The predicted target gene validation,function,and prognosis studies of miRNA-22 in colorectal cancer tissue

Abstract

MicroRNAs are known as small, non-coding, and single-stranded RNAs which can regulate cell proliferation, differentiation, and apoptosis and involve in the development of tumors. In this study, colorectal cancer tissue morphological change in different prognosis in patients was observed by hematoxylin and eosin staining. Thereafter, differentially expressed miR-22 and TIAM1 gene were detected using quantitative polymerase chain reaction and western blot in different colorectal cancer tissues. Meanwhile, luciferase reporter gene system was used to verify the relationship between miR-22 and TIAM1. Eventually, the survival curve was plotted according to follow-up records of patients with colorectal cancer and the expression levels of miR-22 and TIAM1 in different tumor tissues. The hematoxylin and eosin results showed the poor pathological features in the 1-year survival group. The expression level of miR-22 was upregulated and TIAM1 was inhibited, correlating with the extension of patients’ survival time. Our results indicated that miR-22 and TIAM1 might play a regulatory role in the occurrence and development of colorectal cancer which were consistent with the survival curve analysis results. Furthermore, the luciferase in miR-22 co-transfected with pmiR-RB-REPORT-TIAM1 group was significantly lower than pmiR-RB-REPORT-TIAM1-mut and Si groups. Collectively, these data suggest that miR-22 may suppress the expression of its target gene TIAM1. The low miR-22 level or the high TIAM1 level will indicate the poor prognosis in colorectal cancer patients.

Keywords

Colorectal cancer miRNA-22 prognosis

Introduction

Colorectal cancer was reported as one of the most common digestive system malignant tumors which occur in colon and rectum and cause serious threat to human life and health.¹ The development of colorectal cancer is related to a variety of factors, including colon polyps, ulcerative colitis, age, obesity, environment, lifestyle, diet, and genes interaction.^2,3 However, the incidence and mortality of colorectal cancer were obviously increased with the changing of people’s lifestyle and diet. At present, surgery plus chemotherapy was the treatment for colorectal cancer. Clinical studies in recent years suggested that adjuvant chemotherapy after operation could obviously improve the survival and the life quality of patients with colorectal cancer. However, due to some characteristics of the tumor, most patients eventually developed metastatic disease and succumb to colorectal cancer with poor treatment and prognosis. In summary, early detection, diagnosis, and treatment were required to more effectively control the development of the disease.

MicroRNA (miRNA) is an endogenous, non-coding, single-stranded, and small-molecule RNA which consists of about 21–23 nucleotides and is processed from about 70–90 bases of single-stranded messenger RNA precursors (pre-mRNA) with hairpin structure. MiRNAs were a negative regulator of target gene by complementary bind with target gene mRNA 3′-untranslated region (3′-UTR), causing the target gene mRNA degradation or translation inhibition.^4,5 The oncogenes and tumor suppressor genes of miRNAs could participate in a variety of biological processes, including cell proliferation, apoptosis, migration, differentiation, and cell cycle.^6–9 The expression of such small RNAs was specific in organization and time; meanwhile, they were important modulatory molecules of other functional genes in various life activities of the organism.

Mature miR-22 was 22 nt in length and located in human chromosome 17p13.3 in HeLa cells. The expression of miR-22 was reduced in various cancer tissues as a tumor suppressor compared with normal tissues. Therefore, the detection of its expression in tissue cells could be used as alternative biomarkers of cancer diagnosis and prognosis.^10,11 In gastric cancer cells, overexpression of miR-22 could significantly reduce cancer cell proliferation and promote cell apoptosis, suggesting that miR-22 could be used as a potential cancer therapeutic gene. In prostate cancer models, miR-22 was overexpressed¹² and the expression of miR-22 in lung cancer tissues and A549 and H1299 lung cancer cell lines was reduced meanwhile, lung cancer cell proliferation and attacks were significantly inhibited by transfection of miR-22 plasmid.¹³ Furthermore, miR-22 expressed in hepatocellular carcinoma, intrahepatic bile duct carcinoma, and breast cancer was all downregulated and the prognosis was poor.^14,15 In recent years, researches on TIAM1 gene have shown that it could promote tumorigenesis and metastasis in a variety of tumors. Our early results suggested that the expression of TIAM1 transfected with miR-22 plasmid in HCT-116 and the cell viability was inhibited.¹⁶ The expression of miR-22 and TIAM1 in colorectal cancer has been reported; however, their target relationship and prognosis studies of miR-22 in Chinese Han population colorectal cancer tissue were still unclear.

