Sage Journals: Discover world-class research

Abstract

The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID₅₀ (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

Keywords

polymerase chain reaction vaccine contamination

Introduction

Chicken anemia virus (CAV) is a small, non-enveloped, icosahedral virus that contains a circular, single, negative-strand DNA genome. 23 It is the causative agent of chicken infectious anemia (CIA) and classified as the sole member of genus Gyrovirus within the family Circoviridae. 19 The clinical picture of CIA often appears in young, 2–3-week-old chicks, which usually acquire the infection vertically, and it is manifested by aplastic anemia and death. 14 Older chickens, which become infected horizontally when maternally derived antibody fails to be protective, 14 only develop subclinical infection evidenced by poor response to vaccines and increased susceptibility to other infections. 25

Since the first isolation of CAV from contaminated vaccines in Japan in 1979, 33 the role of CAV as a vaccine contaminant is well established. The virus usually introduces to the avian vaccines prepared in embryonating eggs, which get the infection vertically. However, the use of specific pathogen–free (SPF) eggs did not eliminate the possibility of vaccine contamination. Previous studies 4,5 reported evidence about the persistence of CAV in the gonads and its vertical transmission to the progeny of SPF chickens. The presence of viral DNA in a large percentage of blastodisks, collected from freshly laid SPF eggs and in the embryos at 16–19 days of incubation further potentiates this evidence. 16

National and international vaccine production regulations 6,7,18,26 require the screening of avian vaccines for a multitude of extraneous viruses, including: Newcastle disease virus, Avian leukosis virus, Avian reticuloendotheliosis virus, Avian reovirus, Gallid herpesvirus 1, Infectious bursal disease virus, Infectious bronchitis virus, and CAV. Assays described for detection of such contaminants often involve virus isolation in cell culture, embryonating eggs, or laboratory animals. Although this approach is established and routinely used, it is laborious, expensive, and time consuming. 12 In addition, several virologic and serologic tests are used, including hemagglutination/hemadsorption, immunofluorescence and enzyme-linked immunosorbent assay (ELISA), but these methods usually have variable degrees of limited specificity, sensitivity, and applicability. Well-designed polymerase chain reaction (PCR) assays provide a faster and inexpensive alternative to those techniques, and its established higher sensitivity and specificity has been documented. 1

Table 1.

Avian viral vaccines used in specificity testing and spiking experiments.

Vaccine	Seed virus strain *	Minimum titer/vial	Vaccine matrix
Nobilis ND Hitchner B1 †	NDV strain Hitchner B1	10⁹ EID₅₀	Allantoic fluid
Nobilis ND Lasota †	NDV strain LaSota	10⁹ EID₅₀	Allantoic fluid
Nobilis Ovo-Diphtherin †	FPV strain WP	10^6.7 EID₅₀	Crude tissues homogenate
Nobilis AE-Pox †	AEV strain Calnek	10^5.5 EID₅₀	Crude tissues homogenate
	FPV strain Gibbs	10^5.8 EID₅₀	Crude tissues homogenate
Nobilis Ma5 + Clone 30 †	NDV strain Clone30	10⁹ EID₅₀	Allantoic fluid
	IBV strain Ma5	10⁶ EID₅₀	Allantoic fluid
Delvax Gumboro LZD 228 †	IBDV strain 228	2.5 × 10⁶ EID₅₀	Crude tissues homogenate
Gallivac IBD H ‡	IBDV strain W	10⁶ EID₅₀	Crude tissues homogenate

NDV = Newcastle disease virus; FPV = Fowl pox virus; AEV = Avian encephalomyelitis virus; IBDV = Infectious bursal disease virus; IBV = Infectious bronchitis virus; EID₅₀ = 50% egg infectious doses.

†

Intervet/Schering-Plough Animal Health, Boxmeer, The Netherlands.

†

Merial Select Inc., Gainesville, GA.

