Sage Journals: Discover world-class research

Abstract

Background

The rate of disability and mortality associated with cerebral ischemia/reperfusion injury (CIRI) is high due to limited treatment options, making it a major challenge to clinical management. Calycosin is a biologically active compound hostile to inflammatory, neuroprotective, and tumor effects. Whether calycosin has an ischemia/reperfusion effect or mechanism is unclear.

Materials and Methods

For in vivo experiments, we randomly divided rats into five groups: blank control group, middle cerebral artery occlusion/reperfusion (MCAO/R) surgical group, calycosin + MCAO/R group (5 mg/kg), calycosin + MCAO/R group (10 mg/kg), and calycosin + MCAO/R group (20 mg/kg). Molding of the middle cerebral artery was performed. Calycosin’s neuroprotective effects were evaluated using the neurological deficit score, brain edema rate, and cerebral infarct volume. For in vitro experiments, we divided PC12 cells into five groups: blank control group, oxygen and glucose deprivation/reperfusion (OGD/R) group, calycosin + OGD/R group (1 × 10⁻⁶ mol/L), calycosin + OGD/R group (4 × 10⁻⁶ mol/L), and calycosin + OGD/R group (16 × 10⁻⁶ mol/L). The optimal concentration of calycosin on PC12 cells was determined using the cell counting kit-8 (CCK-8) cell activity assay. The expression of nuclear factor kappa-B (NF-κB)-related factors was detected using real-time quantitative polymerase chain reaction and Western blotting.

Results

In rats, the MCAO/R model resulted in elevated neurological deficit scores, increased brain infarct volumes, and increased brain edema rates. The OGD/R model decreased rat adrenal pheochromocytoma (PC12) cell activity, and calycosin had a significant cerebral protective effect on PC12 cells under OGD/R conditions. In addition, calycosin can inhibit the activation of the NF-κB pathway, and its neuroprotective effect may be related to the NF-κB pathway.

Conclusion

Calycosin can reduce focal CIRI, and the neuroprotective effect of calycosin may be related to the inhibition of the high mobility group protein 1/toll-like receptor 4 (TLR4)/NF-κB signaling pathways.

Keywords

Calycosin cerebral ischemia/reperfusion inflammation apoptosis HMGB1/TLR4/NF-κB signal pathway

Introduction

Stroke is an acute, critical illness caused by ischemia and hypoxia in brain tissue due to blockage of blood vessels or bleeding from ruptured cerebral blood vessels. It puts a serious weight on families and society because of its high mortality and inability rate (Chen et al., 2020). The types of strokes include ischemic strokes and hemorrhagic strokes. Revascularization is an effective treatment for ischemic stroke, but when blood flow is revascularized, it may cause ischemic/reperfusion (I/R) injury (Green 2008; Khatri et al., 2012). The pathophysiological processes of I/R injury include free radical generation (Wei et al., 1996), excitatory glutamate toxicity (Mayor & Tymianski, 2018), oxidative stress (Eltzschig & Eckle., 2011), inflammatory response (Shi et al., 2019), and apoptosis (Cherubini & Miles., 2015; Zhang et al., 2015). Treatments are selected according to their pathogenesis to reduce stroke and cerebral ischemia/reperfusion injury (CIRI).

Calycosin is an isoflavonoid phytoestrogen isolated from Astragalus membranaceus, one of the most active components of which is calycosin (Efferth et al., 2016). Calycosin has many organic and drug effects, including hostility to inflammation (Wang et al., 2022), neuroprotective (Yang et al., 2019), hostility to the tumor (Chen et al., 2015), antiviral (Zhu et al., 2009), and so on. The neuroprotective effects of calycosin have already been reported in different models (Liu et al., 2020; Qian et al., 2012; Schreihofer & Redmond, 2009). However, its therapeutic roles in ischemic stroke have been less well studied. Therefore, in this study, we assessed the anti-ischemic effects of calycosin in in vivo and in vitro models.

