Overexpression of LAMC2 predicts poor prognosis in colorectal cancer patients and promotes cancer cell proliferation,migration,and invasion

Abstract

Laminin γ2 (LAMC2) has been reported to be involved in the development and progression of a variety of tumors. However, its function in human colorectal cancer is unclear. Our study aimed to investigate the role of laminin γ2 in colorectal cancer. We first performed the multiple Kaplan–Meier survival analysis of laminin γ2 in a cohort of Gene Expression Omnibus datasets and evaluated its relationship with clinical outcomes of colorectal cancer patients. Then, we established stable colorectal cancer cell lines with laminin γ2 overexpression and examined the functional assays in vitro. Finally the expression pattern of laminin γ2 in colorectal cancer clinical samples was analyzed by immunohistochemistry and quantitative real-time polymerase chain reaction. We found that laminin γ2 was significantly correlated with poor clinical outcomes such as disease-specific, recurrence-free, disease-free, and overall survival in colorectal cancer. Moreover, stably overexpressing laminin γ2 promoted proliferation, migration, and invasion of colorectal cancer cells. In addition, overexpressed laminin γ2 was identified in tumor tissues compared with paired adjacent normal tissues and was related to tumor–node–metastasis stage (p = 0.001) and lymph node metastasis (p < 0.001). In summary, our results strongly suggest that laminin γ2 may be a potential prognostic biomarker and therapeutic target in colorectal cancer.

Introduction

Colorectal cancer (CRC) is one of the most common digestive carcinomas and remains the third leading cause of cancer-related deaths worldwide. ¹ Despite of the advanced surgical techniques and chemotherapy treatment over the last decades, approximately 20% of patients die of recurrence and metastasis events leading to the poor prognosis. ² As a result, the identification of novel biomarkers that can predict progression, metastasis, and prognosis of CRC are urgently needed.

The Gene Expression Omnibus (GEO) database is an international public repository that contains a large number of genomic datasets with clinical information. ³ Although several key pathways and genes that have predictive value in CRC have been identified using these datasets,^4–6 there tends to be inconsistencies among studies due to limitations of small sample sizes and varying results. Therefore, an integrative meta-analysis of multiple GEO datasets can enhance statistical power in identifying more precise and reliable gene signatures. ⁷

Laminin γ2 (LAMC2) is a subunit of the heterotrimeric glycoprotein laminin-332, which is an essential component of epithelial basement membranes and regulates cell motility and adhesion. ⁸ It has been reported that LAMC2 was highly expressed in a variety of carcinomas, including pancreas, stomach, esophageal, lung, and thyroid cancer and was also associated with distant metastasis, recurrence, and poor prognosis.^9–11 Moreover, DNA copy number of LAMC2 was also increased in nasopharyngeal carcinoma, hepatocellular carcinoma, and squamous lung cancer.^12–14 Significant elevation of LAMC2 in pancreatic cancer patients with low cancer antigen 19.9 (CA 19.9) levels suggests that LAMC2 might prove to be an important complementary biomarker for CA 19.9. ¹⁵

To clarify the possible involvement of the LAMC2 in CRC, we examined its expression levels in a comprehensive meta-analysis of GEO datasets and clinical samples. We found that LAMC2 was highly expressed in CRC and related to clinical prognosis, tumor–node–metastasis (TNM) stage, and metastasis. Overexpression of LAMC2 promoted proliferation, invasion, and migration of CRC cells. Overall, we identified LAMC2 as a new prognostic biomarker and a potential therapeutic target in CRC.

Materials and methods

GEO dataset analysis

We used Affymetrix datasets publicly available in GEO database with clinical information as original research. Each of datasets (GSE17536, GSE24549, GSE24550, GSE39582, and GSE29621) included individual gene expression level with overall survival (OS), or disease-specific survival (DSS), or disease-free survival (DFS), or recurrence-free survival (RFS) information for patients with CRC. Datasets with gene expression profile comparing cancer to adjacent normal tissues were obtained from datasets GSE31737, GSE41328, and GSE44076. GSE39582 and GSE16125 datasets included TNM stage information. GSE28702 contained 56 CRC and 27 metastasis tissue samples.

Cell culture

The human CRC cell lines HCT116 and HCT8 were purchased from the American Type Culture Collection (USA), which were cultured in RPMI-1640 medium (Gibco, USA) medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen, USA) at 37°C in an atmosphere with 5% CO₂.

