Sage Journals: Discover world-class research

Abstract

Actinobacillus pleuropneumoniae is the etiologic agent of porcine pleuropneumonia, a highly contagious pulmonary disease in pigs with major economic losses for pig producers worldwide. Whereas A. pleuropneumoniae isolates are divided into 15 serotypes, the isolates secrete 4 types of exotoxins (ApxI, ApxII, ApxIII, and ApxIV), which are known as major virulence factors. In the current study, the ApxIA, ApxIIA, and ApxIIIA genes were amplified and their recombinant proteins expressed in Escherichia coli M15 cells. The antigenicity of each recombinant protein was demonstrated by Western blot and enzyme-linked immunosorbent assay (ELISA) using sera from pigs vaccinated with a subunit vaccine. When ELISAs using the recombinant antigens were optimized and then applied to sera from 320 randomized pigs in Korea, an observed increase in seroprevalence was found among sows in comparison with weaned piglets and growing pigs, indicating an age-dependent seroprevalence. The results obtained in the study suggest that the developed ELISAs may be useful for A. pleuropneumoniae vaccination strategy as a screening tool for pig herds as well as for detection of specific antibodies to Apx exotoxins.

Keywords

Apx toxins enzyme-linked immunosorbent assay pigs prevalence

Introduction

Actinobacillus pleuropneumoniae causes a highly contagious pleuropneumonia in pigs with major economic losses in pig farming worldwide.^6,9,10,14,22 Fifteen serotypes of A. pleuropneumoniae have been described based on the differences of capsular polysaccharides (CP) and lipopolysaccharide (LPS) composition.^2,3,8 There are several virulence factors such as exotoxins, LPS, CP, membrane proteins, and adhesion factors in A. pleuropneumoniae.^1,10,18,24 Among these virulence factors, the exotoxin, called Apx toxins, is strongly correlated with virulence.^4,5,10,20 Actinobacillus pleuropneumoniae produces 4 different Apx toxins belonging to the pore-forming RTX (Repeats in the structural ToXin) toxins, which include the strongly hemolytic and cytotoxic ApxI, the weakly hemolytic and moderately cytotoxic ApxII, the nonhemolytic and strongly cytotoxic ApxIII, and the moderately hemolytic recombinant ApxIV.^10,20,21 The ApxI, ApxII, and ApxIII toxins, which are secreted by different serotypes in various combinations, mainly determine the virulence of the 15 serotypes of A. pleuropneumoniae.^3,5,11 The ApxIV toxin is produced by all serotypes of A. pleuropneumoniae.²¹ The Apx toxin is encoded by the apx operon, which contains 4 genes: the activator gene apxC, the pretoxin structural gene apxA, and the secretion-apparatus–encoding genes apxB and apxD, in the order apxCABD.¹⁰

Actinobacillus pleuropneumoniae can result in various clinical syndromes, which vary in degrees of severity from peracute to chronic, with infected pigs typically showing a hemorrhagic pneumonia often associated with necrosis and fibrinous pleuritis.^14,22 Carrier animals can be the origin of propagation of A. pleuropneumoniae. Diagnosis of porcine pleuropneumonia depends on the isolation, identification, and serotyping of A. pleuropneumoniae, and serodiagnosis. There are several methods used in the serological diagnosis of A. pleuropneumoniae, which include radioimmunoassay, tube or microplate agglutination tests, complement fixation test, hemolysin neutralization, and the enzyme-linked immunosorbent assay (ELISA).^8,17 Although ELISA requires selecting and purifying an antigen, it is more sensitive than other assays.^15,17 Commercial ELISA kits were developed for selected serotypes such as serotypes 1-9-11, 2, 2-6, 3-6-8, and 4-7 in A. pleuropneumoniae. Each ELISA tests for a specific serotype only, and it does not offer options to test for the other serotypes. The Apx toxins are major immunogenic factors and stimulate the production of antibodies to such toxins in infected animals.^12,13 Moreover, because of its wide distribution, vaccination against A. pleuropneumoniae is commonly practiced in Korea. Because it is recognized as a major virulence factor, an ELISA test that uses a native antigen from the Apx toxin may be a practical approach for the detection of antibodies and control of porcine pleuropneumonia.^8,19 The current report describes the development of an ELISA based on the recombinant ApxIA, ApxIIA, and ApxIIIA antigens and evaluated the application of the developed assays on the prevalence of anti-Apx toxin antibodies among pigs in Korea.