Different PCR formats have been developed for detection and quantification of CAV DNA, including endpoint PCR, 10,17 competition quantitative PCR, 31 strain-specific real-time PCR, 13 and real-time quantitative PCR–based serum neutralization test. 27 None of these assays were validated for use in the detection of CAV as an extraneous virus agent in poultry vaccines. Validation of PCR assays for use in the detection of CAV in different viral vaccine formulations is essential for 2 reasons. First, constituents added during vaccine formulation may interfere with virus extraction and/or PCR amplification. Second, DNA from virus propagation hosts may produce false-positive or confusing PCR results. Therefore, the current study was designed for developing and optimizing a high-performance PCR assay to detect CAV in live avian virus vaccines. Different aspects were validated, including the assay's specificity, sensitivity, reproducibility, and effect of the vaccine matrix.

Materials and methods

Vaccines

A commercially available live CAV vaccine a that contains 10⁶ TCID₅₀ (50% tissue culture infective dose) of strain 26P4a was kindly supplied by the Central Laboratories for Control of Veterinary Biologics, Abassia, Egypt, for use in the development of the CAV PCR assay. The same virus was used for spiking different dilutions of avian viral vaccines to assess the utility of the CAV PCR assay in the detection of CAV contamination of vaccines. Seven different avian live virus vaccines, prepared on chicken embryos and proved to be free from CAV contamination, were used as vehicles for spiking experiments and for testing the developed assay's specificity (Table 1).

Table 2.

Oligonucleotide primers. *

Primers 25	Orientation	Sequence (5′to ′9)	Position †	PCR product size
CAV1 (24-mer)	Sense	GACTGTAAGATGGCAAGACGAGCT	823–846	676 bp
CAV2 (20-mer)	Antisense	GGCTGAAGGATCCCTCATTC	1479–1498

CAV = Chicken anemia virus; PCR = polymerase chain reaction.

†

Positions relevant to CAV isolate 01-4201 (accession no. DQ991394.1).

Sensitivity and spiking

Ten-fold serial dilutions, from 10⁻¹ to 10⁻⁸, of the rehydrated CAV vaccine were prepared in PCR-grade water as well as in the different rehydrated live avian virus vaccines (Table 1). The DNA extracts from the stock as well as each dilution were tested by using the PCR assay described in the following section. Serial 2-fold dilutions were prepared from the lowest dilution giving specific amplification in the initial testing. Extracts from the 2-fold serial dilutions were extracted and tested as the initial 10fold dilutions.

Oligonucleotide primers

A wide range of CAV sequences available on the genetic sequence databases (accession nos. FJ172347.1, AY846844.1, DQ217400.1, DQ217401.1, AF311900.3, DQ991394.1, EF176599.1, DQ141672.1, DQ141673.1, AF390038.1, AJ297685.2, AJ297684.2, AB119448.1, and AY040632.1) were collected and aligned by using the MegAlign program, version 3.18. b Two previously published oligonucleotide primers 24,28 that detected highly conserved sequences within the CAV VP1 gene (Table 2) were selected. Their specificity was confirmed by Primer-BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and suitability was verified by analysis that used Oligo design and analysis tools. c The primers were synthesized by Metabion. d

DNA extraction

All vaccines were first resuspended in 1 ml of sterile phosphate buffered saline solution (pH 7.4). The DNA extraction of the vaccine preparations and all the spiked dilutions were conducted by using a commercial DNA extraction kit. e The procedure was carried out by using a 200-μl sample volume according to the manufacturer's protocol. Purified DNA was recovered in a 50-μl elution buffer and stored at −20°C until use.

Table 3.

Sensitivity of Chicken anemia virus polymerase chain reaction (PCR) assay in commercial poultry vaccines.

		Detection limit (TCID₅₀) *
Matrix	Staining dye	Per ml	Per PCR reaction
Water	−	10^2.4	10^0.7
Nobilis ND Hitchner B1 †	−	10³	10^1.3
Nobilis ND Lasota †	+	10³	10^1.3
Nobilis Ovo-Diphtherin †	−	10^2.4	10^0.7
Nobilis AE-Pox †	−	10³	10^1.3
Delvax Gumboro LZD 228 †	−	10^2.4	10^0.7
Gallivac IBD H ‡	+	10⁴	10^2.3
Nobilis Ma5 + Clone 30 †	−	10³	10^1.3

Lowest virus titer at which a positive amplification signal was detected. TCID₅₀ = 50% tissue culture infective dose.

