Sage Journals: Discover world-class research

Abstract

The traditional Chinese medicine (TCM) formula Ento-PB containing Periplaneta americana (Linnaeus) (Blattidae) and Taraxacum mongolicum Hand.-Mazz. (Compositae) has great potential for treating inflammation. This study explored the effects of Ento-PB on ulcerative colitis (UC). The UC model was induced with 2,4,6-trinitrobenzene sulfonic acid (TNBS) by enema. Male Sprague–Dawley rats (n = 32) were divided into four groups: (1) control group that received 2.5 mL/kg normal saline, (2) TNBS group that received 2.5 mL/kg normal saline, (3) Ento-PB low-dose group that received 100 mg/kg Ento-PB, and (4) Ento-PB high-dose group that received 200 mg/kg Ento-PB. Rats were administered drugs via enema for 14 days after modeling. The disease activity index (DAI), colon mucosa damage index (CMDI), histopathological score (HS), levels of interleukin-8 (IL-8), IL-10, IL-17, tumor necrosis factor-α (TNF-α), and C-reactive protein (CRP) in serum, contents of IL-2, myeloperoxidase (MPO), transforming growth factor-β1 (TGF-β1), and epidermal growth factor (EGF) in the colon, and abundance of Bifidobacterium, Lactobacillus, Enterococcus, Bacteroides, and Escherichia coli were assessed. Ento-PB administration showed a significant reduction in DAI, CMDI, and HS, contents of IL-2, IL-8, IL-17, TNF-α, CRP, and MPO, and a significant increase in the levels of IL-10, TGF-β1, and EGF. Compared with the TNBS-administered group, the abundance of Bifidobacterium, Lactobacillus, Enterococcus, and E. coli decreased, while an obvious increase in the proportion of Bacteroides was found in the Ento-PB-administered groups. Ento-PB alleviated inflammation in UC by regulating the equilibrium of Th1/Th17/Treg cytokines and recovering the imbalance between the gut microbiota. Applying Ento-PB in treating UC could be suggested.

Keywords

2,4,6-trinitrobenzene sulfonic acid Th1/Th17/Treg cytokines gut microbiota

Introduction

Limited to the colon and rectum, ulcerative colitis (UC) is a chronic nonspecific inflammation characterized by repeated relapse and remission. The morbidity of UC has increased rapidly worldwide, which makes UC one of the severe diseases that influences people's health.^1–3 Edema, hyperemia, erosion, ulcers in the colon mucosa, diarrhea, bloody feces, and abdominal pain are observed in UC patients.⁴ In addition, the pathogenesis of UC is unclear, and it is believed that abnormal immune responses, gut microbiota, mucosal barrier disorder, and other factors contribute to the incidence of UC.⁵ Currently, nonsteroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, and immunosuppressant drugs are popular treatments for UC. However, these drugs are limited in clinical application because of their side effects, such as allergies, anti-antibody reactions, and infections.⁶ Therefore, investigating alternative approaches is important for UC patients.

When used to treat a variety of diseases for 3000 years, traditional Chinese medicine (TCM) is one of the sources of complementary and alternative therapies and has fewer adverse effects.⁷ The use of TCM formulas that contain 2 or more traditional Chinese herbs is the main form of TCM treatment. In addition, previous studies have proven that an increasing number of TCM formulas exert certain therapeutic effects on UC in animal models, such as Huangqin decoction, Ping Weisan decoction, and Gegen Qinlian decoction.^8–10

The TCM formula Ento-PB contains two Chinese herbs: Periplaneta americana (Linnaeus.) (Blattidae) and Taraxacum mongolicum Hand.-Mazz. (Compositae). The ratio between P. americana and T. mongolicum in Ento-PB is 7:3. According to the Compendium of Materia Medica, P. americana can promote blood circulation and regulate gastrointestinal function, while T. mongolicum can dissipate swelling and facilitate detoxification.¹¹ In addition, current research showed that P americana could attenuate inflammation in a rat paw edema model induced by carrageenan¹² and that T mongolicum could suppress inflammation in the lung induced by lipopolysaccharide.¹³ This evidence implies that the TCM formula Ento-PB may be a promising approach for treating UC, but this hypothesis needs more research.

Therefore, the purpose of this study was aimed to explore whether the TCM formula Ento-PB could attenuate 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced UC in rats and to preliminarily investigate its potential mechanism.