Materials and methods

Bacterial strains and growth conditions

A Korean isolate A. pleuropneumoniae serotype 2 was used for the apxIIA gene as previously described.²³ Actinobacillus pleuropneumoniae serotypes 5 and 2 isolated from infected Korean pigs with pleuropneumonia were used for apxIA and apxIIIA genes, respectively. The organism was grown in lysogeny broth (LB)^a with 0.01% β-nicotinamide adenine dinucleotide^b for 24 hr at 37°C. Escherichia coli M15 cells were grown in LB with ampicillin^c (100 µg/ml) and kanamycin^c (25 µg/ml) for 16 hr at 37°C.

Polymerase chain reaction amplification and cloning of apxIA, apxIIA, and apxIIIA genes

Total genomic DNA was provided for gene amplification from A. pleuropneumoniae serotypes 2 and 5 using a commercial bacterial genomic DNA kit.^d The sequences of apxIA, apxIIA, and apxIIIA and primers were designed on the basis of GenBank (Table 1; C-terminal part of apxIA: accession no. AF363361; full sequences of apxIIA: accession no. AF363362; N-terminal part of apxIIIA: accession no. AF363363). The ApxIIA gene (2,883 base pairs [bp]) was amplified and cloned as previously described.²³ Amplified apxIA and apxIIIA genes were purified with a gel extraction kit.^e The polymerase chain reaction (PCR) products were electrophoresed in a 1.0% agarose gel and observed under ultraviolet light after ethidium bromide staining. The ApxIA (801 bp) and apxIIIA (615 bp) genes were cloned into the pQE30UA and the pQE31 vectors,^e respectively. To confirm gene insertion, DNA sequencing was carried out with an automated DNA sequencer.^f The cloned apxIA and apxIIIA were then transformed into competent E. coli M15 cells for expression.

Table 1.

Primer sequences used for cloning and expression of the Actinobacillus pleuropneumoniae ApxIA, ApxIIA, and ApxIIIA toxins.*

Toxin	Direction	Primer sequence (5’–3’)	PCR parameter
ApxIA (2269-3069)	Forward	GGAGACGACGGTAATGATGTA	94°C, 20 sec;
	Reverse	TTAAGCAGATTGTGTTAAATAATTACT	57°C, 10 sec;
			72°C, 60 sec
ApxIIA (1-2883)	Forward	GGATCCATGTCAAAAATCACTTTGTCA	94°C, 20 sec;
	Reverse	GGATCCTTAAGCGGCTCTAGCTAATTG	60°C, 10 sec;
			72°C, 120 sec
ApxIIIA (760-1374)	Forward	AGCTTACTTTCAGGAGTAACTGCA	94°C, 20 sec;
	Reverse	AGCTTTATGACGAGCATCATAGC	56°C, 10 sec;
			72°C, 60 sec

PCR = polymerase chain reaction. GenBank accession number in parentheses.