In this study, colorectal cancer tissue morphological change in different prognosis in patients was observed by hematoxylin and eosin (HE) staining. Thereafter, differentially expressed miR-22 and TIAM1 gene were detected using qPCR and western blot in different colorectal cancer tissues. Meanwhile, luciferase reporter gene system was used to verify the relationship between miR-22 and TIAM1. Eventually, the survival curve was plotted according to the follow-up records of patients with colorectal cancer and the expression levels of miR-22 and TIAM1 in different tumor tissues. It should be helpful for further studies of the role of miR-22 and its target gene in the regulation of colorectal cancer occurrence and development.

Materials and methods

Tissue samples

Colorectal cancer patients who had surgery in 2010–2011 were enrolled from the Department of Colorectal and Anal Surgery in Third Affiliated Hospital of Jilin University. The study was approved by the Ethics Committee of Third Affiliated Hospital of Jilin University. The colorectal cancer tissue and normal paracancerous tissue were stored in liquid nitrogen or washed in pure water after soaking in 4% formaldehyde for 3 days. Follow-up observation was conducted once every 3 months during the first two post-operative years for the patients and once every 6 months thereafter for 3 years until June 2015. Survival time was determined from the date of the completion of colorectal cancer surgery to death. The patients who died from traffic accident or other non-colorectal cancer reasons were recorded as “censored data.” The gender, age, tumor size, histological type, depth of invasion, location, lymph node metastasis, lymphatic invasion, and liver metastasis were recorded. The patients were divided into three groups based on their survival time: (1) 1-year group, patients in this group died in the first year after surgery; (2) 3-year group, patients in this group died between the first year and the third year after surgery; and (3) survival group, patients in this group still survived until 36 months after surgery.

HE staining

Two samples were randomly selected from each group. The paraffin sections were made from the patient tissues. After dewaxing by dimethylbenzene-ethanol method, the slices were washed with distilled water. Then, nuclei were stained with hematoxylin for 4 min. After rinsing in running tap water, the sections were differentiated with 0.3% acid alcohol and rinsed in 0.2% ammonia solution. The eosin was used to stain cytoplasm for 2 min. Morphology analysis of colorectal cancer tissue pathological changes was done through a microscope.

Real-time PCR and western blot detection

The colorectal cancer tissues were frozen in liquid nitrogen, total RNA was isolated using Trizol reagent and primer mix, and miR-125b and U6 primers were designed for complementary DNA (cDNA) synthesis by a reverse transcription polymerase chain reaction (RT-PCR) Kit (Takara, Dalian, China) according to the manufacturer’s instructions. MiR-125b, U6, TIAM1, and β-actin primers for qPCR detection and the above-mentioned reverse transcription primers were listed in Table 1. The qPCR reaction amplification system includes 2 µL cDNA, 10 µL PCR-Master Mix, 0.5 µL F-Primer, 0.5 µL R-Primer, and 7 µL RNase-free H₂O under the following reaction conditions: 95°C for 1 min; followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The detection and qPCR results were analyzed using Agilent StrataGene Mx3005P (Agilent, Santa Clara, California, USA).

Table 1.

TIAM1 and β-actin primers and the reverse transcription primers.