Materials and Methods

Chemicals and Reagents

P. americana was purchased from Good Doctor Pharmaceutical Group Co. Ltd, (Chengdu, Sichuan, China) in 2018 and was identified by Dr Zi-Zhong Yang from Dali University. T. mongolicum was bought in Jinbei medicinal materials markets (Dali, Yunnan, China) in 2018 and was identified by Dr Miao He from Dali University. The voucher specimens were deposited in the sample collection room of the Yunnan provincial key laboratory of entomological biopharmaceutical R&D. TNBS was purchased from Sigma-Aldrich (Shanghai, China), chloral hydrate from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China), rat enzyme-linked immunosorbent assay kits for IL-2, IL-8, IL-10, IL-17, tumor necrosis factor-α (TNF-α), C-reactive protein (CRP), transforming growth factor-β1 (TGF-β1), and epidermal growth factor (EGF) from Jiancheng Bioengineering Institute (Nanjing, China), HPLC-grade methanol from Fisher Scientific (Waltham, MA, USA), and HPLC-grade formic acid from Shanghai Aladdin Bio-Chem Technology Co., Ltd (Shanghai, China). Pure water (18.2 MW) for HPLC analysis was obtained from a water purification system purchased from Merck Millipore (Darmstadt, Germany). Caffeic acid, uracil, hypoxanthine, adenosine, and inosine were purchased from the National Institutes for Food and Drug Control (Beijing, China), uridine from Sigma-Aldrich Corporation (Saint Louis, USA), caftaric acid from Solarbio (Beijing, China), cichoric acid from Chengdu Biopurify Phytochemical Ltd (Sichuan, China), a stool DNA kit from Tiangen Biotech Co., Ltd (Beijing, China), the forward and reverse primers for gut microbiota from Sangon Biotech (Shanghai) Co., Ltd (Shanghai, China), 2 × Taq PCR master mix, 2 × RealStar power SYBR mixture UNG (with ROX), DNA marker, DNA gel extraction kit, and plasmid miniprep kit from GenStar Biosolutions Co., Ltd (Beijing, China), and Escherichia coli DH5α competent cells and pMD®19-T vector cloning kits from Takara Bio Inc. (Shiga Ken, Japan).

Drugs Preparation

The TCM formula Ento-PB was prepared according to the following method. First, 0.7 kg P americana and 0.3 kg T mongolicum were dried and extracted with 10 L water, three times (2 h per time) at 95°C. After filtration, the filtrate was evaporated under reduced pressure to obtain an extract with a density of 1.15 g/mL. Finally, 60% ethanol was added and, after 24 h, the precipitate was removed by filtration and the filtrate was evaporated under reduced pressure to obtain the TCM formula Ento-PB.

HPLC Analysis of the Chemical Composition of Ento-PB

An Agilent 1260 (Agilent Technologies) equipped with a diode array detector was utilized to analyze the chemical composition of Ento-PB. A Sepax HP-C18 column (250 mm × 4.6 mm, 5 μm, 120 Å; Sepax Technologies) was used for the analysis at 25°C. The flow rate, detection wavelength, and injection volume were 1 mL/min, 254 nm, and 10 µL, respectively. The samples of Ento-PB (20 mg/mL) and mixed standard compounds of uracil, hypoxanthine, uridine, adenosine, inosine, caftaric acid, caffeic acid, and cichoric acid (all 0.125 mg/mL) were dissolved in pure water and filtered through a 0.22 μm membrane filter. Solution A (methanol) and solution B (water with 0.1% formic acid [v/v]) were utilized as the mobile phases. The elution gradient was as follows: t = 0 min, eluent A (0%), eluent B (100%); t = 10 min, eluent A (0%), eluent B (100%); t = 12 min, eluent A (8%), eluent B (92%); t = 14 min, eluent A (8.8%), eluent B (91.2%); t = 19 min, eluent A (8.8%), eluent B (91.2%); t = 22 min, eluent A (10%), eluent B (90%); t = 27 min, eluent A (35%), eluent B (65%), t = 37 min, eluent A (35%), eluent B (65%); t = 60 min, eluent A (95%), eluent B (5%). In addition, the contents of compounds were analyzed by the external standard method. The calibration curve (y = ax + b) was plotted based on the peak areas (y) versus the concentrations of compounds (x).

Animals

Male Sprague–Dawley rats (n = 32, 200 ± 20 g, Certificate No. SCXK [Xiang]-2015-030) were purchased from Hunan SJA Laboratory Animals Co., Ltd (Hunan, China). All rats were housed in an air-conditioned room (temperature 25 ± 2°C, 50% humidity, 12 h light/dark cycle) and were free to chow and water. The animal experiment was carried out after rats were acclimatized to the laboratory environment for 1 week. This protocol was approved by the Animal Ethics Committee of Dali University (No. 2018-0514).

Grouping and Administration

Thirty-two rats were divided into 4 groups randomly: the control group, TNBS group, and Ento-PB low- and high-dose groups. The TNBS-induced colitis model was established by the method described by Morris.¹⁴ Briefly, rats were fasted but free to drink water for 1 day. Then, the rats were anesthetized by chloral hydrate (0.3 mL/100 g), and a soft tube equipped with a 1 mL syringe was inserted into the rat's anus for approximately 8.0 cm. TNBS (75 mg/kg body weight) was dissolved in 30% ethanol, and then 0.6 mL TNBS ethanol solution was instilled into the colon via a soft tube. To prevent leakage of TNBS, animals were maintained in a head downward position for 10 s. The control group received an equivalent volume of normal saline. On the eighth day after modeling, the control and TNBS groups received normal saline at a dose of 2.5 mL/kg. The Ento-PB low- and high-dose groups received 100 and 200 mg/kg Ento-PB, respectively. All agents were administered by enema for 14 days.

Evaluation of the Viscera Index

The rats were anesthetized with chloral hydrate (3 mL/kg) and sacrificed 24 h after the last administration. The thymuses, livers, spleens, and colons of rats were dissected and weighed. The viscera index was calculated by the following formula: viscera index = (viscera weight)/(rat weight).

