Optimal Probe Size and Fixation Time for the Detection of Porcine Circovirus–2 DNA by in Situ Hybridization in Formalin-Fixed,Paraffin-Embedded Tissue

Abstract

Probe size and fixation time for detecting Porcine circovirus–2 (PCV–2) by in situ hybridization in formalin-fixed, paraffin-embedded lymph nodes from experimentally infected pigs were optimized. In situ hybridization using a 169–base pair (bp) probe detected significantly fewer PCV–2–positive cells than when using 8 other larger probes (P < 0.05). The difference in hybridization intensity between smaller probes (169 and 225 bp) and larger probes (416, 473, 571, 631, 693, and 753 bp) was statistically significant (P < 0.05). The PCV–2–positive cells were consistently detected in lymph nodes fixed up to 3 days; thereafter, the number of positive cells declined. The PCV–2–positive cells were detected in lymph nodes fixed for up to 730 days. The difference in hybridization intensity between samples fixed for a short term (1 or 3 days) and a longer term (4–730 days) was statistically significant (P < 0.05). The data demonstrates that the optimal probe size and fixation time for detecting PCV–2 in formalin-fixed, paraffin-embedded lymph nodes is 473 bp and 1–3 days, respectively.

Introduction

The introduction of in situ hybridization has revolutionized molecular pathology by supplementing classical histopathology with modern molecular biological techniques. 10,11 In situ hybridization reveals cellular details and histological architecture such that small numbers of virus-infected cells and lesions can be studied in the same tissue section. Thus, in situ hybridization is useful for diagnosing viral diseases in which the etiological agent must be identified in the histopathological lesions. In postweaning multisystemic wasting syndrome (PMWS), which is caused by Porcine circovirus–2 (PCV–2; family Circoviridae, genus Circovirus), 1,4 serologic studies and virus isolation alone are not considered diagnostic of PMWS because of the high incidence of subclinical PCV–2 infection in PMWS-negative herds. 2 To establish a definitive diagnosis of PMWS, techniques that link the virus with tissue lesions are required. 3

An enhanced, modified pretreatment procedure for optimizing in situ hybridization for detecting PCV–2 in formalin-fixed, paraffin-embedded (FFPE) tissues has been reported 5 ; however, there are no reports concerning the effect of probe size or fixation time on the efficacy of PCV–2 DNA detection by in situ hybridization. The objective of the present study was to optimize detection of PCV–2 DNA by in situ hybridization in FFPE tissues by varying the probe size and fixation time.

Materials and methods

FFPE tissues

Lymph node tissues from 10 pigs experimentally infected with PCV-2 were obtained 28 days postinoculation at necropsy; the tissues were fixed in formalin, processed routinely, and embedded in paraffin. 6,8 Superficial inguinal lymph nodes were collected because they have been found to show consistent and intense labeling for PCV–2. 7 Superficial inguinal lymph nodes were also collected from 3 noninfected pigs and 3 pigs experimentally infected with PCV–1 (negative controls).

Fixation time and probes

Lymph node samples were fixed in 10% (w/v) neutral buffered formaldehyde for 1, 3, 15, 30, 60, 90, 120, 180, and 720 days, then processed and embedded in paraffin wax according to standard laboratory procedures. Primers were designed based on the PCV–2 sequence (GenBank accession no. AF027217). Four different pairs of forward and reverse primers were used in the current study (Table 1). Nine different sizes of polymerase chain reaction (PCR) products were generated using different combinations of forward (F) and reverse (R) primers: F3 and R1 = 169 base pair (bp), F4 and R3 = 225 bp, F2 and R1 = 324 bp, F3 and R3 = 416 bp, F1 and R2 = 473 bp, F2 and R3 = 571, F2 and R4 = 631, F1 and R3 = 693 bp, and F1 and R4 = 753 bp.

Table 1.

Primer sequences designed in the current study. *

Primer	Sequence (5‘-3’)	Position of target sequence in PCV–2 genome
F1	TCAGACCCCGTTGGAATGGT	818–837
F2	AGTTCGTCACCCTTTCCCCC	940–959
F3	CGGATATTGTAGTCCTGGTCG	1095–1115
F4	GATTGTATGGCGGGAGGAGT	1286–1305
R1	CCCGTTACTTCACACCCAAACC	1263–1242
R2	CAATCCCCCAACCCTTCTCC	1290–1271
R3	ATTGACGACTTTGTTCCCCC	1510–1491
R4	ACTGTCAAGGCTACCACAGTCA	1570–1549

*

PCV–2 = Porcine circovirus–2; F = forward; R = reverse.