Expression and purification of the recombinant proteins

When the culture reached an optical density of 0.6 nm (OD_0.6nm), isopropyl β-D-1-thiogalactopyranoside^c (IPTG, 1 mM) was added and then cultured continuously for 4 hr. The harvested cells were re-suspended in lysis buffer (20 mM Tris–hydrogen chloride, 500 mM sodium chloride, 8 M urea, 40 mM imidazole, pH 7.0). Nickel–nitrilotriacetic acid (Ni-NTA) chelate affinity chromatography^g was then performed according to the manufacturer’s instruments. The bound protein was eluted with elution buffer (20 mM Tris–hydrogen chloride, 500 mM sodium chloride, 8 M urea, 500 mM imidazole, pH 7.0). The predicted size of the purified recombinant proteins matched the results on the sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and Western blot, based on amino acids constitution. The purified ApxIA, ApxIIA, and ApxIIIA fusion proteins were analyzed by 12% SDS–PAGE with Coomassie blue staining and transferred to a nitrocellulose membrane; the membrane was immunoblotted with mouse anti-histidine antibodies^h at a 1:2,000 dilution and an alkaline phosphatase–conjugated goat anti-mouse immunoglobulin G (IgG, H+L)^d at a 1:1,000 dilution. Blots were developed with an alkaline phosphatase kit.ⁱ The purified recombinant ApxIA, ApxIIA, and ApxIIIA were immunoblotted with the serum of a pig vaccinated with a subunit vaccine containing ApxI, ApxII, and ApxIII toxoids and outer membrane proteins at a 1:2,500 dilution and an alkaline phosphatase–conjugated rabbit anti-pig IgG (H+L)ⁱ at a 1:2,000 dilution for the purpose of evaluating diagnostic antigens. Blots were developed with an alkaline phosphatase kit.ⁱ

Development of ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays

The assays were performed using 96-well microplates coated with respective antigen at 4°C overnight. Plates were washed with solution of phosphate buffered saline (PBS) containing 0.01% Triton X-100 (Tween-20 in PBS [PBST]) after antigen coating and blocked with 10% normal horse serum by incubation at 37°C for 2 hr. Test reagents (antigen and conjugate) were checkerboard titrated utilizing representative positive and negative sera. Sensitization of recombinant ApxIA, ApxIIA, and ApxIIIA antigens was performed by a serial of two-fold dilution of each antigen ranging from 2.4 ng/well to 5,000 ng/well. A serum from a vaccinated pig and a serum from a nonvaccinated pig were used as positive and negative control sera for discrimination, respectively. The plates were incubated at 37°C for 2 hr with 100 µl of two-fold serial dilution of each control serum, followed by incubation with horseradish peroxidase–conjugated goat anti-pig IgG^j (100 µl; 1:1,000 or 1:2,000 diluted in PBST) at 37°C for 1 hr, and washed between incubations with PBST. Color formation was done with 2,2’-Azino-bis(3-ethylbenzthiazoline)6-sulfonic acid^d as substrate. Optical density was measured at 405 nm using a microplate reader.^k

To determine optimal cut-off values, 40 sera from pigs vaccinated with Porcilis APP^l and 25 sera from 10 colostrum-deprived piglets and 15 nonvaccinated piglets were used. The sensitivity, specificity, efficiency, and Youden index were obtained to evaluate diagnostic accuracy of the ApxIA, ApxIIA, and ApxIIIA ELISAs. The following formulas were calculated:

\begin{array}{l} Sensitivity = no . of true positive / (no . of true positive + no . of false negative); \\ Specificity = no . of true positive / (no . of true negative + no . of false positive); \\ Efficiency (%) = [(no . of true positive + no . of true negative) / (no . of true positive + no . of false positive + no . of true positive + no . of true negative + no . of true positive + no . of false negative)] \times 100; \\ Youden index = sensitivity + specificity - {1 .}^{7} \end{array}

Youden index is the measure of the probability of correct classifications that is invariant to prevalence.⁷ Values for the area under the receiving operator characteristic (ROC) curve of the ApxIA, ApxIIA, and ApxIIIA ELISAs were evaluated using a statistical program^m at the 95% confidence interval.

Anti-ApxI, -ApxII, and -ApxIII prevalence in domestic pigs

A total of 320 field pig sera was chosen randomly according to age, which was divided into suckling piglet (0–4 weeks), weaned piglet (4–10 weeks), growing pig (10–20 weeks), and sow classes. Prevalence of antibodies against ApxI, ApxII, and ApxIII was investigated with the ELISA in domestic pigs in Korea. Each pig sera were measured 3 times. The absorbance of samples was measured at 405 nm and analyzed.

