et al. Dehydroepiandrosterone improves follicular fluid bone morphogenetic protein-15 and accumulated embryo score of infertility patients with diminished ovarian reserve undergoing in vitro fertilization: a randomized controlled trial. J Ovarian Res. 2014;7(10):93.

Jayaprakasan

Narkwichean

Maalouf

Campbell

. Efficacy of dehydroepiandrosterone to overcome the effect of ovarian ageing (DITTO): a proof of principle randomised controlled trial protocol. BMJ Open. 2014;4(10):e005767.

Ferraretti

La Marca

Fauser

, et al. ESHRE Consensus on the definition of 'poor response' to ovarian stimulation for in vitro fertilization: the Bologna criteria. Hum Reprod. 2011;26(7):1616‐1624.

Committee Opinion No. 698. Hormone therapy in primary ovarian insufficiency. Obstet Gynecol. 2017;129(5):e134‐e141.

Anonymous . Breast cancer and hormone replacement therapy: collaborative reanalysis of data from 51 epidemiological studies of 52,705 women with breast cancer and 108,411 women without breast cancer. Collaborative Group on Hormonal Factors in Breast Cancer. Lancet. 1997;350(9084):1047‐1059.

10.

Furness

Roberts

Marjoribanks

Lethaby

. Hormone therapy in postmenopausal women and risk of endometrial hyperplasia. Cochrane Datab Syst Rev. 2012;2012(8):CD000402.

11.

Zhao

Yang

. Risk of stroke in healthy postmenopausal women during and after hormone therapy: a meta-analysis. Menopause. 2014;21(11):1204‐1210.

12.

Canonico

Plu-Bureau

O'Sullivan

, et al. Age at menopause, reproductive history, and venous thromboembolism risk among postmenopausal women: the Women's Health Initiative Hormone Therapy clinical trials. Menopause. 2014;21(3):214‐220.

13.

Lian

Wang

ZHang

Sun

. Effect of Erzhi Tiangui recipe on ovarian reactivity in elderly sterile women. Zhongguo Zhong Xi Yi Jie He Za Zhi. 2006;26(8):685‐688.

14.

Jiang

Tai

Kuang

, et al. Jian-Pi-Yi-Shen decoction inhibits mitochondria-dependent granulosa cell apoptosis in a rat model of POF. Aging (Albany NY). 2022;14(20):8321‐8345.

15.

Zhu

Luo

Zhu

. Protective effect of Zuogui pill on ovarian autoimmune injury. Zhongguo Zhong Xi Yi Jie He Za Zhi. 2005;25(10):920‐924.

16.

Xia

. Xia Guicheng TCM gynecological diagnosis and treatment manual. China Press of Traditional Chinese Medicine; 2017:448.

17.

Tan

. Chinese medicine master Xia Guicheng gynecology clinical experience. People’s Medical Publishing House; 2022:120.

18.

Wang

Tan

. Analysis of experience of Tan Yong in treating diminished ovarian reserve. Clin J Tradit Chinese Med. 2021;33(06):1060‐1064.

19.

Huang

. A probe into Tan Yong’s experience of treating infertility due to premature ovarian dysfunction. Jiangsu J Tradit Chin Med. 2019;51(10):17‐19.

20.

Wang

. Clinical study on sequential therapy of nourishing Yin and Tonifying Yang prescription combined with ART in infertility due to diminished ovarian reserve . Master's Degree. Nanjing University of Chinese Medicine; 2021.

21.

Huang

. Clinical observation on the treatment of POI infertility, with nourishing Yin and Tonifying Yang decoction combined with femoston . Master's Degree. Nanjing University of Chinese Medicine; 2020.

22.

Huang

Wang

Xia

Tan

. Bioinformatics-based study of the ceRNA network and the sub-network of the Ziyin Buyang Formula in premature ovarian failure due to ovarian tumour therapy. Eur J Gynaecol Oncol. 2023;44(3):35‐42.

23.

Zhang

Huai

Miao

Qian

Wang

. Systems pharmacology for investigation of the mechanisms of action of traditional Chinese medicine in drug discovery. Front Pharmacol. 2019;10(7):743.

24.