PCR and specificity assays

Ten microliters of the supernatant containing extracted DNA was used as PCR template in the first reaction; 10 μl of the product of the first reaction was used as a template for the second reaction. Amplification was performed in a 50–μl reaction mixture containing 1.25 mM MgCl₂, 1– PCR buffer, 0.2 mM of each deoxyribonucleotide triphosphate, 1.00 μM of each primer, and 2.5 U of Taq DNA polymerase. Both reactions were run in a thermocycler under the same conditions: 35 cycles of denaturation at 94°C for 30 sec, primer annealing at 61°C for 30 sec, and extension at 72°C for 30 sec. The PCR was ended with a final 7–min extension at 72°C.

The amplified products were resolved by electrophoresis using 10 μl of the final reaction mixture on a 2% agarose gel and visualizing the bands under ultraviolet light after ethidium bromide staining. Their lengths were ascertained by comparison against a digested lambda DNA standard run simultaneously. The PCR reactions were repeated 3 times. Control DNA from a reference strain was included in each reaction. Porcine reproductive and respiratory syndrome virus, Porcine parvovirus, Porcine epidemic diarrhea virus, Transmissible gastroenteritis virus, and Rotavirus were tested independently in specificity studies using each of the 8 sets of primers.

Probe labeling

The PCR products were purified using a 30–kD cutoff membrane filter. The nucleotide sequences of the purified PCR products were determined by means of BigDye chemistry with the use of an automated sequencer. a After sequencing, the products were labeled by random priming with digoxigenin–2‘-deoxyuridine 5‘-triphosphate b according to the manufacturer's instructions.

In situ hybridization

Tissue sections (4 μm) were prepared from each of the FFPE tissues. Sections for in situ hybridization were mounted on positively charged slides c and stored at room temperature. Just before use, sections were deparaffinized in xylene and rehydrated in phosphate buffered saline (PBS; pH 7.4, 0.01 M) for 5 min. Deproteinization was carried out in 0.2 N HCl for 20 min at room temperature.

Sections were digested at 37°C for 20 min in proteinase K (300 μg/ml) 4 in PBS. Then, sections were covered with PBS and placed on a thermal cycler e for 12 cycles, each comprising 94°C for 20 sec, 55°C for 20 sec, and 72°C for 20 sec (held for 5 min for final cycle). Sections were then fixed in 4% paraformaldehyde in PBS for 10 min. After rinsing with PBS twice, the slides were acetylated in 300 ml of 0.1 mM triethanolamine-HCl buffer (pH 8.0) to which 0.75 ml of acetic anhydride (0.25%) had been added. After 5 min, an addition of 0.75 ml of acetic anhydride was added, and 5 min later, the slides were rinsed in 2χ saline sodium citrate (SSC; 1χ SSC contains 50 mM NaCl and 15 mM sodium citrate, pH 7.0).

Hybridization was carried out overnight at 45°C. The digoxigenin-labeled probe (1 ng/μl) was diluted in 50 μl of standard hybridization buffer consisting of 2χ SSC containing deionized formamide 50%, salmon sperm DNA f 10 mg, sodium dodecyl sulfate 0.02%, Denhart solution 1%, and dextran sulfate solution (50% concentration) 50%. Approximately 75 ng of digoxigenin-labeled probe was added to standard hybridization buffer (70 μl), which was then layered over the section. Fluid was held in place by a coverslip (the edges of which were sealed with rubber cement) and heated for 10 min in a 95°Cheating block. After overnight hybridization, sections were thoroughly washed twice in 4χ SSC for 10 min at room temperature, twice in 2χ SSC for 10 min at 45°C, twice in 0.2χ SSC for 10 min at room temperature, twice in 0.2χ SSC for 10 min, once in maleic acid buffer (100 mM maleic acid and 150 mM NaCl, pH 7.5) for 5 min, and once in 1X blocking reagent b for 40 min at room temperature.

Sections were incubated with anti-digoxigenin conjugated with alkaline phosphatase b diluted 1 in 500 in 1χ blocking reagent. After 3 washes in buffer, substrate consisting of nitroblue tetrazolium and 5–bromocresyl–3–indolylphosphate was layered over the sections. Color was allowed to develop for 3–4 hr in the dark, and development was stopped by dipping the slides briefly in ethylenediamine tetra-acetic acid (EDTA) buffer (10 mM Tris-HCl and 1 mM EDTA, pH 8.0). Sections were counterstained with methyl green 0.5%, and the slides were then washed with distilled water for 1 min and dried completely.