Inflammation is one of the key factors contributing to the pathophysiology of stroke. Its secondary damage to brain tissue caused by I/R injury in the brain is closely associated with inflammation (Jiang et al., 2014; Qiu et al., 2008; Tao et al., 2015). Past investigations have shown that irritation is a significant part of the pathogenesis of ischemic stroke (O’Connell et al., 2017; Laird et al., 2014; Xu et al., 2018). When I/R occurs, High Mobility Group Protein 1 (HMGB1) secretion, reactive oxygen species (ROS) production, glutamate toxicity, and Ca²⁺ overload promote complement and platelets, activate inflammatory transcription factors, and release inflammatory signals (Laird et al., 2014). Among these, nuclear factor kappa-B (NF-κB) is significant in neurodegeneration and neuroinflammation (Wang et al., 2020). Late examinations have demonstrated that atorvastatin can balance the NF-κB flagging pathway during cerebral I/R with its potential NF-κB upstream factors like toll-like receptor 4 (TLR4) and HMGB1. HMGB1 concentrations in plasma are significantly elevated in patients with cerebral ischemia (Goldstein et al., 2006) and are positively correlated with cerebral infarct volume. Previous studies have concluded that the HMGB1/TLR4/NF-κB signaling pathway contributes to traumatic brain and spinal cord injuries (Sun et al., 2020; Wang et al., 2020).

B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X (Bax) are key factors in apoptosis; Bcl-2 protein exerts anti-apoptotic effects, while Bax protein exerts proapoptotic effects. Bax binds to Bcl-2 to form a heterodimer and inhibits the anti-apoptotic effect of Bcl-2 (Klemm et al., 2008). In past studies, methylcobalamin inhibits neuronal apoptosis. It regulates Bcl-2 and Bax expression in neurons during CIRI (Li et al., 2021). Liu et al. showed that electroacupuncture might prevent brain I/R damage by regulating Bax and Bcl-2 expression, significant pathways in apoptosis, and altering extracellular regulated protein kinases (ERK1/2), c-Jun N-terminal kinase (JNK), and p38 mitogen-activated protein kinases (p38MAPK) signaling pathways (Liu et al., 2018). Bcl-2 is activated after I/R injury and safeguards neurons against oxidative harm and fiery reactions (Chen et al., 2022; Wang et al., 2018). Calycosin applies its neuroprotective impacts by constricting the inflammatory reaction and neuronal apoptosis activated by mind I/R and rat adrenal pheochromocytoma (PC12) cells under oxygen and glucose deprivation/reperfusion (OGD/R) conditions. Furthermore, the defensive effect of calycosin in cerebrum CIRI included actuation of the HMGB1/TLR4/NF-κB flagging pathway. Consequently, according to our results, calycosin may be a promising therapeutic strategy for ischemic stroke and CIRI.

Materials and Methods

Chemicals and Materials

Calycosin was obtained from Priva Biotechnology Co., China. Anti-HMGB1, anti-TLR4, anti-NF-κB, and anti-IκB were obtained from Abcam, UK. p-NF-κB and p-IκB were obtained from Santa Cruz Biotechnology, USA. Anti-Bcl-2 and anti-Bax were obtained from Proteintch Group, China. Anti-β-actin was obtained from ZSGB-Bio, China. Dulbecco’s Modified Eagle Medium (DMEM) was obtained from Hyclone Laboratories, USA. The incubator was obtained from Billups-Rothenberg, USA. The cell counting kit-8 (CCK-8) assay kit was obtained from Dojindo, China.