Primer	Sequence (5′ to 3′)
miR-22-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAAAGCTT
qPCR-miR-22-F	TGCGGAGTTCTTCAGTGGCAA
qPCR-miR-22-R	CAGTGCAGGGTCCGAGGT
qPCR-TIAM1-F	AAGACGTACTCAGGCCATGTCC
qPCR-TIAM1-R	GACCCAAATGTCGCAGTCAG
qPCR-β-actin-F	CTGGAACGGTGAAGGTGACA
qPCR-β-actin-R	AAGGGACTTCCTGTAACAACGCA
U6-RT	AACGCTTCACGAATTTGCGT
qPCR-U6-F	CTCGCTTCGGCAGCACA
qPCR-U6-R	AACGCTTCACGAATTTGCGT

Total protein concentrations were assessed by bicinchoninic acid (BCA) Protein Assay Kit (Boster, Wuhan, China) after being extracted from colorectal cancer tissues by radioimmunoprecipitation assay (RIPA) buffer (Boster) referring to the instructions and stored at −80°C. The protein samples (30 µg per sample) were isolated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted onto polyvinylidene fluoride (PVDF) membrane. The membrane was blocked by 5% defatted milk powder for 1 h and then incubated sequentially with anti-TIAM1 antibody (Abcam, Waltham, MA, USA), 1:1000 and anti-rabbit IgG (Abcam). The bandings of TIAM1 protein were obtained by enhanced chemiluminescence (ECL) Western Blotting Substrate (Invitrogen, Waltham, MA, USA).

Bioinformatics prediction and luciferase reporter system detection of target gene

The target gene of miR-22 was predicted in our previous research, and the expressions of miR-22 and the predicted target gene were detected after miR-22 overexpressed in HCT-116 cells.¹⁶ The vectors of reporter gene (wild-type (WT) vectors and mutant (MUT) vectors) were constructed and confirmed by RiboBio (RiboBio Company, Guangzhou, China).

For co-transfection, the Opti-MEM serum-free medium (150 µL; GIBCO, New York, USA) was mixed with Lipofectamine TM2000 (5 µL; Invitrogen), miR-22 mimics (1.25 µL), and pmiR-RB-REPORT-vectors (500 ng) at room temperature for 5 min after cells were seeded to approximately 80% confluence in six-well plates. Thereafter, the mixture was uniformly mixed and incubated at room temperature for 30 min. Cells were cultured with the mixture for 4 h before re-feeding with fresh medium. After 48 h of co-transfection, a dual-luciferase reporter assay system (Promega, Madison, USA) was used to detect the luciferase activity in HCT-116 cells according to the manufacturer’s instructions.

Statistical analysis

The gene expression levels were reported as mean ± SD and relative mRNAs expressions were calculated using 2^−ΔΔCT method. The different levels of comparison among groups were with the use of one-way analysis of variance. The relationships between the gene expression levels and potential explanatory variables, gender, age, tumor size, histological type, depth of invasion, location, lymph node metastasis, lymphatic invasion, and liver metastasis, were detected with chi-square test. The Kaplan–Meier and log-rank test methods were used for the analysis of post-operative survival rate and the differences in survival rates, respectively. The multivariate analysis was analyzed by a Cox proportional hazards model. All the statistical analyses of the results were conducted using SPSS16.0 software for windows and p value < 0.05 was considered as a significant difference.

Results

Patient statistics

A total of 193 colorectal cancer patients were included in this study. Their surgeries were performed from September 2010 to December 2011. Among all patients, 23 cases were died in the first year after surgery, 34 cases were died in the first 3 years after surgery, 133 cases were still survived until June 2015, and 3 subjects were censored. The total rate of follow-up was 98.4%. Male occupied 58% of the total patients. The average age was 61.7 ± 11.3 years. All the patients enrolled were Han population in China.

Pathological changes in different prognosis colorectal cancer tissue

As shown in Figure 1, for the cases who died in the first year (1-year group), the colonic mucus layer was totally disrupted. No integrated crypt was observed. Adenocarcinoma cells invade to normal glandular epithelial cells. For the 3-year survival group, accumulation of polykaryocytes and the presence of hyperchromatic nuclei were observed. The moderately differentiated adenocarcinoma tumor cells had spread into colonic crypts and showed complicated glandular structures. The spindle cells and connective tissues massively proliferated among crypts. For the tumor tissue from survival group, carcinoma grew in situ. Slightly abnormal glandular structures were observed, cell numbers and morphology were different in crypts, and proliferation connective tissues were found between glands. And in the normal paracancerous tissue, gland epithelium cells were formula and connective tissue were less in mucus layer.