Morphometric analysis

For quantitative morphometric analysis, 10 randomly selected fields on each of 3 different tissue sections from each animal were examined in blinded fashion by 3 pathologists. The fields were scored for the number of positive cells per unit area (0.25 mm 2 ) and the degree of signal intensity using the National Institutes of Health Image J program. g Hybridization intensity was scored as 0 = absent staining, 1 = weak, 2 = moderate, 3 = strong, and 4 = very strong staining.

Statistical analysis

Statistical analysis was performed using the Prism 4 program. h Comparisons among the 9 groups were made by Kruskal-Wallis test. If any significant differences were noted, the Mann-Whitney U-test was used for intergroup comparisons. Statistical significance was accepted at P < 0.05.

Results

Specificity assays, probe size, and in situ hybridization

No primers cross-reacted with any virus tested other than PCV–2. Porcine circovirus–2-positive cells were detected in lymph node tissues by in situ hybridization using probes of various sizes (Fig. 1). Statistical analysis of the mean number of PCV–2–positive cells per unit area showed significant differences in the numbers of cells detected by the different probes. The 473–bp probe detected the most PCV–2–positive cells (– + SD: 59.80 + 9.96), whereas the 169–bp probe detected the fewest PCV–2–positive cells (17.40 + 9.24; P < 0.05). The 169–bp probe detected significantly fewer PCV–2–positive cells than any of the other 8 probes (P < 0.05). In addition, the 225–bp probe detected significantly fewer PCV–2–positive cells than all other probes, excluding the 169–bp probe (P < 0.05; Fig. 2).

There were statistically significant differences in the intensities of the PCV–2 hybridization signals produced by the various probes. The 473-bp probe produced the most intense signal (3.80 + 0.45), whereas the signal produced by the 169–bp probe was the least intense (2.00 + 0.71; P < 0.05). The difference in signal intensity between the smaller probes (169 and 225 bp) and the larger probes (416, 473, 571, 631, 693, and 753 bp) was statistically significant (P < 0.05; Fig. 3).

Fixation time and in situ hybridization

To evaluate the effect of fixation time on in situ hybridization efficiency, lymph node samples were fixed in 10% (w/v) neutral buffered formaldehyde for various times, processed routinely, embedded in paraffin wax, and then subjected to in situ hybridization using the 473–bp probe. All fixation time points were tested simultaneously with in situ hybridization.

Porcine circovirus–2-positive cells were consistently detected in lymph nodes fixed for 1 and 3 days. Thereafter, the number of positive cells declined; however, PCV–2–positive cells were detected in lymph nodes fixed up to 730 days (Fig. 4). The greatest number of PCV–2–positive cells was detected in cells fixed for 1 day (89.67 + 5.99), whereas the least number of PCV–2–positive cells was detected in lymph nodes fixed for 730 days (27.00 + 4.47; P < 0.05). Fixation for 1 and 3 days allowed detection of significantly more PCV–2–positive cells than did fixation for 4 to 730 days (P < 0.05; Fig. 5).

There were statistically significant differences in the PCV–2 signal intensities among lymph nodes fixed for different times. Lymph nodes fixed for 1 day had the highest mean signal intensity (3.60 + 0.55); lymph nodes fixed for 730 days had the lowest mean signal intensity (1.80 + 0.45; P < 0.05). The difference in hybridization intensity between samples fixed for a short term (1–3 days) and a longer term (4–730 days) was statistically significant (P < 0.05; Fig. 6).

Discussion

Both probe size and fixation time significantly influenced the efficiency of in situ hybridization for detecting PCV–2 in FFPE lymph node samples. These results have important implications for in situ hybridization-based diagnosis of PCV–2 infection in swine. In the present study, a 473–bp labeled nucleic acid probe produced maximum hybridization signals in tissues fixed in formalin for 3 days or less.

In situ hybridization is based on the binding of a labeled nucleic acid probe to the complementary sequence in tissue sections, followed by visualization of the hybridized probe within the cells by microscopy. 10 Therefore, penetration of the labeled nucleic acid probe into the tissue section is a critical factor in the success of this technique. Precipitating fixatives such as methanol/acetic acid and Carnoy fixative allow good probe penetration, whereas cross-linking fixatives such as paraformaldehyde and glutaraldehyde are preferred for preserving tissue morphology and for providing better nucleic acid retention. 11 Formalin fixation was chosen in the present study because it is used routinely in most pathology laboratories. Formaldehyde is the main constituent in formalin and is responsible for cross-linking proteins with DNA or RNA, which could limit access of probes to the target nucleic acid sequences. 12 However, the combined pretreatment of tissues in a thermocycler and with protease K could overcome the limited penetration of nucleic acid probes into formalin-fixed tissue. 5 In addition, FFPE tissues are often the only samples available in pathology laboratory archives because fresh tissue and serum from suspected cases are rarely saved for extended periods. Formalin-fixed, paraffin-embedded tissues have been preserved as paraffin blocks for over a century, and this archive represents a historical collection of virtually every disease.