Plasmids and constructs

LAMC2 was cloned into pWSLV-puro-GFP-vector and validated by sequencing. Virus was produced by transfection of approximately 1 × 10⁷ 293T cells with 4 µg pWSLV-GFP, 4 µg DR8.9, and 1 µg VSVG plasmids using 24 µL linear polyethylenimine (PEI; Poly-sciences, USA). Viral supernatant was harvested 72 h after transfection. Mammalian cells were infected at a 1:100 dilution of virus in the presence of 4 µg/mL polybrene (Millipore, USA) and centrifuged for 30 min at 2000 r/min. The culture medium was changed immediately after spin infection, and 48 h later infected cells were selected by flow cytometry (MoFlo XDP; Beckman Coulter, USA).

RNA extraction and quantitative reverse transcription polymerase chain reaction analyses

Total RNA was extracted from tissues or cultured cells using TRIzol reagent (Invitrogen). For quantitative reverse transcription polymerase chain reaction (qRT-PCR), RNA was reverse transcribed into complementary DNA (cDNA) using a Reverse Transcription Kit (TaKaRa, Beijing, China). Real-time PCR analyses were performed with SYBR Green (TaKaRa). Results were normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used were as follows—LAMC2: TACAGAGCTGGAAGGCAGGATG (sense) and GTTCTCTTGGCTCCTCACCTTG (antisense); GAPDH: GGAGCGAGATCCCTCCAAAAT (sense) and GGCTGTTGTCATACTTCTCATGG (antisense).

The amplification conditions were as follows: 1 cycle of 2 min at 95°C followed by 40 cycles of 10 s at 95°C, 30 s at 60°C, and 30 s at 72°C. All experiments were performed in triplicate.

Western blot assay and antibodies

Cell protein lysates were separated by 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), transferred to 0.22 µm polyvinylidene fluoride (PVDF) membranes (Sigma, USA), and incubated with specific antibodies. GAPDH antibody was used as a control (Santa Cruz Biotechnology, USA), and anti-LAMC2 (1:1000) was purchased from Chemicon (USA).

Cell viability and cycle assays

Cell viability was assessed by Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Shang Hai, Japan). Cell cycle was measured by flow cytometry by staining the cells with propidium iodide (Sigma).

Cell migration and invasion assay

A volume of 1 × 10⁵ cells in serum-free media were placed onto the upper chamber of an insert for migration (8-µm pore size; Millipore) and invasion assays with Matrigel (Corning, Jiangsu, China). Media containing 10% FBS was added to the lower chamber. After 24 h of incubation, the cells that had migrated or invaded through the membrane were fixed in 4% paraformaldehyde and stained by 0.1% crystal violet.

Tissue collection

The study was approved by the Ethics Committee of the Beijing Cancer Hospital, Peking University. Fresh-frozen and paraffin-embedded CRC tissues and corresponding adjacent non-tumorous colon samples were obtained from Beijing Cancer Hospital, Peking University. All the cases were reviewed by pathologist and histologically confirmed as CRC based on histopathological evaluation. No local or systemic treatment was conducted in these patients before the operation.

Immunohistochemical analysis

Immunohistochemistry (IHC) was performed to study altered LAMC2 protein expression in CRC. Negative control was incubated with phosphate-buffered saline (PBS). The degree of immunostaining of LAMC2 protein was assayed and scored by the staining intensity. Scores representing the intensity of positively stained tumor cells were graded as follows: 0 (no staining), 1 (weak staining, light yellow), 2 (moderate staining, yellow brown), or 3 (strong staining, brown). We identified the optimal cutoff as follows: The staining index score of more than or equal to 3 was considered as high expression and less than or equal to 2 as low expression.

Statistical analysis

Clinical and gene expression profiling data were analyzed using standard statistical tests including the log-rank test and Student’s t tests. To compare LAMC2 RNA expression among different TNM stages, the Kruskal–Wallis test was used. Differences were considered significant when p < 0.05. Analyses were performed using GraphPad Prism 6.0 (GraphPad Software, Inc.; http://www.graphpad.com/) and the statistical package SPSS (version 20.0; IBM, USA).