†

Intervet/Schering-Plough Animal Health, Boxmeer, The Netherlands.

†

Merial Select Inc., Gainesville, GA.

PCR amplification and gel electrophoresis

A reaction mixture, which contained 12.5 μl of 2× ReddyMix PCR Master Mix, f 1 μM (2.5 μl) of each primer, and 5 μl of DNA extract, was brought up to a 25-μl volume by using PCR-grade water. Target DNA sequences were amplified in 0.2-ml thin-walled tubes incubated in a thermal cycler. g The thermal profile of DNA amplification consisted of 1 cycle at 95°C for 5 min followed by 50 cycles of 95°C for 30 sec, 55°C for 35 sec, and 72°C for 1 min, and finally 1 cycle of 72°C for 7 min. Ten microliters of the PCR products were separated in 1.2% agarose gel that contained 0.5 μg/ml ethidium bromide. The specific bands were identified in comparison with 100-bp DNA ladder f and documented by using an image analysis system. h

Assay specificity and precision

The assay specificity was evaluated by testing preparations that contained CAV against DNA extracted from the different avian live virus vaccines (Table 1) for cross reactivity. To assess the assay's precision (reproducibility), 3 separate dilution series were assayed in a single run to determine the intra-assay variation. Interassay variation was also determined by application of 3 separate runs on different days by using freshly prepared reagents.

Results

Optimization of the PCR conditions

Different variables of the PCR assay were evaluated to identify the best possible conditions for getting highly specific and reproducible results. Three integrated kit systems were assessed and compared, including Illustra PuReTaq Ready-To-Go PCR beads, i ReddyMix PCR Master Mix, f and GeneAmp Fast PCR Master Mix. g All 3 systems were efficient in amplifying the target 676-bp fragment of CAV genome as visualized in agarose gel; with a slightly higher performance by ReddyMix and GeneAmp. In addition, other parameters such as magnesium chloride (MgCl₂) and primer concentrations, annealing temperature, and cycling repeats were tested in series to establish the optimal working conditions. ReddyMix was selected to complete the PCR for economic reasons.

Specificity of the reaction

The specificity of PCR was verified by successful amplification of the target sequence in several batches of the CAV vaccine. Furthermore, no specific amplification was detected either with the negative control or with any other tested avian viruses, including Newcastle disease virus, Infectious bursal disease virus, Infectious bronchitis virus, Fowl pox virus, and Avian encephalomyelitis virus.

Detection limit and effect of different vaccine matrices

The sensitivity of the developed assay for detecting possible CAV contamination of commercial poultry vaccines was evaluated by testing 10-fold dilution series of the virus stock (10⁶ TCID₅₀/ml; dilutions 10⁻¹ to 10¹⁸). Further 2-fold serial dilutions were applied to the lowest dilution that generated a positive signal. The results showed that the assay detected down to the genome equivalent of 250 TCID₅₀/ml (the genome equivalent of 5 TCID₅₀ per reaction; Table 3; Fig. 1). In certain cases, vaccine matrix reduced the assay performance and decreased the detection sensitivity 4–40-fold (Table 3; Fig. 1).

Reproducibility

All the replicates showed specific amplification of the target. Differences were observed only in band intensity in ethidium bromide gels.

Discussion

The use of high-quality vaccines is essential for maintenance of animal health and production. Different requirements and procedures were established for assuring the production of a proper vaccine for immunization purposes as described in the Code of Federal Regulations (CFR Title 9, 113), 26 in the annex of European Union Directive 2001/82/EC, 7 in the European pharmacopeia, 6 and in the World Organization for Animal Health manual of diagnostic tests and vaccines. 30 Freedom of the vaccine from contamination by extraneous virus agents should be secured throughout the process of production and before market release to avoid infection of immunized animals. 30

Figure 1.

Polymerase chain reaction (PCR) detection of dilutions of Chicken anemia virus (CAV) in different matrices. PCR-grade water (A), Nobilis ND Lasota (B), Nobilis ND Hitchner B1 (C), Delvax Gumboro LZD 228 (D), Gallivac IBD H (E), Nobilis Ovo-Diphtherin (F), Nobilis AE-Pox (G), Nobilis Ma5 + Clone 30 (H). Lane 1: dilution 10⁻¹; lane 2: dilution 10⁻²; lane 3: dilution 10⁻³; lane 4: dilution 0.25 × 10⁻³; lane 5: dilution 10⁻⁴; lane M: 100-bp DNA ladder.