Trott

Olson

. Autodock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem. 2010;31(2):455‐461.

25.

Barker

Kind

Groves

Howarth

Whittaker

. Oestrous phase cyclicity influences judgment biasing in rats. Behav Processes. 2018;157:678‐684.

26.

Jiang

Wang

Zhang

, et al. Protective effects and possible mechanisms of actions of Bushen Cuyun recipe on diminished ovarian reserve induced by cyclophosphamide in rats. Front Pharmacol. 2020;11(5):546.

27.

Liu

Chen

Liu

, et al. Zihuai recipe alleviates cyclophosphamide-induced diminished ovarian reserve via suppressing PI3K/AKT-mediated apoptosis. J Ethnopharmacol. 2021;277(9):113789.

28.

Cao

Tian

, et al. Five different processing methods induced variations in composition and content of liposoluble and volatile constituents of Psoralea corylifolia. Chin Tradit Patent Med. 2021;43(09):2418‐2427.

29.

Qin

Wang

Xing

, et al. Effects of prenylated compounds derived from Psoralea corylifolia against human CYP1A1 and corresponding molecular docking validation. J Nanjing Univ Tradit Chin Med. 2021;37(05):750‐759.

30.

Wang

Zhang

, et al. Study on alleviating effect of Glycyrrhizae Radix et Rhizoma on Psoraleae fructus-induced liver injury based on network pharmacology and cell experiments. China J Chin Mater Med. 2022;47(01):176‐187.

31.

Hong

Peng

, et al. miR-106a increases granulosa cell viability and is downregulated in women with diminished ovarian reserve. J Clin Endocrinol Metab. 2018;103(6):2157‐2166.

32.

Ferreira

Dos Santos

Oliva

Andricopulo

. Molecular docking and structure-based drug design strategies. Molecules. 2015;20(7):13384‐13421.

33.

Maidarti

Anderson

Telfer

. Crosstalk between PTEN/PI3K/Akt signalling and DNA damage in the oocyte: implications for primordial follicle activation, oocyte quality and ageing. Cells. 2020;9(1):200.

34.

Zhang

Zeng

, et al. Increased DNA damage and repair deficiency in granulosa cells are associated with ovarian aging in rhesus monkey. J Assist Reprod Genet. 2015;32(7):1069‐1078.

35.

Zeng

Song

Zhang

Wang

Zhang

Suo

. Comparison of in vitro and in vivo antioxidant activities of six flavonoids with similar structures. Antioxidants (Basel). 2020;9(8):732.

36.

Yao

Han

, et al. Quercetin, inflammation and immunity. Nutrients. 2016;8(3):167.

37.

Wang

Cui

. Antioxidant activities of quercetin and its complexes for medicinal application. Molecules. 2019;24(6):1123.

38.

Hashemzaei

Delarami Far

Yari

, et al. Anticancer and apoptosis-inducing effects of quercetin in vitro and in vivo. Oncol Rep. 2017;38(2):819‐828.

39.

Silva

AAA

Silva

MNP

Figueiredo

LBF

, et al. Quercetin influences in vitro maturation, apoptosis and metabolically active mitochondria of goat oocytes. Zygote. 2018;26(6):465‐470.

40.

Bolouki

Zal

Bordbar

. Ameliorative effects of quercetin on folliculogenesis in diabetic mice: a stereological study. Gynecol Endocrinol. 2020;36(10):864‐868.

41.

Elkady

Shalaby

Fathi

El-Mandouh

. Effects of quercetin and rosuvastatin each alone or in combination on cyclophosphamide-induced premature ovarian failure in female albino mice. Hum Exp Toxicol. 2019;38(11):1283‐1295.

42.

Nna

Usman

Ofutet

Owu

. Quercetin exerts preventive, ameliorative and prophylactic effects on cadmium chloride-induced oxidative stress in the uterus and ovaries of female Wistar rats. Food Chem Toxicol. 2017;102(4):143‐155.

43.

Huang

Zhang

. Luteolin alleviates polycystic ovary syndrome in rats by resolving insulin resistance and oxidative stress. Am J Physiol Endocrinol Metab. 2021;320(6):E1085‐E1092.

44.