The data from the current study showed that hybridization with larger-sized probes (approximately 400–750 bp) produced more intense signals and detected a greater number of PCV–2–positive cells

Figure 1.

Consecutive serial sections of superficial inguinal lymph nodes at 28 days postinoculation from pigs experimentally infected with Porcine circovirus-2. a, strong hybridization signal. In situ hybridization with the 473-base pair (bp) probe, nitroblue tetrazolium (NBT)/5-bromocresyl-3-indolylphosphate (BCIP), methyl green counterstain. Bar = 30 μm. b, weak hybridization signal. In situ hybridization with the 169-bp probe, NBT/BCIP, methyl green counterstain. Bar = 30 μm.

Figure 2.

Mean number of Porcine circovirus–2-positive cells per unit area according to probe size. Significantly different as compared with the 169–base pair (bp) probe (^*). Significantly different as compared with the 169– and 225-bp probes (°).

Figure 3.

Mean signal intensity per unit area according to probe size. Significantly different as compared with the 169– and 225–base pair (bp) probes (^*). Significantly different as compared with the 324–bp probe (°).

Figure 4.

Consecutive serial sections of superficial inguinal lymph nodes at 28 days postinoculation from pigs experimentally infected with Porcine circovirus-2. a, strong hybridization signal. One-day fixation, 473–base pair (bp) probe, nitroblue tetrazolium (NBT)/5–bromocresyl–3–indolylphosphate (BCIP), methyl green counterstain. Bar = 30 μm. b, weak hybridization signal. Ninety-day fixation, 473–bp probe, NBT/BCIP, methyl green counterstain. Bar = 30 μm.

Figure 5.

Mean number of Porcine circovirus-2-positive cells per unit area according to fixation time. Significantly different as compared with 1 and 3 days’ fixation (^*). Significantly different as compared with 15 and 30 days’ fixation (†). Significantly different as compared with 60 and 90 days’ fixation (†). Significant differently as compared with 120 and 180 days’ fixation (§).

than did hybridization with smaller-sized probes (approximately 100-300 bp). These differences in signal intensity could have resulted from differences in the strengths of the intermolecular forces between the probe and its complementary sequence. Intermolecular forces of appropriate strength are pivotal for binding and stabilizing the hybridization process. 10,11 Detecting false-positive signals is the most common problem encountered during in situ hybridization. 10,11 To avoid false-positive reactions, washing solutions must be of adequate stringency to remove nonspecifically bound and unhybridized probes. Since the intermolecular forces between small-sized probes and the target sequence may be weaker than those between larger-sized probes and the target sequence, 9 smaller-sized probes could dissociate from the hybridization complex if the conditions are too stringent.

In situ hybridization and immunohistochemistry (IHC) are the common methods for detecting viral genomes and proteins, respectively, in FFPE tissues. However, application of IHC is largely restricted by antibody availability, and the generation of monoclonal antibodies and the production of ascites fluid are technically complex, expensive, and time-consuming. In contrast to IHC, DNA probes can be prepared easily by PCR, and the increasing availability of probes and sequence databases ensures the expanded use of in situ hybridization in diagnosis and research. The use of digoxigenin-labeled probes avoids the use of radioactive materials and renders in situ hybridization easily transferable to diagnostic laboratories that currently perform IHC procedures. Therefore,

Figure 6.

Mean signal intensity per unit area according to fixation time. Significantly different as compared with 1 and 3 days’ fixation (^*). Significantly different as compared with 15 and 30 days’ fixation (†). Significantly different as compared with 60 days’ fixation (‡).

the most attractive advantage of in situ hybridization is the ability to detect viral genomes in FFPE tissues without the need for antibodies.

The results of the current study demonstrated that optimal detection of PCV–2 in formalin-fixed (1–3 days), paraffin-embedded tissues occurred using a medium-sized probe (473 bp). Optimizing the probe size and fixation time may facilitate detection of small amounts of viral DNA in FFPE tissues, especially in cases of subclinical or chronic infection.

Acknowledgements

This research was supported by the Technology Development Program for Agriculture and Forestry, Ministry for Agriculture, Forestry and Fisheries. The research was also supported by Brain Korea 21 Program for Veterinary Science and the Korea Research Foundation Grant (KRF–2006–005–J02902) in the Republic of Korea.