Evaluations of DAI, Colon Mucosa Damage Index (CMDI), and HS

Stool consistency, blood in feces and body weight of rats were recorded to assess disease activity index (DAI) on the 1st, 4th, 7th, 10th, 14^th, and 21st days according to the method described by Hamamoto¹⁵ (Table 1). After the last administration, rats were sacrificed, and the colons were dissected, weighed, cut along the mesentery, and cleaned with normal saline. Colon length and width were measured. Then, the colons were examined and scored by combining the criteria of Ekström¹⁶ and Luk.¹⁷ The criterion is shown in Table 2. Colon tissues from rats were fixed in 10% formalin, dehydrated with ethanol, embedded in paraffin, cut into 3 to 5 μm sections and dyed with hematoxylin and eosin. Then, the samples were observed using a microscope and scored by combining the methods of Hamamoto¹⁵ and Luk.¹⁷ The method is shown in Table 3.

Table 1.

The Standard for DAI Evaluation.

Score	Weight loss (%)	Stool consistency	Occult/gross bleeding
0	None	Normal	None
1	≥1 to <5	Normal or loose stools	Guaiac +
2	≥5 to <10	Loose stools	Guaiac + +
3	≥10 to <15	Loose stools or diarrhea	Guaiac + + +
4	≥15	Diarrhea	Gross bleeding

The disease activity index (DAI) = combined scores of weight loss, stool consistency, and bleeding.

Table 2.

The Standard for CMDI Evaluation.

Score	Damage to the colon mucosa
0	None
1	Mild hyperemia and edema, smooth, no erosion or ulcer
2	Hyperemia and edema, rough, erosion, or intestinal adhesion
3	Severe hyperemia and edema, ulceration extended ≤ 1 cm²
4	Severe hyperemia and edema, ulceration extended > 1 cm²

Abbreviation: CMDI, colon mucosa damage index.

Table 3.

The Standard for HS Evaluation.

Score	Epithelial morphology	Inflammation
0	Normal	None
1	Loss of one-third of goblet cells	Inflammation and ulceration to the crypts
2	Loss of two-thirds of goblet cells loss	Inflammation and ulceration to the mucosa muscularis
3	Loss of one-third of the crypts	Inflammation and ulceration to the submucosa, thickening of the intestinal wall, and obvious edema
4	Loss of two-thirds of the crypts	Inflammation and ulceration to the serosa

The histological score (HS) = combined scores of epithelial morphology and inflammation.

Evaluation of Inflammatory Cytokines

Blood samples of rats were taken from the abdominal aorta and centrifuged. Subsequently, supernatants were collected for the detection of the levels of IL-8, IL-10, IL-17, CRP, and TNF-α by ELISA kits. Colons were homogenized with normal saline and centrifuged, and then the supernatants were collected to measure the levels of myeloperoxidase (MPO), TGF-β1, EGF, and IL-2 in the colon via ELISA kits.

Gut Microbiota Analysis

Feces were collected after rats were sacrificed. The DNA of the feces was extracted by stool DNA kits and quantified through a NanoPhotometer (Implen GmbH). Then, the 16S rDNA V3 to V4 region of the ribosomal RNA was amplified using the primers as shown in Table 4 via an ABI StepOnePlus real-time PCR system (Life Technologies). Amplicons were purified using a DNA gel extraction kit. The purified amplicons were connected with plasmid by a pMD®19-T vector cloning kit and then transferred to E coli DH5α competent cells. After blue–white plaque selection, the plasmids were extracted with a plasmid miniprep kit and identified by Sangon Biotech (Shanghai) Co., Ltd. The plasmids were quantified through a NanoPhotometer and diluted to a series of solutions with different concentrations to make the standard curves. Finally, the contents of the gut microbiota were quantified using an ABI StepOnePlus real-time PCR system.

Table 4.

Sequences of Primers Used for Quantitative Real-Time PCR (qRT-PCR).

Target bacterium	Nucleotide sequence of primer (5′ to 3') Forward	Nucleotide sequence of primer (5′ to 3') Reverse
Total microbiota	TCCTACGGGAGGCAGCAGT	GGACTACCAGGGTATCTAATCCTGTT
Bacteroides	ACTCGTTGTACTTCCCATTGT	CCGCAAACTTTCACAACTGACTTA
Lactobacillus	AGCAGTAGGGAATCTTCCA	CACCGCTACACATGGAG
Bifidobacterium	TCGCGTC(C/T)GGTGTGAAAG	CCACATCCAGC(A/G)TCCAC
Enterococcus	CCCTTATTGTTAGTTGCCATCATT	ACTCGTTGTACTTCCCATTGT
Escherichia coli	GTTAATACCTTTGCTCATTGA	ACCAGGGTATCTTAATCCTGTT

Statistical Analysis

The data were analyzed using SPSS 17.0 (IBM), and all values are expressed as the mean ± SD. The data were analyzed by one-way analysis of variance (ANOVA). A P value < .05 was considered statistically significant.

Results

HPLC Analysis of the Chemical Composition of Ento-PB

After HPLC analysis of the chemical composition of Ento-PB, 8 compounds were identified in Ento-PB. They were uracil, hypoxanthine, uridine, adenosine, inosine, caftaric acid, caffeic acid, and cichoric acid. Based on the literature^{3, 18}, the chemical constituents of P americana are uracil, hypoxanthine, uridine, adenosine, and inosine, and of T mongolicum are caftaric acid, caffeic acid, and cichoric acid; their contents are shown in Table 5.