Figure 1.

Hematoxylin and eosin (HE) staining of colorectal cancer tissues.

Expression of miR-22 and TIAM1 in different prognosis colorectal cancer tissue

The TIAM1 was the predicted target gene of miR-22 in our previous research, and the expressions of miR-22 and the predicted target gene were detected after miR-22 overexpressed in HCT-116 cells. In this study, we used qPCR and western blot to examine the changes in miR-22 and TIAM1 expression levels in different prognosis colorectal cancer tissue, and the results showed that miR-22 expressed in 1-year group, 3-year group, and survival group was significantly different (p < 0.05, Figure 2(a)), increasing with the growth of survival time. TIAM1 gene mRNA expression levels were suppressed and the relative contents were 6.89, 3.70, and 0.99 in 1-year group, 3-year group, and survival group, respectively (p < 0.05, Figure 2(b)). Western blot results of TIAM1 were consistent with the mRNA expression levels mentioned above (Figure 2(c)). The results from qPCR and western blot showed that miR-22 was a negative regulator in the development of colorectal cancer; meanwhile, TIAM1 played a positive role in the regulation, which indirectly indicated that there was an interaction between miR-22 and TIAM1.

Figure 2.

Relative expression of (a) miR-22 and (b) TIAM1 mRNA and (c) western blot of TIAM1 protein.

Dual-luciferase assay

In our experiments, miR-22 was considered to bind with the predicted target sites in TIAM1 mRNA 3′-UTR, and the WT and MUT 3′-UTR fragments with predicted binding site were inserted into the reporter plasmid to determine whether the TIAM1 gene expression was regulated by miR-22. Results showed that the luciferase activity of WT group was significantly decreased compared with MUT group and reporter plasmid group in HCT-116 cells (p < 0.05; Figure 3). A significant decrease in expression was also observed in cells transfected with miR-22 plasmid compared with parental or negative control (NC) cells. Besides, the expression of miR-22 also exerted inhibitory effects on the suppression of HCT-116 cell migration and invasion.¹⁶ This finding suggested that miR-22 binding site exists in TIAM1 mRNA 3′-UTR.

Figure 3.

Dual-luciferase assay of miR-22.

Analysis of miR-22 expression and prognostic survival

Kaplan–Meier method was used to plot the overall survival curve, and Cox proportional hazards regression model was used to plot the subgroup survival curve (Figure 4). For subgroup analysis, we set three groups according to the relative expression of miR-22: the case which expressed less than 2 belongs to “low miR-22 level” group, 2–10 belongs to “moderate miR-22 level” group, and more than 10 belongs to “high miR-22 level” group. Similarly, three TIAM1 mRNA level groups were defined: 0–2 as “low TIAM1 level” group, 2–5 as “moderate TIAM1 level” group, and >5 as “high TIAM1 level” group. Then, prognostic factors were identified by univariate analysis with Cox proportional hazards model, including patient features, tumor characteristics, and miR-22 and TIAM1 mRNA expression. However, the analysis results of age, gender, tumor size, and location prognostic factors had no statistical significance. And miR-22 and TIAM1 mRNA expression demonstrated significant HRs between groups (Table 2). The multivariate analysis of prognosis factors by a Cox proportional hazards model indicated that high miR-22 expression and low TIAM1 level were the important indicators of the best survival in colorectal cancer, even better than overall survival status (p < 0.005). In contrast, the low miR-22 level and high TIAM1 level predicted the poorest prognosis (p < 0.001; Figure 4).

Figure 4.

Survival curves of colorectal cancer patients after surgery: (a) survival curves of different miR-22 levels and (b) survival curves of different TIAM1 mRNA levels.