Animals and Animal Experiments

Sprague–Dawley rodents (SD) (n = 50), by rejecting the dead creatures and ineffective models, including those without localized necrosis or localized necrosis with discharge (220–230 g), were bought from Hunan Silaikejingda, China. All trial creature conventions were supported by the Creature Trial and Error Morals Advisory group of Guilin Clinical College and were led by the Creature Care and Use Committee rules of Guilin Clinical College. Rodents were set in a steady temperature (20℃–25℃), consistent mugginess (40%–60%) day/night cycle of 12/12 h, and an unlimited eating routine and water for a brief multiweek time before the trial. Calycosin was disintegrated in dimethyl sulfoxide and weakened with sterile to the ideal focus. Day-to-day intraperitoneal infusions were given for 14 sequential days. A brief center middle cerebral artery occlusion/reperfusion (MCAO/R) was laid out by blocking the center cerebral course in rodents concerning our past exploratory method (Guo et al., 2021). The 50 rats were haphazardly allotted into the accompanying five gatherings (n = 10): the blank group, MCAO/R group, MCAO/R with 5 mg/kg calycosin, MCAO/R with 10 mg/kg calycosin, and MCAO/R with 20 mg/kg calycosin.

Assessment of Neurological Deficit

In the 24 h following reperfusion, the rats in the MCAO/R model had their neurological deficiencies evaluated using the Longa neurological shortfall scale, and the results were scored as follows. A score of 0 indicates that there are no neurological issues; 1 for failure to fully extend the left front paw and mildly limited neurological deficiencies; 2 for moderate neurological deficits as the rats turned to the left when walking; and 3 for severe neurological deficits as the rats A score of 3 shows that the rat leans to the left side when walking, with severe neurological deficits; a score of 4 shows that the rat cannot walk spontaneously or loses consciousness (Longa et al., 1989).

Infarct Volume Measurement

Toward the end of the neurological deficiency scoring, the rodents were euthanized with 2% sodium pentobarbital, executed, and the cerebrums were immediately eliminated. The brains were placed in molds for coronal sectioning and incubated with a 2% 2,3,5-triphenyl-2H-tetrazolium chloride (TTC) solution. A 2% TTC solution was obtained from Solarbio, China. Image analysis was performed using ImageJ. ImageJ was obtained from the National Institutes of Health (NIH), USA.

Brain Water Content

The degree of cerebral edema is determined by measuring the water content of the brain using wet and dry methods. A swiftly removed brain is weighed on an electronic analytical balance to determine its wet weight. After drying for 24 h at 100°C, the brain is weighed again to determine its dry weight.

Cells Culture and OGD/R Modeling

PC12 cells were bought from the Chinese community for type culture assortment. The cells were refined in DMEM at 37℃, 5% CO₂, and 100% moisture with 10% fetal bovine serum and 100 units/mL penicillin/streptomycin. The OGD/R model was established by simulating in vitro CIRI. A 24-h pretreatment with calycosin was performed on PC12 cells, and then, cultured PC12 cells were in sugar-free Earle’s balanced salt solution (EBSS) to induce OGD and incubated in a hypoxic state at 37℃, 5% CO₂, and 95% N₂ incubator for 2 h. Control PC12 cells were cultured in EBSS containing glucose. After the OGD, PC12 cells were transferred to a basal medium for PC12 cells and incubated for 24 h at 37°C in a standard simulating reperfusion in a humidified incubator.

Analyses of Cell Viability

Cell viability was determined using the CCK-8 assay kit according to the instructions provided. PC12 cells were briefly purified in 96-well plates (1×10⁴/well) for 24 h. Then, for the next 24 h, PC12 cells were exposed to three combinations of trichothecene (1, 4, and 16 M). After drug treatment, PC12 cells were refined in OGD/R conditions. CCK-8 was added to the appropriate wells and incubated at 37°C shading for 4 h, trailed by absorbance estimation at 450 nm utilizing a compound marker (Bio-Rad Model 680, Bio-Rad, CA, USA).

Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

After sampling brain tissue or PC12 cells from each group of the experiment, samples were treated with Trizol lysis (Invitrogen, USA); ribonucleic acid (RNA) was extracted from the samples, and NanoDrop 2000 was used to determine its concentration and purity (Thermo Fisher Logical, USA). The ABI PRISM 7500 Sequence Detection System (Applied Biosystems, USA) was used for all RT-qPCR procedures. The appropriate gene expression was measured using the 2-^∇∇CT technique, with actin acting as a normalization control. Table 1 displays the primer sequences for each qRT-PCR analysis.