Table 5.

Determination of Compound Contents in Ento-PB (n = 3).

Compound	Standard curve	Content (mg/g)
Uracil	y = 44.282x + 0.6816, R² = 1	1.11 ± 0.02
Hypoxanthine	y = 10.338x–15.748, R² = 1	9.39 ± 0.12
Uridine	y = 17.604x–4.1587, R² = 1	1.94 ± 0.03
Adenosine	y = 28.029x + 1.4149, R² = 1	0.50 ± 0.01
Inosine	y = 25.286x + 3.3328, R² = 1	4.14 ± 0.07
Caftaric acid	y = 13.493x–17.175, R² = 0.9998	4.82 ± 0.08
Caffeic acid	y = 8.0551x + 1.5134, R² = 0.9999	1.13 ± 0.05
Cichoric acid	y = 15.226x + 12.501, R² = 0.9997	9.68 ± 0.14

Effects of Ento-PB on Viscera index

As shown in Figure 1, in comparison with the control group, the TNBS group significantly increased colon and liver indices (P < .01) and significantly decreased thymus and spleen indices (all P < .01). However, the Ento-PB high-dose group showed an upward trend in the thymus index (P < .05) and spleen index (P < .01) and a decrease in the colon and liver indices (all P < .01) compared with the TNBS group. In addition, the Ento-PB low-dose group showed the same trend of viscera index as the Ento-PB high-dose group, but only the downregulation of liver index was found to be significantly different (P < .05) when compared with the TNBS group.

Figure 1.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on visceral indices : (A) colon index, (B) liver index, (C) thymus index, and (D) spleen index.

Effects of Ento-PB on DAI

After modeling, the rats exhibited anorexia, weight loss, diarrhea and bloody stools. As shown in Figure 2, the TNBS group showed an obvious increase in DAI compared with the control group (P < .01) on the first day after modeling, suggesting the success of colitis induction. Interestingly, with Ento-PB treatment, the DAI showed a decreasing trend in comparison to the TNBS group. A significant decrease in the DAI (P < .01 or P < .05) was observed at 10 d, 14 d, and 21 d between the Ento-PB-treated groups and the TNBS group, which indicated that Ento-PB could attenuate inflammation in UC rats.

Figure 2.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on DAI.

Effects of Ento-PB on the Colon Length/Width Ratio and CMDI

As shown in Figure 3, severe ulcers were found in the TNBS-administered group, whereas in the Ento-PB-administered groups this was ameliorated in a dose-dependent manner. In addition, compared with the control group, the TNBS group displayed a great downward trend in colon length and colon length/width ratio (P < .01) and showed a strong increase in CMDI (P < .01). However, the Ento-PB-treated groups had significantly increased colon length (P < .01) and showed an obvious reduction in CMDI (P < .01) compared to the TNBS group. Additionally, compared with the TNBS-treated group, the colon length/width ratio in the Ento-PB high-dose group increased remarkably (P < .01), but no significant difference was found in the Ento-PB low-dose group.

Figure 3.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on macroscopic changes in the colon, colon index, colon length, colon length/width ratio and CMDI : (A) macroscopic changes in the colon, (B) CMDI, (C) colon length, and (D) colon length/width ratio.

Effects of Ento-PB on Colon HS

As shown in Figure 4, under a microscope, the colon in the control group displayed intact mucosal epithelium without inflammatory cell infiltration. However, the colons in the TNBS group showed severe inflammatory cell infiltration and great loss of goblet cells and crypts. Interestingly, with the increase in Ento-PB dose, inflammatory cell infiltration, and the loss of goblet cells and crypts were obviously improved. In addition, histopathological score (HS) in the TNBS group increased significantly (P < .01) compared to that in the control group. However, a significant decrease in HS (P < .01 or .05) was found in the Ento-PB-treated groups compared with the TNBS group.

Figure 4.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on microscopic changes (H&E, × 200) in the colon and HS of the colon : (A) microscopic changes in the colon and (B) HS of the colon.

Effects of Ento-PB on serum Levels of IL-8, IL-10, IL-17, CRP, and TNF-α

As shown in Figure 5, compared with the control group, the serum levels of IL-8, IL-17, CRP, and TNF-α increased significantly (P < .01), and the production of IL-10 in serum showed a downward trend (P < .01) in the TNBS group. However, compared with the TNBS group, the Ento-PB-administered groups exhibited remarkable decreases in the expression of IL-8, IL-17, and TNF-α (both P < .01) and showed obvious increases in the level of IL-10 (P < .01). In addition, the Ento-PB high-dose group markedly downregulated CRP (P < .01) in comparison with the TNBS group, but no significant difference was observed in the Ento-PB low-dose group.

Figure 5.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on the levels of IL-8, IL-17, IL-10, CRP, and TNF-α in serum : (A) IL-8, (B) IL-17, (C) IL-10, (D) CRP, and (E) TNF-α.