Results

Production of the recombinant ApxIA, ApxIIA, and ApxIIIA

The nucleotide sequences of the cloned genes have confirmed the identity of each toxin (data not shown). The transformed bacteria were cultured and harvested after IPTG induction. The sodium dodecyl sulfate–polyacrylamide gel electrophoresis analysis showed that the molecular masses of recombinant ApxIA, ApxIIA, and ApxIIIA fusion proteins were approximately 29 kDa, 106 kDa, and 23 kDa, respectively, as shown in Figure 1, in good agreement with the software-predicted molecular weights. Western blot analysis also revealed the presence of a clear protein band with an estimated molecular mass of each purified recombinant protein, as presented in Figure 2.

Figure 1.

Purification of the recombinant Actinobacillus pleuropneumoniae toxins ApxIA, ApxIIA, and ApxIIIA. The recombinant ApxIA, ApxIIA, and ApxIIIA were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (A) and Western blot (B) with an anti-histidine antibody. Lane M: prestained protein molecular mass marker (kDa); lanes 1, 4, and 7: uninduced clone of ApxIA, ApxIIA, and ApxIIIA, respectively; lanes 2, 5, and 8: induced clone ApxIA, ApxIIA, and ApxIIIA, respectively; lanes 3, 6, and 9: purified ApxIA, ApxIIA, and ApxIIIA, respectively.

Figure 2.

Immunoblots of the purified recombinant Actinobacillus pleuropneumoniae toxins ApxIA, ApxIIA, and ApxIIIA for its antigenicity. The proteins were characterized by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (A) and Western blot (B) using positive pig serum. Lane M: prestained protein molecular mass marker (kDa); lane 1: recombinant ApxIA; lane 2: recombinant ApxIIA; lane 3: recombinant ApxIIIA.

Development of ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays

The results indicated that the optimal concentration of recombinant ApxIA antigen used to coat was 625 ng per well using a 1:100 dilution of serum, and also revealed that the concentrations of recombinant ApxIIA and ApxIIIA antigens were 9.8 and 156.3 ng per well, respectively, using a 1:200 dilution of serum. The largest differences between the absorbance of positive and negative control sera were obtained by the addition of a 1:1,000 dilution of the conjugate for wells coated with the ApxIA antigen under optimized conditions. In cases of using wells coated with the ApxIIA antigen or the ApxIIIA antigen, a 1:2,000 dilution of the conjugate made a significantly clear distinction between positive and negative control sera.

Cut-off values

The mean OD and standard deviation (SD) of 25 serum samples (from 10 colostrum-deprived piglets and 15 nonvaccinated piglets) were 0.191 and 0.108 for ApxIA ELISA, 0.107 and 0.058 for ApxIIA ELISA, and 0.15 and 0.074 for ApxIIIA ELISA. A cut-off value was defined as the average value plus SD of the 25 sera (i.e., 0.299 for ApxIA ELISA, 0.165 for ApxIIA ELISA, and 0.225 for ApxIIIA ELISA). Such cut-off values were determined to be optimal by ROC analysis of sensitivity and specificity at different cut-off levels, as shown in Figure 3, using the 25 control sera noted above and 40 sera from pigs vaccinated with the subunit vaccine. The specificity, specificity, efficiency, and Youden index of each ELISA at the corresponding cut-off value are summarized in Table 2.

Figure 3.

Receiver operating characteristic (ROC) curves of ApxIA (A), ApxIIA (B), and ApxIIIA (C) enzyme-linked immunosorbent assays for the diagnosis of Actinobacillus pleuropneumoniae. The area under the ROC of ApxIA, ApxIIA, and ApxIIIA ELISAs was 0.999, 0.989, and 0.992 (95% confidence interval; P < 0.001). The horizontal line belongs to the test curve, and the diagonal line shows a noninformative test curve.