Chicken anemia virus is an important extraneous pathogen that potentially contaminates the avian virus vaccines, particularly those prepared by inoculation on chicken embryos. The virus was reported to infect SPF flocks, which supply eggs for vaccine production, and its DNA was detected in a large proportion of the laid eggs. 4,5,16 Vaccine contamination with CAV either results in severe anemia and significant mortalities in vaccinated birds or in potential reduction in the immune response to the target vaccine candidate(s). 25 Therefore, the process of assuring freedom of the avian virus vaccines from CAV contamination requires a 2-step strategy; first, testing the SPF embryonating eggs used in vaccine production and quality control; and second, examining the produced vaccines for possible contamination before release. In the current report, the development of a reliable and accurate assay for routine identification of CAV in poultry vaccines was described, whereas the establishment of a similar method for screening SPF eggs is a matter of ongoing research.

To date, identification of CAV as a possible vaccine contaminant is routinely done by virus isolation on cell culture, embryonated eggs, or SPF chickens. The MDCC-CU147 or MSB1 cell cultures are the most common hosts used, although some virus strains do not grow well and differences in susceptibility of MSB1 sublines have been reported. 18 Moreover, the traditional virus isolation methods relied on difficult, time-consuming passaging of cells until the culture fails because of CAV infection. 32 The PCR assay described in the current study, however, is a simple, rapid, and more accurate method for detecting several extraneous virus agents, such as Newcastle disease virus, 21 Infectious bronchitis virus, 8 Avian leukosis virus, 9 Infectious laryngotracheitis virus, 29 and Avian reovirus. 3 Hence, the proven aptitude of PCR was exploited in the current study to provide a suitable alternative to virus isolation for detecting CAV in vaccine preparations.

Several CAV genetic groups have been recognized, 11 with no significant antigenic or pathogenic differences among the isolates. 15 Therefore, the primers used in developing the current PCR assay were chosen to target highly conserved regions of the CAV genome after sequence alignment of 14 CAV strains.

During the primer selection phase, it was noticed that the published primers were not all suited for vaccine screening applications. The primer sequences published for the detection of CAV in formalin-fixed tissues did not yield any positive results when tested against published GenBank sequences. 10 Primers based on VP3 were not considered in our selection because they had an improved sensitivity only when applied as a nested procedure that is laborious and time consuming. 2 In comparison, the VP1 primers CAV1 and CAV2 hybridize to highly conserved sequences; thus ensuring that all variants of the CAV will be detected and that future mutations of the virus will not affect our primer binding and/or detection sensitivity. 24 It is important to note that CAV1 and CAV2 have never been tested for sensitivity of detection under any experimental conditions before the current work.

Specificity of the reaction was proven by testing several CAV vaccine batches, all of which produced a distinct amplification signal revealed by a band of 676 bp in agarose gel. Furthermore, no specific product was obtained with the no template control (NTC) and with other avian viruses such as Newcastle disease virus, Infectious bronchitis virus, Avian erythroblastosis virus, Infectious bursal disease virus, and Avian papillomavirus. The assay performance was further optimized by testing several variables of the reaction components and the cycling conditions (data not shown). This enabled consistent production of the specific PCR product in all reaction tubes, with no effect of the intra-assay or interassay factors.

The detection limit of the test (10^0.7 TCID₅₀ per reaction; Table 3) is comparable with, or below, the detection thresholds of most developed PCR assays for CAV. 10,20,22,24 Although the use of nested PCR showed improved detection sensitivity by 10–100-fold, 10,20 it increases the cost and time required for vaccine evaluation with no extra positive impact on the results obtained.