Effects of Ento-PB on the Levels of IL-2, MPO, TGF-β1, and EGF in the Colon

As shown in Figure 6, compared with the control group, the TNBS group showed an obvious decrease in the levels of TGF-β1 and EGF (P < .01) and a great increase in the expression of MPO and IL-2 (P < .01). However, compared with the TNBS group, the Ento-PB-treated groups showed not only a striking decrease in the levels of MPO and IL-2 (both P < .01), but also an increase in the expression of EGF (P < .01). In addition, compared with that in the TNBS-treated group, the expression of TGF-β1 in the Ento-PB high-dose group was notably elevated (P < .05), while no significant difference was indicated in the Ento-PB low-dose group.

Figure 6.

Effects of Ento-PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on the levels of TGF-β1, MPO, EGF, and IL-2 in the colon : (A) TGF-β1, (B) MPO, (C) EGF, and (D) IL-2.

Effects of PB on gut Microbiota Analysis

As shown in Figure 7, the population of total microbiota showed no significant difference among the groups. Compared with the control group, the abundance of E. coli increased significantly (P < .05), while an obvious reduction in the proportion of Bacteroides (P < .05) was found in the TNBS-treated group. In addition, although the abundances of Bifidobacterium, Lactobacillus, and Enterococcus in the TNBS-treated group increased, no significant difference was detected between the TNBS group and the control group. However, the trend of the microbiota was reversed in rats treated with Ento-PB. Compared with the TNBS group, all Ento-PB dose groups had reduced proportions of E. coli, Bifidobacterium, Lactobacillus, and Enterococcus and increased abundances of Bacteroides. The change in Bifidobacterium was found to be significant (P < .05) in all Ento-PB-administered groups.

Figure 7.

Effects of PB (high dose: 200 mg/kg; low dose: 100 mg/kg) on gut microbiota .

Discussion

With increasing morbidity, UC is a chronic and relapsing inflammatory disease of the intestinal tract. There is still no effective treatment for UC patients, which underscores the need for alternative treatments.¹⁹ Currently, TCM have been developed and suggested as complementary and alternative treatments for many diseases, including UC.²⁰ Herein, we demonstrated that the TCM formula Ento-PB could ameliorate UC by regulating the balance of Th1/Th17/Treg cytokines and improving intestinal microbiota disorders.

Based on the multiple ingredients, TCM have been used to treat many complex diseases successfully. According to the HPLC analysis, uracil, hypoxanthine, uridine, adenosine, inosine, caftaric acid, caffeic acid, and cichoric acid were identified in Ento-PB. Some of the compounds have been reported to have activities against UC or inflammation. Caffeic acid could improve mucosal histopathology, balance biochemical indices, and inhibit the recruitment of macrophages, which slowed the development of UC.²¹ Cichoric acid significantly decreased the degradation of IκBα and the expression of IL-1β, TNF-α, COX-2, and PGE2 in MSU-stimulated THP-M cells through the NF-κB signaling pathway and the NLRP3 inflammasome.²² Inosine increased in colon microbiota-derived metabolites when barley leaf extract was given to UC mice, and it was found that administrating inosine could exert a protective effect in DSS-induced colitis, similar to that of barley leaf extract. These suggested that Ento-PB has the potential to treat UC via multiple ingredients and pathways.²³

In TCM, UC is called “xie xie” and “li ji”, which means severe diarrhea, loose stool, and abdominal pain. Based on traditional Chinese medical theories, UC is related to the spleen, liver, kidney, and lung. Specifically, the downregulation of spleen function is the main factor that causes excessive dampness in UC patients.²⁴ In addition, it is well known that the spleen and thymus are important organs in modulating the immune response of our body. In addition, CRP is an acute-phase protein produced by liver tissue, and it has been observed that CRP rises sharply in the period of inflammation.²⁵ In this study, the Ento-PB high-dose group reversed the reduction in the spleen and thymus indices, and the increase in CRP in the TNBS group, indicating that Ento-PB might play an important role in recovering the function of the spleen, thymus, and liver.

The TNBS-induced UC model was used in this study. TNBS is a hapten that can cause immunological responses when it combines with macromolecular substances. In addition, ethanol can also do harm to the mucosa. Therefore, the use of TNBS and ethanol contributes to serious inflammation in the colon. Moreover, this model is simple, and the histology and distribution of inflammation in this UC model are similar to the clinical manifestations of UC.^14,26 In this research, it was found that Ento-PB could attenuate inflammatory cell infiltration, ulcers, and edema in the colon of UC rats. Additionally, increased DAI, CMDI, and HS induced by TNBS were significantly reduced after administration of Ento-PB, which suggested that it could promote the proliferation of epithelial cells and repair tissue injury in UC.