Table 2.

Results of Actinobacillus pleuropneumoniae toxin ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays (ELISAs) in control pig sera at each cut-off values.*

	ApxIA		ApxIIA		ApxIIIA
	Positive	Negative	Positive	Negative	Positive	Negative
ELISA positive	40^a	1^c	38^a	1^c	37^a	1^c
ELISA negative	0^b	24^d	2^b	24^d	3^b	24^d
Sensitivity†	1		0.95		0.925
Specificity†	0.96		0.96		0.96
Percent efficiency†	98.5		95.4		93.9
Youden index†	0.96		0.91		0.885

To determine optimal cut-off values, 40 sera from pigs vaccinated with a subunit vaccine consisting of ApxI, ApxII, and ApxIII toxoids and a 42-kDa outer membrane protein, and 25 sera from 10 colostrum-deprived piglets and 15 nonvaccinated piglets were used. A cut-off value was defined as the average value plus standard deviation of 25 sera. Forty positive pig sera and 25 negative pig sera were used to analyze the sensitivity and specificity of the ELISA.

†

Formulas: sensitivity = a/(a + b); specificity = d/(c + d); efficiency = (a + d)/(a + b + c + d) × 100; Youden index = Se + Sp – 1.

Table 3.

Seroprevalence rate of the Actinobacillus pleuropneumoniae toxins ApxIA, ApxIIA, and ApxIIIA using the developed enzyme-linked immunosorbent assay in Korean domestic pigs.*

Group	ApxIA	ApxIIA	ApxIIIA
Suckling piglets (n = 80)	40	92.5	46.25
Weaned piglets (n = 80)	46.25	50	18.75
Growing pigs (n = 80)	71.25	51.25	17.5
Sows (n = 80)	72.5	98.75	86.25

Total sample size was 320 pigs.

Anti-ApxI, -ApxII, and ApxIII -IgG prevalence in domestic pigs

High seroprevalence was found among domestic pigs in Korea, as shown in Figure 4. The rates of antibody positivity for ApxIA, ApxIIA, and ApxIIIA antigens were 57.5%, 73.13%, and 42.19%, respectively. The highest rate was seen for sows when the surveyed pigs were grouped in four herds: suckling or pre-weaning piglets, post-weaning piglets, growing pigs and sows.

Figure 4.

Distribution of anti–Actinobacillus pleuropneumoniae toxins ApxIA (A), ApxIIA (B), and ApxIIIA (C) antibodies in domestic pigs. Serum samples from 320 pigs were tested by ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays. Mean values of optical density (OD)₄₀₅ were noted by a horizontal line in each group, which is divided age-dependently.

Discussion

In the current study, the recombinant ApxIA, ApxIIA, and ApxIIIA proteins were used as ELISA antigens instead of employing native proteins. Each recombinant protein was visible as one single band strongly reactive with vaccinated pig sera in Western blot analysis (Fig. 2), suggesting that the developed recombinant proteins produced and purified herein have effective antigenicity enough for ELISA tests. Using each of the cut-off values, ApxIA, ApxIIA, and ApxIIIA ELISAs had sensitivities of 1, 0.95, and 0.925 and specificities of 0.96, 0.96, and 0.96, respectively, when 25 serum samples from 10 colostrum-deprived piglets and 15 nonvaccinated piglets and 40 serum samples from vaccinated pigs were used as test serum controls (Table 2 and Fig. 3). The ELISA results indicate that the developed assay can be used for the detection of serum antibodies to 3 A. pleuropneumoniae exotoxins (ApxI, ApxII, and ApxIII).