Spiking of CAV in different commercial avian virus vaccines enabled the study of the effect of vaccine preparation method and vaccine matrix on the efficiency of the developed assay. In contrast to previous observations, 3 CAV was detected in vaccines produced in allantoic fluid such as Newcastle disease virus with the same efficiency that it was recovered from the vaccines produced as a crude tissues homogenate of virus-infected embryonating eggs such as Infectious bursal disease virus and Avian papillomavirus (Tables 1, 3). However, all the preparations that contained Fowl pox virus produced a distinct smear in the agarose gel without any loss of the analytical sensitivity (Fig. 1F, G). This effect may result from the fact that pox viruses are DNA viruses and, therefore, vaccines would contain a higher level of DNA or from a special additive often added to the poxvirus vaccines. In another context, the detection sensitivity of the PCR assay varied to some extent according to the type of vaccine matrix (Fig. 1).

In conclusion, the current report describes the development of a highly specific, sensitive, and reproducible PCR assay for the detection of CAV contamination in avian virus vaccines. The assay could be routinely used for evaluation of the purity of vaccine batches, particularity those prepared in chicken embryos, with great impact on the time, labor, and economy of the quality control procedures.

Footnotes

a.

Nobilis® CAV P4, Intervet/Schering-Plough Animal Health, Boxmeer, The Netherlands.

b.

DNASTAR Inc., Madison, WI.

c.

Integrated DNA Technologies Inc., Coralville, IA.

d.

Metabion International AG, Martinsried, Germany.

e.

GF-1 blood DNA extraction kit, Vivantis, Selangor DE, Malaysia.

f.

ABgene, Epsom, Surrey, United Kingdom.

g.

Applied Biosystem Inc., Foster City, CA.

h.

IMAGO Compact Imaging System, B&L Systems, Maarssen, The Netherlands.

i.

GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom.

References

Belák

: 2007, Molecular diagnosis of viral diseases, present trends and future aspects. A view from the OIE collaborating centre for the application of polymerase chain reaction methods for diagnosis of viral diseases in veterinary medicine Vaccine 25:5444–5452

Brentano

Lazzarin

Bassi

: 2005, Detection of chicken anemia virus in the gonads and in the progeny of boiler breeder hens with high neutralizing antibody titers Vet Microbiol 105:65–72

Bruhn

Bruckner

Ottiger

: 2005, Application of RT-PCR for the detection of avian reovirus contamination in avian viral vaccines J Virol Methods 123:179–186

Cardona

Lucio

O'Connell

: 2000, Humoral immune responses to chicken infectious anemia virus in three strains of chickens Avian Dis 44:661–667

Cardona

Oswald

Schat

: 2000, Distribution of chicken anemia virus in the reproductive tissues of specific-pathogen-free chickens J Gen Virol 81:2067–2075

Council of Europe: 2005, European pharmacopoeia, 5th ed. Editions of the Council of Europe, Strasbourg, France

European parliament: 2004, Directive 2001/82/EC of the European parliament and of the Council of 6 November 2001 on the community code relating to veterinary medicinal products Official Journal L-311, 28/11/2004, pp. 1 66

Falcone

D'Amore

Di Trani

: 1997, Rapid diagnosis of avian infectious bronchitis virus by the polymerase chain reaction J Virol Methods 64:125–130

Haeuptli

Bruckner

Ottiger

: 1997, Use of reverse transcriptase polymerase chain reaction for detection of vaccine contamination by avian leukosis virus J Virol Methods 66:71–81

10.

Imai

Mase

Yamaguchi

: 1998, Detection of chicken anaemia virus DNA from formalin-fixed tissues by polymerase chain reaction Res Vet Sci 64:205–208

11.

Islam

Johne

Raue

: 2002, Sequence analysis of the full-length cloned DNA of a chicken anaemia virus (CAV) strain from Bangladesh: Evidence for genetic grouping of CAV strains based on the deduced VP1 amino acid sequences J Vet Med B Infect Dis Vet Public Health 49:332–337

12.

Jungbäck

Motitschke

: 2010, Extraneous agents testing for substrates of avian origin and viral vaccines for poultry: Current provisions and proposals for future approaches Biologicals 38:362–365

13.

Markowski-Grimsrud

Miller

Schat

: 2002, Development of strain-specific real-time PCR and RT-PCR assays for quantitation of chicken anemia virus J Virol Methods 101:135–147

14.