As a crucial part of the body, the gut microbiota interacts with the immune system of the host and is involved in the etiology of UC.²⁷ The proportion of beneficial bacteria and pathogenic bacteria is associated with the incidence and development of UC. Beneficial bacteria, such as Bacteroides, Bifidobacterium, and Lactobacillus, can provide a variety of advantages for the host in nutrition, metabolism, and the immune system.^28–30 However, pathogenic bacteria such as E. coli, Enterococcus faecalis, and Helicobacter hepaticus cause different types of colitis in IL-10-deficient mice.³¹ In addition, intestinal flora can produce a variety of substances, such as lactate, short-chain fatty acids, and inorganic compounds, by fermenting carbohydrates. Among the substances, some provide a variety of benefits for the host's health, while others harm the intestinal tract of the host. Lactate contributors (eg Bifidobacterium, Lactobacillus, and Enterococcus) can produce lactic acid, which will reduce the pH in the gut, change the abundance and distribution of the gut flora and exacerbate the inflammation of the intestinal tract in disease situations.³² In this study, the population of lactate producers, such as Bifidobacterium, Lactobacillus, and Enterococcus, increased in the TNBS group compared with the control group. At the same time, it was also found that the abundance of E. coli was elevated, while a downregulated trend was found in the proportion of Bacteroides after the administration of TNBS. Contrary to the TNBS group, the Ento-PB-treated groups showed the opposite result of the population among the gut microbiota, which highlighted the effect of Ento-PB in regulating the proportion of intestinal microbiota in UC.

Under normal physiological conditions, there is an equilibrium between the intestinal microbiota and immune system, but homeostasis is disrupted in disease situations. In UC, changes in the intestinal microbiota affect the differentiation and cytokine expression of T cells, including Th1, Th17, and Treg cells, which cause excessive tissue inflammation.³³ Th1 cells trigger classical macrophages and regulate the immune response through the expression of IL-2, TNF-α, and IFN-γ.³⁴ Th17 cells can secrete proinflammatory cytokines such as IL-17, which contribute to the recruitment of neutrophils together with the expression of MPO.³⁵ As a result of neutrophil infiltration, IL-8 increases and EGF decreases, which slows wound healing and aggravates the inflammatory response in UC.^36,37 In contrast, Treg cells can produce IL-10 and TGF-β1 to suppress the proliferation of Th cells that can express proinflammatory cytokines and thus exert a vital effect in reducing inflammation in UC.³⁸ In this work, it was observed that TNBS-administered rats diminished the levels of IL-10, TGF-β1, and EGF while elevating the expression of IL-2, IL-8, IL-17, TNF-α, and MPO in comparison with the control group. Conversely, totally different results of the above cytokines were found in the rats treated with Ento-PB, which showed that Ento-PB played a beneficial role in regulating the balance of Th1/Th17/Treg cytokines.

In the current study, it was shown that Ento-PB exerted a therapeutic effect in UC by modulating Th1/Th17/Treg cytokines. However, further investigations are needed to study the change in the number of Th1/Th17/Treg cells in the immune organs, which accurately reflects the effect of Ento-PB on inflammation in UC. In addition, although the abundance of gut microbiota was improved by the Ento-PB treatment when compared with the TNBS group, there were some opposite trends reported in the changes of Bifidobacterium, Lactobacillus, and Bacteroides in UC.^39,40 This may be related to the multicomponent and multitarget effects of TCM. Thus, follow-up studies are necessary to demonstrate clearly the correlations between intestinal flora and Ento-PB in UC. Moreover, based on the multiple components and targets, TCM treat diseases in a holistic way, so it was not clear whether the curative effects originate from active compounds. Therefore, research should focus on the active compounds of Ento-PB and how they exert effects in UC in the future.

Conclusion

According to our findings, the TCM formula Ento-PB could attenuate TNBS-induced inflammation in UC rats, and its potential mechanism might be related to regulating the balance of Th1/Th17/Treg cytokines and recovering the proportion of gut microbiota. These findings indicated that Ento-PB could become a potential alternative drug for UC in the future.

Footnotes

Acknowledgments

We thank American Journal Experts for the help in English language editing service.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by theNational Natural Science Fund of China under grant (Nos. 82060780, 81860742, and 81860765), Yunnan Fundamental Research Projects (Nos. 2019FH001-003, 202001AT070021), Innovative Team of Dali University for Digital Development of Medicinal Insects and Arachnids Resources (No. ZKLX2020303), Special Fund for Traditional Chinese Medicine Pieces of Department of Industry and Information Technology of Yunnan Province (No. 2019-YG-067), and the Special Program of Science and Technology of Yunnan Province (No. 202002AA100007).

Ethical Approval

All experimental procedures involving the animals were conducted in accordance with the Animal Ethics Committee of Dali University (Approval number: 2018-0514).

Informed Consent

There are no human subjects in this article, and therefore, informed consent is not applicable.

ORCID iDs

Yi-Hao Che

Heng Liu

Trial Registration

Not applicable, because this article does not contain any clinical trials.

References

Szandruk

Merwid-Ląd

Szeląg

. The impact of mangiferin from Belamcanda chinensis on experimental colitis in rats. Inflammopharmacology. 2018;26(2):571-581. doi:10.1007/s10787-017-0337-0

Shi

Hamidi

, et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies. Lancet. 2017;390(10114):2769-2778. doi:10.1016/S0140-6736(17)32448-0

, et al. Periplaneta americana ameliorates dextran sulfate sodium-induced ulcerative colitis in rats by Keap1/Nrf-2 activation, intestinal barrier function and gut microbiota regulation. Front Pharmacol. 2018;9:944. doi:10.3389/fphar.2018.00944

Conrad

Roggenbuck

Laass

. Diagnosis and classification of ulcerative colitis. Autoimmun Rev. 2014;13(4-5):463-466. doi:10.1016/j.autrev.2014.01.028