Table 2.

Cox proportional hazards analysis of miR-22 and TIAM1 expression.

MiRNA-22	HR	95% CI	TIAM1 mRNA	HR	95% CI
L-M	1.94	1.31–4.81	H-M	1.85	1.16–4.17
M-H	2.12	4.22–14.31	M-L	6.03	6.03–21.24
L-H	3.81	17.94–89.34	H-L	23.65	23.65–134.6

HR: hazard ratio; CI: confidence interval.

Discussion

MiRNA is an endogenously expressed and highly conserved non-coding small-molecule single-stranded RNA with the function of regulating gene expression activity. The mature miRNA could bind with target genes mRNA 3′-UTR inducing the formation of silencing complex (RNA-induced silencing complex (RISC)), resulting in mRNA degradation or translation blocking to regulate the target gene expression in transcription level.^4,5 The in-depth study found that miRNA not only participated in the development of plants’ and animals’ tissues and organs; cell proliferation, differentiation, and apoptosis; and secretion of hormone but also widely involved in tumor pathogenesis.

More and more studies have confirmed that miRNAs played an important role in various physiological and pathological processes and were closely related to the incidence of cancer.¹⁷ MiR-22 was originally found in cervical cancer HeLa cells as a tumor suppressor gene, and the role of miR-22 in different tumors was extensively studied. Studies have shown that miR-22 was downregulated in gastric cancer by targeting regulatory Wnt signaling pathway to inhibit gastric cancer cell proliferation and induce apoptosis.¹⁸ Meanwhile, miR-22 could improve the sensitivity of cancer cells to chemotherapeutic drugs for reducing resistance phenomenon of cancer cells which was helpful to enhance the efficacy of chemotherapy.¹⁹ MiR-22 target genes were varied which could regulate a variety of biological processes such as targeting MECP2 gene for the expression regulation of methylated DNA downstream²⁰ and suppressing BTG1 gene expression thereby inhibiting cell autophagy for enhancing sensitivity of cancer cells to 5-fluorouracil.²¹ MiR-22 could also inhibit cell migration, affect the cell cycle, and promote apoptosis by acting on TIAM1, ERα, and MDC1 genes.^22,23 In our previous work, we found that miR-22 could downregulate TIAM1 expression and suppress colon cancer cell viability, migration, and invasion in vitro.¹⁶ We verified whether TIAM1 is the target gene of miR-22 by dual-luciferase assay in this study. TIAM1 is a Rac activator, and it modulates the activity of Rho-like proteins and connects extracellular signals to cytoskeletal activities.²⁴ The overexpressed TIAM1 gene could make tumor larger and more aggressive in nude mice,²⁵ and TIAM1-deficient mice have much fewer and smaller tumors.²⁶ To our knowledge, no previous study has examined the relationship between miR-22 and TIAM1 and the effect of miR-22 and TIAM1 expression on the outcome of the patients with colorectal cancer.

In this study, the morphological changes in different colorectal cancer prognosis were detected by HE method. With the extension of survival time, the tumor cells gradually become invasive and metastatic. We also investigated the expression of miR-22 and the predicted target gene TIAM1 with different prognosis, confirming the relationship between miR-22 and TIAM1 gene. Results showed that TIAM1 gene could be significantly negatively regulated by miR-22. Meanwhile, high miR-22 expression and low TIAM1 level were the important indicators of better survival status in colorectal cancer.

In conclusion, we reported that TIAM1 was a target gene of miR-22. The low expression of miR-22 and the upregulated TIAM1 predicted poor prognosis in colorectal cancer. The findings may provide important insights into understanding the pathology of colorectal cancer.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This research was supported by Youth Foundation of Jilin Committee of Science and Technology, China (Grant No. 20150520146JH).

References

Stintzing

Management of colorectal cancer. F1000Prime Rep 2014; 6: 108.

Siegel

Zou

. Cancer statistics, 2014. CA Cancer J Clin 2014; 64(1): 9–29.

Vargas

Thompson

PA.