When the ELISAs were applied to a seroepidemiologic study of anti–A. pleuropneumoniae exotoxin antibodies in 320 randomized pigs in Korea, high rates of positive antibody were observed in animals of all groups (i.e., suckling piglets, weaned piglets, growing pigs, and sows), especially in sows, which gave the highest mean OD value in the ApxIIA ELISA (Fig. 4). Such finding may be related to the fact that serotypes 2, 5, and 6 are prevalent in Korea, of which all produce ApxIIA, as noted earlier.^10,16,19 Also, the results seemed to show an age-dependent prevalence, except for suckling piglets (Fig. 4). Considering that the mean OD value of weaned piglets in any one of ApxIA, ApxIIA, and ApxIIIA ELISAs was lower than that of suckling piglets (Fig. 4), anti-Apx toxin antibody activity in sera of preweaned animals may have been due to maternal antibodies that disappear gradually after weaning. Although there is evidence for geographic boundaries of pig infection by particular serotypes of A. pleuropneumoniae, emergence of an unexpected serotype should always be taken into consideration in naive pigs.¹⁵ An expanded serologic survey would be needed to understand the present status of A. pleuropneumoniae prevalence, which also is important in planning and evaluating A. pleuropneumoniae vaccination programs. The exotoxin-specific ELISA developed in the current study may provide a useful screening tool for pleuropneumonia control and prevention in swine farms.

Footnotes

a.

Difco Laboratories Inc., Detroit, MI.

b.

Tokyo Chemical Industry, Tokyo, Japan.

c.

Duchefa Biochemie, Haarlem, The Netherlands.

d.

GenElute™, Sigma-Aldrich, St. Louis, MO.

e.

QIAquick, Qiagen GmBH, Hilden, Germany.

f.

ABI 377L, Applied Biosystems, Foster City, CA.

g.

GE Healthcare, Buckinghamshire, United Kingdom.

h.

IG Therapy Co., Kangwon, Republic of Korea.

i.

Bio-Rad, Hercules, CA.

j.

Bethyl Laboratories Inc., Montgomery, TX.

k.

Emax Precision, MDS Inc., Sunnyvale, CA.

l.

Intervet International BV, Boxmeer, The Netherlands.

m.

version 17.0, SPSS Inc., Chicago, IL.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The BioGreen 21 Program (20080401034048), ARPC (107034-03-3-CG000), BK21 Program for Veterinary Science, and the Research Institute of Veterinary Science, Seoul National University, Korea, supported the present study.

References

Baltes

Hennig-Pauka

Gerlach

: 2002, Both transferrin binding proteins are virulence factors in Actinobacillus pleuropneumoniae serotype 7 infection. FEMS Microbiol Lett 209:283–287.

Beynon

Richards

Perry

: 1993, Characterization of the Actinobacillus pleuropneumoniae serotype K11:01 capsular antigen. Eur J Biochem 214:209–214.

Blackall

Klaasen

van den Bosch

.: 2002, Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15. Vet Microbiol 84:47–52.

Boekema

Kamp

Smits

.: 2004, Both ApxI and ApxII of Actinobacillus pleuropneumoniae serotype 1 are necessary for full virulence. Vet Microbiol 100:17–23.

Bosse

Janson

Sheehan

.: 2002, Actinobacillus pleuropneumoniae: pathobiology and pathogenesis of infection. Microbes Infect 4:225–235.

Chiers

Donne

Van Overbeke

.: 2002, Actinobacillus pleuropneumoniae infections in closed swine herds: infection patterns and serological profiles. Vet Microbiol 85:343–352.

Crowther

: 2000, The ELISA guidebook. Methods Mol Biol 149:III–IV, 1–413.

Dubreuil

Jacques

Mittal

Gottschalk

: 2000, Actinobacillus pleuropneumoniae surface polysaccharides: their role in diagnosis and immunogenicity. Anim Health Res Rev 1:73–93.

Fenwick

Henry

: 1994, Porcine pleuropneumonia. J Am Vet Med Assoc 204:1334–1340.

10.

Frey

: 1995, Virulence in Actinobacillus pleuropneumoniae and RTX toxins. Trends Microbiol 3:257–261.

11.