Yadav

Varum

Bravo

Furrer

Bojic

Basit

. Inflammatory bowel disease: exploring gut pathophysiology for novel therapeutic targets. Transl Res. 2016;176:38-68. doi:10.1016/j.trsl.2016.04.009

Renna

Cottone

Orlando

. Optimization of the treatment with immunosuppressants and biologics in inflammatory bowel disease. World J Gastroenterol. 2014;20(29):9675-9690. doi:10.3748/wjg.v20.i29.9675

Yang

Liu

, et al. A systems pharmacology approach for identifying the multiple mechanisms of action of the Wei Pi Xiao decoction for the treatment of gastric precancerous lesions. Evid Based Complement Altern Med. 2019;2019:1-15. doi:10.1155/2019/1562707

Zhang

Cao

Shen

Liu

Cao

Zhang

. Ping weisan alleviates chronic colitis in mice by regulating intestinal microbiota composition. J Ethnopharmacology. 2020;112715. doi:10.1016/j.jep.2020.112715

Zhao

Luan

Gao

Zhang

. Gegen Qinlian decoction maintains colonic mucosal homeostasis in acute/chronic ulcerative colitis via bidirectionally modulating dysregulated notch signaling. Phytomedicine. 2020;68:153182. doi:10.1016/j.phymed.2020.153182

10.

Chen

Yang

, et al. Protective effects of Huangqin Decoction against ulcerative colitis and associated cancer in mice. Oncotarget. 2016;7(38):61643-61655. doi:10.18632/oncotarget.11426

11.

. Compendium of Materia Medica. People's Medical Publishing House; 1975.

12.

Zhu

Wang

, et al. Anti-inflammatory effects of water extract of Taraxacum mongolicum hand.-mazz on lipopolysaccharide-induced inflammation in acute lung injury by suppressing PI3K/Akt/mTOR signaling pathway. J Ethnopharmacol. 2015;168:349-355. doi:10.1016/j.jep.2015.03.068

13.

Nguyen

Chen

Chai

, et al. Antipyretic, anti-inflammatory and analgesic activities of Periplaneta americana extract and underlying mechanisms. Biomed Pharmacother. 2020;123:109753. doi:10.1016/j.biopha.2019.109753

14.

Morris

Beck

Herridge

Depew

Szewczuk

Wallace

. Hapten-induced model of chronic inflammation and ulceration in the rat colon. Gastroenterology. 1989;96(2):795-803. doi:10.1016/0016-5085(89)90904-9

15.

Hamamoto

Maemura

Hirata

Murano

Sasaki

Katsu

. Inhibition of dextran sulphate sodium (DSS)-induced colitis in mice by intracolonically administered antibodies against adhesion molecules (endothelial leucocyte adhesion molecule-1 (ELAM-1) or intercellular adhesion molecule-1 (ICAM-1)). Clin Exp Immunol. 1999;117(3):462-468. doi:10.1046/j.1365-2249.1999.00985.x

16.

Ekström

. Oxazolone-induced colitis in rats: effects of budesonide, cyclosporin A, and 5-aminosalicylic acid. Scand J Gastroenterol. 1998;33(2):174-179. doi:10.1080/00365529850166914

17.

Luk

Fung

Cho

. Delineation of the protective action of zinc sulfate on ulcerative colitis in rats. Eur J Pharmacol. 2002;443(1-3):197-204. doi:10.1016/S0014-2999(02)01592-3

18.

Duan

Zhang

Zhao

Chang

Guo

. Comparison of bioactive phenolic compounds and antioxidant activities of different parts of Taraxacum mongolicum. Molecules. 2020;25(14):3260. doi:10.3390/molecules25143260

19.

Feuerstein

Cheifetz

. Ulcerative colitis: epidemiology, diagnosis, and management. Mayo Clin Proc. 2014;89(11):1553-1563. doi:10.1016/j.mayocp.2014.07.002

20.

Cao

Wang

Zhang

. Progress in active compounds effective on ulcerative colitis from Chinese medicines. Chin J Nat Med. 2019;17(2):81-102. doi:10.1016/s1875-5364(19)30012-3

21.

Xiang

Liu

, et al. Blockade of TLRs-triggered macrophage activation by caffeic acid exerted protective effects on experimental ulcerative colitis. Cell Immunol. 2021;365(104364). doi:10.1016/j.cellimm.2021.104364

22.

Wang

Lin

Feng

. Cichoric acid ameliorates monosodium urate-induced inflammatory response by reducing NLRP3 inflammasome activation via inhibition of NF-kB signaling pathway. Evid Based Complement Alternat Med. 2021;2021:8868527. doi:10.1155/2021/8868527

23.

Feng

Tian

Chen

. Gut microbiota-derived inosine from dietary barley leaf supplementation attenuates colitis through PPARγ signaling activation. Microbiome. 2021;9(1):83. doi:10.1186/s40168-021-01028-7

24.

Yang

Liu

, et al. The Th17/treg immune balance in ulcerative colitis patients with two different Chinese syndromes: dampness-heat in large intestine and spleen and kidney yang deficiency syndrome. Evid Based Complement Altern Med. 2015;2015:1-10. doi:10.1155/2015/264317

25.

Chang

Malter

Hudesman

. Disease monitoring in inflammatory bowel disease. World J Gastroenterol. 2015;21(40):11246-11259. doi:10.3748/wjg.v21.i40.11246

26.