Results

LAMC2 was a prognosis biomarker in CRC

To confirm the reproducibility prognostic value of LAMC2, we retrieved a validation cohort from the GEO datasets and performed Kaplan–Meier survival analysis of this gene. By analyzing gene expression profiles and corresponding clinical information of CRC patients, we found that high expression of LAMC2 conferred poor DSS, DFS, RFS, and OS. The log-rank test results identified that LAMC2 was closely related to OS in three datasets (Figure 1(a), (g), and (i)), DFS in four datasets (Figure 1(c)–(f)), and DSS/RFS in one dataset (Figure 1(b) and (h)). All these data indicated that LAMC2 conferred poor prognosis in CRC.

Figure 1.

LAMC2 was significantly correlated with prognostic and clinicopathological parameters in GEO datasets. Kaplan–Meier survival analysis of the prognostic value (OS/DFS/DSS/RFS) of LAMC2 was analyzed in GEO datasets: (a) GSE17536-OS, (b) GSE17536-DSS, (c) GSE17536-DFS, (d) GSE24549-GPL5175-DFS, (e) GSE24549-GPL11028-DFS, (f) GSE24550-GPL5175-DFS, (g) GSE39582-OS, (h) GSE39582-RFS, and (i) GSE29621-OS. Kruskal–Wallis test confirmed that LAMC2 was correlated with TNM stage: (j) GSE39582, p = 0.003; and (k) GSE16125, p = 0.021. The expression level of LAMC2 in tumor and normal tissues: (l) GSE41258, p < 0.001; (m) GSE31737, p < 0.001; (n) GSE41328, p < 0.05; and (o) GSE44076, p < 0.001. LAMC2 expression in primary tumor and metastasis tissues: (p) GSE28702, p < 0.01.

To explore the correlation between LAMC2 and CRC progression, we analyzed several other GEO datasets. Kruskal–Wallis test confirmed that LAMC2 was correlated with TNM stage (Figure 1(j) and (k)). In addition, LAMC2 was highly expressed in tumor tissues when compared with adjacent normal tissues as well as healthy colon samples from healthy donors (Figure 1(l)–(o)). LAMC2 was also highly expressed in metastasis tissues when compared with primary tumor tissues (Figure 1(p)). Taken together, our results show that LAMC2 was a TNM-stage-related gene in CRC and was overexpressed in tumor tissues. The expression level of LAMC2 may also be associated with distant metastasis.

LAMC2 promoted proliferation, migration, and invasion in CRC

To investigate the biological function of LAMC2 in CRC cells, LAMC2 was stably transduced into HCT8 and HCT116 cells (Figure 2(a) and (b)). The results from the CCK-8 assay showed that ectopic overexpression of LAMC2 significantly increased the rate of proliferation as compared with that of vector control cells (Figure 2(c)). Furthermore, transwell assay revealed that overexpression of LAMC2 promoted migration and invasion compared to vector control (Figure 2(d) and (e)). In addition, LAMC2 overexpressing CRC cells markedly increased the proportion of S-phase cells as compared with that of vector control cells (Figure 2(f) and (g)). These data demonstrated that LAMC2 was able to modulate the invasion and migration properties of CRC cells. Moreover, LAMC2 might promote G1/S transition and thus enhance the proliferation of CRC cells.

Figure 2.

Overexpression of LAMC2 enhances proliferation, migration, and invasion of CRC cells. (a and b) Overexpression of LAMC2 in CRC cell lines was analyzed by Western blotting and RT-PCR. (c) CCK-8 assay was performed to evaluate the effect of LAMC2 overexpression on the proliferation of CRC cells. (d and e) Overexpression of LAMC2 increased migration and invasion in HCT8 and HCT116 cells. (f and g) Flow cytometric determination of proportion of indicated cells in distinct cell cycle phases. (*p < 0.05;**p < 0.01;***p < 0.001).

Expression pattern of LAMC2 in CRC clinical samples

To further understand the clinical relevance of LAMC2 in progression of human CRC, we first analyzed the LAMC2 messenger RNA (mRNA) expression in 21 paired tumor and normal colon samples. As shown in Figure 3(a), LAMC2 was significantly overexpressed in colorectal tumor samples (p < 0.01) and was associated with TNM stage (p < 0.05). These results were consistent with the above GEO dataset analysis results. We then examined the expression level of LAMC2 in 49 paired tumor and adjacent normal samples by immunohistochemical staining. Consistent with the mRNA results, the expression level of LAMC2 was significantly higher in TNM stage III/IV than in early TNM stage I/II (Figure 3(b)). Furthermore, the results showed that LAMC2 was highly expressed in tumor tissues when compared with paired normal tissues (Figure 3(c)). In addition, the expression of LAMC2 in liver metastasis sample showed a higher level than in primary tumor tissues (Figure 3(d)). Finally, we evaluated the association between LAMC2 expression and clinicopathological features of CRC patients. As shown in Table 1, LAMC2 expression was significantly associated with TNM stage (p = 0.001) and lymph node metastasis (p < 0.001). These data collectively indicate that LAMC2 was overexpressed in CRC samples and related to TNM stage.