McNulty

: 1991, Chicken anemia agent: A review Avian Pathol 20:187–203

15.

McNulty

Connor

McNeilly

: 1990, Preliminary characterization of isolates of chicken anemia agent from the United Kingdom Avian Pathol 19:67–73

16.

Miller

Ealey

Oswald

Schat

: 2003, Detection of chicken anemia virus DNA in embryonal tissues and egg shell membranes Avian Dis 47:662–674

17.

Noteborn

Verschueren

van Roozelaar

: 1992, Detection of chicken anaemia virus by DNA hybridization and polymerase chain reaction Avian Pathol 21:107–118

18.

Renshaw

Soiné

Weinkle

: 1996, A hypervariable region in VP1 of chicken anemia virus mediates rate of spread and cell tropism in tissue culture J Virol 70:8872–8878

19.

Schat

: 2003, Circovirus infections: Chicken infectious anemia In: Diseases of poultry, ed. Saif

Barnes

Fadl

, 11th ed., pp. 182 202. Iowa State University Press, Ames, IA

20.

Soine

Watson

Rybicki

: 1993, Determination of the detection limit of the polymerase chain reaction for chicken infectious anaemia virus Avian Dis 37:467–476

21.

Stäuber

Brechtbuühl

Bruckner

: 1995, Detection of Newcastle disease virus in poultry vaccines using the polymerase chain reaction and direct sequencing of amplified cDNA Vaccine 13:360–364

22.

Tham

Stanislawek

: 1992, Polymerase chain reaction amplification for direct detection of chicken anemia virus DNA in tissues and sera Avian Dis 36:1000–1006

23.

Todd

Creelan

Mackie

: 1990, Purification and biochemical characterization of chicken anaemia agent J Gen Virol 71:819–823

24.

Todd

Mawhinney

McNulty

: 1992, Detection and differentiation of chicken anemia virus isolates by using the polymerase chain reaction J Clin Microbiol 30:1661–1666

25.

Toro

Ramirez

Larenas

: 1997, Pathogenicity of chicken anaemia virus (isolate 10343) for young and older chickens Avian Pathol 26:485–499

26.

United States Department of Agriculture: 2000, Code of Federal Regulations, Title 9, Parts 1–199. US Government Printing Office, Washington, DC

27.

van Santen

Kaltenboeck

Joiner

: 2004, Real-time quantitative PCR-based serum neutralization test for detection and titration of neutralizing antibodies to chicken anemia virus J Virol Methods 115:123–135

28.

van Santen

Hoerr

Lauerman

: 2001, Genetic characterization of chicken anemia virus from commercial broiler chickens in Alabama Avian Dis 45:373–388

29.

Voegtlin

Bruckner

Ottiger

: 1999, Use of polymerase chain reaction (PCR) for the detection of vaccine contamination by infectious laryngotracheitis virus Vaccine 17:2501–2506

30.

World Organization for Animal Health (OIE): 2008, Manual of diagnostic tests and vaccines for terrestrial animals (mammals, birds and bees), 6th ed. OIE, Paris, France

31.

Yamaguchi

Kaji

Munang'andu

: 2000, Quantification of chicken anaemia virus by competitive polymerase chain reaction Avian Pathol 29:305–310

32.

Yuasa

Taniguchi

Goda

: 1983, Isolation of chicken anemia agent with MDCC-MSB1 cells from chickens in the field Natl Inst Anim Health Q (Tokyo) 23:75–77

33.

Yuasa

Taniguchi

Yoshida

: 1979, Isolation and some characteristics of an agent inducing anemia in chicks Avian Dis 23:366–385

An Optimized Polymerase Chain Reaction Assay to Identify Avian Virus Vaccine Contamination with Chicken Anemia Virus

Abstract

Keywords

Introduction

Materials and methods

Vaccines

Sensitivity and spiking

Oligonucleotide primers

DNA extraction

PCR amplification and gel electrophoresis

Assay specificity and precision

Results

Optimization of the PCR conditions

Specificity of the reaction

Detection limit and effect of different vaccine matrices

Reproducibility

Discussion

Footnotes

a.

b.

c.

d.

e.

f.

g.

h.

i.

References