Shawky

Nassra

El-Alkamy

AMT

Sallam

El Sohafy

. Unraveling the mechanisms of Fenugreek seed for managing different gynecological disorders: steroidal saponins and isoflavones revealed as key bioactive metabolites. J Pharm Biomed Anal. 2024;238(1):115865.

45.

Kouhestani

Jafari

Babaei

. Kaempferol attenuates cognitive deficit via regulating oxidative stress and neuroinflammation in an ovariectomized rat model of sporadic dementia. Neural Regen Res. 2018;13(10):1827‐1832.

46.

Zhu

Tang

Zhang

, et al. Kaempferol slows intervertebral disc degeneration by modifying LPS-induced osteogenesis/adipogenesis imbalance and inflammation response in BMSCs. Int Immunopharmacol. 2017;43(2):236‐242.

47.

Hoshino

Yokoo

Yoshida

Sasada

Matsumoto

Sato

. Phosphatidylinositol 3-kinase and Akt participate in the FSH-induced meiotic maturation of mouse oocytes. Mol Reprod Dev. 2004;69(1):77‐86.

48.

Kalous

Solc

Baran

Kubelka

Schultz

Motlik

. PKB/AKT is involved in resumption of meiosis in mouse oocytes. Biol Cell. 2006;98(2):111‐123.

49.

Dummler

Hemmings

. Physiological roles of PKB/Akt isoforms in development and disease. Biochem Soc Trans. 2007;35(Pt 2):231‐235.

50.

Ashry

Rajput

Folger

, et al. Functional role of AKT signaling in bovine early embryonic development: potential link to embryotrophic actions of follistatin. Reprod Biol Endocrinol. 2018;16(1):1.

51.

Chrysis

Zaman

Chagin

Takigawa

Sävendahl

. Dexamethasone induces apoptosis in proliferative chondrocytes through activation of caspases and suppression of the Akt-phosphatidylinositol 3'-kinase signaling pathway. Endocrinology. 2005;146(3):1391‐1397.

52.

Jeong

S-J

Dasgupta

Jung

K-J

, et al. PI3K/AKT inhibition induces caspase-dependent apoptosis in HTLV-1-transformed cells. Virology. 2008;370(2):264‐272.

53.

El Sheikh

Mesalam

Idrees

Lee

Kong

. Melatonin abrogates the anti-developmental effect of the AKT inhibitor SH6 in bovine oocytes and embryos. Int J Mol Sci. 2019;20(12):2956.

54.

Yang

Wang

Yang

. IL-1alpha up-regulates IL-6 expression in bovine granulosa cells via MAPKs and NF-kappaB signaling pathways. Cell Physiol Biochem. 2017;41(1):265‐273.

55.

Xia

Qin

Wang

. Effects of low intensity pulsed ultrasound on expression of B-cell lymphoma-2 and BCL2-associated X in premature ovarian failure mice induced by 4-vinylcyclohexene diepoxide. Reprod Biol Endocrinol. 2021;19(1):113.

56.

Maines

Stevens

Tong

Stein

. Drosophila dMyc is required for ovary cell growth and endoreplication. Development. 2004;131(4):775‐786.

57.

Bestetti

Barbieri

Sironi

, et al. Targeted whole exome sequencing and Drosophila modelling to unveil the molecular basis of primary ovarian insufficiency. Hum Reprod. 2021;36(11):2975‐2991.

58.

Wee

Wang

. Epidermal growth factor receptor cell proliferation signaling pathways. Cancers (Basel). 2017;9(5):52.

59.

Yang

Chen

, et al. Melatonin: multi-target mechanism against diminished ovarian reserve based on network pharmacology. Front Endocrinol (Lausanne). 2021;12(4):630504.

60.

Kechiche

Venditti

Knani

, et al. First evidence of the protective role of melatonin in counteracting cadmium toxicity in the rat ovary via the mTOR pathway. Environ Pollut. 2021;270(2):116056.

61.

Liu

Lin

Chen

, et al. MicroRNA-146b-5p overexpression attenuates premature ovarian failure in mice by inhibiting the Dab2ip/Ask1/p38-Mapk pathway and gammaH2A.X phosphorylation. Cell Prolif. 2021;54(1):e12954.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.07 MB