Wallace

Carter

Appleyard

Beck

. Hapten-induced chronic colitis in the rat: alternatives to trinitrobenzene sulfonic acid. J Pharmacol Toxicol Methods. 1995;33(4):237-239. doi:10.1016/1056-8719(95)00001-X

27.

Derikx

Dieleman

Hoentjen

. Probiotics and prebiotics in ulcerative colitis. Best Pract Res Clin Gastroenterol. 2016;30(1):55-71. doi:10.1016/j.bpg.2016.02.005

28.

Nascimento

RPD

Machado

Galvez

Cazarin

CBB

Maróstica Junior

. Ulcerative colitis: gut microbiota, immunopathogenesis and application of natural products in animal models. Life Sci. 2020;258:118129. doi:10.1016/j.lfs.2020.118129

29.

Wen

Teng

Yang

, et al. The potential mechanism of Bawei Xileisan in the treatment of dextran sulfate sodium-induced ulcerative colitis in mice. J Ethnopharmacol. 2016;188:31-38. doi:10.1016/j.jep.2016.04.054

30.

Luo

, et al. Anti-inflammatory effects of Huangqin Decoction on dextran sulfate sodium-induced ulcerative colitis in mice through regulation of the gut microbiota and suppression of the Ras-PI3K-Akt-HIF-1α and NF-κB pathways. Front Pharmacol. 2019;10:1552. doi:10.3389/fphar.2019.01552

31.

Matsuoka

Kanai

. The gut microbiota and inflammatory bowel disease. Semin Immunopathol. 2015;37(1):47-55.

32.

Zhang

Cai

, et al. Gut microbiota contributes to the distinction between two traditional Chinese medicine syndromes of ulcerative colitis. World J Gastroenterol. 2019;25(25):3242-3255. doi:10.3748/wjg.v25.i25.3242

33.

Luo

Wen

Wang

, et al. Rhubarb Peony decoction ameliorates ulcerative colitis in mice by regulating gut microbiota to restoring Th17/Treg balance. J Ethnopharmacol. 2019;231:39-49. doi:10.1016/j.jep.2018.08.033

34.

Yang

Wang

, et al. Th1/Th2 balance and Th17/treg-mediated immunity in relation to murine resistance to dextran sulfate-induced colitis. J Immunol Res. 2017;2017:7047201. doi:10.1155/2017/7047201

35.

Sun

Zhang

Wang

, et al. Regulating the balance of Th17/treg via electroacupuncture and moxibustion: an ulcerative colitis mice model based study. Evid Based Complement Altern Med. 2017;2017(11):7296353. doi:10.1155/2017/7296353

36.

Sinha

Nightingale

West

Berlanga-Acosta

Playford

. Epidermal growth factor enemas with oral mesalamine for mild-to-moderate left-sided ulcerative colitis or proctitis. N Engl J Med. 2003;349(4):350-357. doi:10.1056/NEJMoa013136

37.

Műzes

Molnár

Tulassay

Sipos

. Changes of the cytokine profile in inflammatory bowel diseases. World J Gastroenterol. 2012;18(41):5848-5861. doi:10.3748/wjg.v18.i41.5848

38.

Sakaguchi

Miyara

Costantino

Hafler

. FOXP3+ regulatory T cells in the human immune system. Nat Rev Immunol. 2010;10(7):490-500. doi:10.1038/nri2785

39.

Lin

Zheng

Chen

, et al. Protective effect of Bruguiera gymnorrhiza (L.) Lam. fruit on dextran sulfate sodium-induced ulcerative colitis in mice: role of Keap1/Nrf2 pathway and gut microbiota. Front Pharmacol. 2019;10:1602. doi:10.3389/fphar.2019.01602

40.

Zhao

Deng

Huang

Wang

. Sanhuang Shu'ai decoction alleviates DSS-induced ulcerative colitis via regulation of gut microbiota, inflammatory mediators and cytokines. Biomed Pharmacother. 2020;125:109934. doi:10.1016/j.biopha.2020.109934

Effects of the Traditional Chinese Medicine Formula Ento-PB in Experimental Models of Ulcerative Colitis

Abstract

Keywords

Introduction

Materials and Methods

Chemicals and Reagents

Drugs Preparation

HPLC Analysis of the Chemical Composition of Ento-PB

Animals

Grouping and Administration

Evaluation of the Viscera Index

Evaluations of DAI, Colon Mucosa Damage Index (CMDI), and HS

Evaluation of Inflammatory Cytokines

Gut Microbiota Analysis

Statistical Analysis

Results

HPLC Analysis of the Chemical Composition of Ento-PB

Effects of Ento-PB on Viscera index

Effects of Ento-PB on DAI

Effects of Ento-PB on the Colon Length/Width Ratio and CMDI

Effects of Ento-PB on Colon HS

Effects of Ento-PB on serum Levels of IL-8, IL-10, IL-17, CRP, and TNF-α

Effects of Ento-PB on the Levels of IL-2, MPO, TGF-β1, and EGF in the Colon

Effects of PB on gut Microbiota Analysis

Discussion

Conclusion

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

Ethical Approval

Informed Consent

ORCID iDs

Trial Registration

References