Frey

Bosse

Chang

.: 1993, Actinobacillus pleuropneumoniae RTX-toxins: uniform designation of haemolysins, cytolysins, pleurotoxin and their genes. J Gen Microbiol 139:1723–1728.

12.

Frey

Nicolet

: 1991, Immunological properties of Actinobacillus pleuropneumoniae hemolysin I. Vet Microbiol 28:61–73.

13.

Frey

van den Bosch

Segers

Nicolet

: 1992, Identification of a second hemolysin (HlyII) in Actinobacillus pleuropneumoniae serotype 1 and expression of the gene in Escherichia coli . Infect Immun 60:1671–1676.

14.

Haesebrouck

Chiers

Van Overbeke

Ducatelle

: 1997, Actinobacillus pleuropneumoniae infections in pigs: the role of virulence factors in pathogenesis and protection. Vet Microbiol 58:239–249.

15.

Ward

Inzana

: 1998, Detection and identification of Actinobacillus pleuropneumoniae serotype 5 by multiplex PCR. J Clin Microbiol 36:1704–1710.

16.

Min

Chae

: 1999, Serotype and apx genotype profiles of Actinobacillus pleuropneumoniae field isolates in Korea. Vet Rec 145:251–254.

17.

Montaraz

Fenwick

Hill

Rider

: 2006, Evaluating antibody isotype-specific ELISA, complement fixation, and Apx1 hemolysin neutralization tests to detect serum antibodies in pigs infected with Actinobacillus pleuropneumoniae serotype 1. Swine Health Prod 4:79–83.

18.

Negrete-Abascal

Reyes

Garcia

.: 2003, Flagella and motility in Actinobacillus pleuropneumoniae . J Bacteriol 185:664–668.

19.

Nielsen

van den Bosch

Plambeck

.: 2000, Evaluation of an indirect enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to the Apx toxins of Actinobacillus pleuropneumoniae . Vet Microbiol 71:81–87.

20.

Reimer

Frey

Jansen

.: 1995, Molecular investigation of the role of ApxI and ApxII in the virulence of Actinobacillus pleuropneumoniae serotype 5. Microb Pathog 18:197–209.

21.

Schaller

Kuhn

Kuhnert

.: 1999, Characterization of apxIVA, a new RTX determinant of Actinobacillus pleuropneumoniae . Microbiology 145:2105–2116.

22.

Sebunya

Saunders

: 1983, Haemophilus pleuropneumoniae infection in swine: a review. J Am Vet Med Assoc 182:1331–1337.

23.

Shin

Cho

Yoo

: 2003, Cloning, sequencing and expression of apxIA, IIA, IIIA of Actinobacillus pleuropneumoniae isolated in Korea. Korean J Vet Res 43:247–253.

24.

Tascon

Vazquez-Boland

Gutierrez-Martin

.: 1994, The RTX haemolysins ApxI and ApxII are major virulence factors of the swine pathogen Actinobacillus pleuropneumoniae: evidence from mutational analysis. Mol Microbiol 14:207–216.

An immunosorbent assay based on the recombinant ApxIa,ApxIIa,and ApxIIIa toxins of Actinobacillus pleuropneumoniae and its application to field sera

Abstract

Keywords

Introduction

Materials and methods

Bacterial strains and growth conditions

Polymerase chain reaction amplification and cloning of apxIA, apxIIA, and apxIIIA genes

Expression and purification of the recombinant proteins

Development of ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays

Anti-ApxI, -ApxII, and -ApxIII prevalence in domestic pigs

Results

Production of the recombinant ApxIA, ApxIIA, and ApxIIIA

Development of ApxIA, ApxIIA, and ApxIIIA enzyme-linked immunosorbent assays

Cut-off values

Anti-ApxI, -ApxII, and ApxIII -IgG prevalence in domestic pigs

Discussion

Footnotes

a.

b.

c.

d.

e.

f.

g.

h.

i.

j.

k.

l.

m.

References