Figure 3.

Expression of LAMC2 in clinical CRC tissues (20×). (a) LAMC2 mRNA expression in CRC tissues and paired adjacent non-tumor tissues examined by qRT-PCR and normalized to GAPDH. (b) LAMC2 expression in TNM stage I/II/III/IV cancer tissues by immunohistochemical staining. (c) LAMC2 protein expression in adjacent normal colon and tumor epithelium by immunohistochemical staining. (d) LAMC2 protein expression in colorectal cancer tissues and paired liver metastasis tissues by immunohistochemical staining.

Table 1.

Association of LAMC2 expression with pathological characteristics of CRC.

Characteristics	Number	LAMC2 expression		p value
		Low	High
Age (years)
⩽60	20	10	10	0.897
>60	29	17	12
Gender
Male	25	14	11	0.551
Female	24	13	11
Tumor site
Colon	29	18	11	0.179
Rectum	20	9	11
Tumor size (cm)
<5	37	22	15	0.282
⩾5	12	5	7
Lymph node metastasis
Negative	25	20	5	<0.001
Positive	24	7	17
Distant metastasis
Negative	46	26	20	0.581
Positive	3	1	2
TNM stage
I/II	24	19	5	0.001
III/IV	25	8	17
Vessel invasion
Negative	38	22	16	0.465
Positive	11	5	6

LAMC2: laminin γ2; CRC: colorectal cancer; TNM: tumor–node–metastasis.

Statistical analyses were performed by the Pearson χ² test.

p < 0.05 was considered to be statistically significant.

Discussion

CRC is one of the common leading causes of cancer-related deaths. LAMC2, a key component of laminin-332, is overexpressed in many human cancers. However, the association between LAMC2 and CRC prognosis remains unclear. Multiple Kaplan–Meier survival analysis of gene expression profiles from GEO datasets demonstrated that LAMC2 expression correlated well with clinical outcome of CRC patients. Importantly, the patients with high LAMC2 expression had shorter DFS, DSS, RFS, and OS in CRC, which gives a comprehensive evaluation on prognostic value of this gene. There was also significant LAMC2 expression difference in tumor tissues when compared with paired adjacent normal tissues. Besides, the expression level of LAMC2 is associated with TNM stage and distant metastasis. Thus, LAMC2 might be considered as a biomarker associated with CRC progression.

Metastasis is the main cause of high mortality in CRC patients. ¹⁶ Several previous studies reported that LAMC2 expression was associated with the invasion and metastasis of tumor cells in different kinds of carcinomas such as lung, liver, gastric, and thyroid cancer.^11,17–19 We found that stable high expression of LAMC2 increased the metastatic progression, promoted G1/S transition, and enhanced the proliferation of CRC cells. These observations emphasized the importance of LAMC2 as a specific marker for invasive carcinoma. Rising understanding of the role of the LAMC2 in promoting cancer progression raised the possibility that LAMC2 may be an attractive candidate for anticancer therapy.

Hlubek et al. ²⁰ reported that LAMC2 is overexpressed in colon adenocarcinoma mainly in the invading tumor cells. Consistent with their results, we observed that the LAMC2 is overexpressed in colon carcinoma compared with normal colon and increased with tumor TNM stage. Moreover, LAMC2 was predominant in tumor cells at the boundary between tumor and normal colon, further supporting a role of LAMC2 in tumor cell spreading. In addition, LAMC2 was highly expressed in metastasis tissues in comparison with tumor tissues. However, we are aware that data on only one paired primary tumor and metastasis tissue from the same patient is not strongly convictive and that this result must be confirmed on more metastatic samples.

In conclusion, our study showed that LAMC2 was highly expressed in CRC tissues and enhanced metastatic potential in CRC patients. Overexpression of LAMC2 predicts poor prognosis in CRC patients and promotes cancer cell proliferation, migration, and invasion. These findings indicate that LAMC2 might serve as a strong biomarker for prognosis and a potential therapeutic target in CRC.