Diet and nutrient factors in colorectal cancer risk. Nutr Clin Pract 2012; 27(5): 613–623.

Bartel

DP.

MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116(2): 281–297.

Farh

Grimson

Jan

. The widespread impact of mammalian microRNAs on mRNA repression and evolution. Science 2005; 310(5755): 1817–1821.

Garzon

Calin

Croce

CM.

MicroRNAs in cancer. Annu Rev Med 2009; 60: 167–179.

Esquela-Kerscher

Slack

FJ.

Oncomirs—microRNAs with a role in cancer. Nat Rev Cancer 2006; 6(4): 259–269.

Meng

Henson

Lang

. Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology 2006; 130(7): 2113–2129.

Zhang

Pan

Cobb

. MicroRNAs as oncogenes and tumor suppressors. Dev Biol 2007; 302(1): 1–12.

10.

Wan

Zhang

Wang

. Down-regulated miR-22 as predictive biomarkers for prognosis of epithelial ovarian cancer. Diagn Pathol 2014; 9: 178.

11.

Zhang

Xia

Tian

. Clinical significance of miR-22 expression in patients with colorectal cancer. Med Oncol 2012; 29(5): 3108–3112.

12.

Poliseno

Salmena

Riccardi

. Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal 2010; 3(117): ra29.

13.

Ling

Wang

Long

. Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3. J Cancer Res Clin Oncol 2012; 138(8): 1355–1361.

14.

Kawahigashi

Mishima

Mizuguchi

. MicroRNA profiling of human intrahepatic cholangiocarcinoma cell lines reveals biliary epithelial cell-specific microRNAs. J Nippon Med Sch 2009; 76(4): 188–197.

15.

Xiong

Wei

. An estrogen receptor alpha suppressor, microRNA-22, is downregulated in estrogen receptor alpha-positive human breast cancer cell lines and clinical samples. FEBS J 2010; 277(7): 1684–1694.

16.

Song

Liu

. miRNA-22 suppresses colon cancer cell migration and invasion by inhibiting the expression of T-cell lymphoma invasion and metastasis 1 and matrix metalloproteinases 2 and 9. Oncol Rep 2013; 29(5): 1932–1938.

17.

Casalini

Iorio

MV.

MicroRNAs and future therapeutic applications in cancer. J BUON 2009; 14(Suppl. 1): S17–S22.

18.

Tang

Kong

Guo

. Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathway by up-regulation of miR-200b and miR-22. Cancer Lett 2013; 340(1): 72–81.

19.

Zhang

Zhao

. Overexpression of miR-22 reverses paclitaxel-induced chemoresistance through activation of PTEN signaling in p53-mutated colon cancer cells. Mol Cell Biochem 2011; 357(1–2): 31–38.

20.

Feng

Huang

Wani

. Ischemic preconditioning potentiates the protective effect of stem cells through secretion of exosomes by targeting Mecp2 via miR-22. PLoS ONE 2014; 9(2): e88685.

21.

Zhang

Tang

. MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett 2015; 356(2 Pt B): 781–790.

22.

Wang

. miR-22 inhibits proliferation and invasion in estrogen receptor alpha-positive endometrial endometrioid carcinomas cells. Mol Med Rep 2014; 9(6): 2393–2399.

23.

Lee

Park

Jeong

. MicroRNA-22 suppresses DNA repair and promotes genomic instability through targeting of MDC1. Cancer Res 2015; 75(7): 1298–1310.

24.

Malliri

Collard

JG.

Role of RHO-family proteins in cell adhesion and cancer. Curr Opin Cell Biol 2003; 15(5): 583–589.

25.

Zhang

. TIAM1 transgenic mice display increased tumor invasive and metastatic potential of colorectal cancer after 1,2-dimethylhydrazine treatment. PLoS ONE 2013; 8(9): e73077.

26.

Malliri

van der Kammen

Clark

. Mice deficient in the Rac activator TIAM1 are resistant to Ras-induced skin tumours. Nature 2002; 417(6891): 867–871.