Table 1.

Primer sequences for RT-PCR assays.

Gene	Species		Sequence (5’-3’)
HMGB1	Rat	Forward	CTGGCTGTAATGCCTTTG
HMGB1		Reverse	TCCGCTTTCCTTGTATCTG
TLR4	Rat	Forward	GCCATTGCTGCCAACATC
TLR4		Reverse	GACTTCTCCACTTTCTCAAGGACAA
NF-κB	Rat	Forward	GGTCCTAGCTGGACCTGCCTGAAGC
NF-κB		Reverse	CCTCGGTGGGACTCCTCTT
Bcl-2	Rat	Forward	TGAACCGGCATCTGCACAC
Bcl-2		Reverse	CGTCTTCAGAGACAGCCAGGAG
Bax	Rat	Forward	CGGCGAATTGGAGATGAACTG
Bax		Reverse	AGCAAAGTAGAAGAGGGCAACC
β-actin	Rat	Forward	ACTGGCATTGTGATGGACTC
β-actin		Reverse	CAGCACTGTGTTGGCATAGA

Abbreviations: MCAO/R, middle cerebral artery occlusion/reperfusion; NF-κB, nuclear factor kappa-B; HMGB1, high mobility group protein 1; TLR4, toll-like receptor 4; Bcl-2, bax b-cell lymphoma-2; RT-PCR, real time-polymerase chain reaction.

Western Blotting

Cerebrum tissue or PC12 cell test gatherings were homogenized in radioimmunoprecipitation assay (RIPA) buffer, and all proteins were separated (Beyotime Biotechnology, China). The protein content of the examples was then resolved to utilize a bicinchoninic acid assay (BCA) pack (Beyotime Biotechnology, China). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) used equal amounts of protein samples (20 mg/sample), and the proteins were transferred onto 0.45 mm polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories, USA). The essential neutralizer was shut with 5% skim milk and broke down in tris-buffered saline with tween 20 (TBST) at 37°C (cradled salt arrangement containing 0.1% Tween-20) for 2 h, then for the time being at 4°C. anti-HMGB1 anti-TLR4, p-NF-κB, anti-NF-κB, p-IκB, anti-IκB, anti-Bcl-2, anti-Bax, and anti-β-actin. Antibody-related content is displayed. Wash three times the following day with the TBST solution for 5 min. The Super Signal West Pico Western blot detection reagent (Bridgen, China) was used to separate protein groups after 2 h of room-temperature incubation with secondary antibodies. The separated protein groups were then captured using Image Lab software (Bio-Rad, USA).

Statistical Analysis

Data were examined using SE and SPSS 23, USA. One-way analysis of variation and post hoc Dunnett’s tests were used to compare the groupings statistically. A statistically significant difference was defined as p < 0.05.

Results

Calycosin’s Neuroprotective Effect in Focal CIRI

The neurological function scores of the rats in the MCAO/R model group were greater than those of the control group (p <0.05, Figure 1A). Rats in the MCAO/R model group demonstrated improved neurological function scores compared to the control group (p <0.05, Figure 1A). Calycosin gradually decreased with increasing drug concentration. Moreover, the rates of cerebral infarct volume (p <0.05, Figure 1B) and cerebral edema (p <0.05, Figure 1C) were essentially more excellent in the MCAO/R model group compared to the benchmark group. Brain infarct volume (p <0.05, Figure 1B) and cerebral edema rate were significantly higher in the MCAO/R model group in the calycosin administration group compared to the benchmark group. This suggests a role for calycosin in the rat brain I/R model (associated with neuroprotection).

Figure 1.

Note: The results were statistically analyzed and represented as mean ± SD of triplicates. Each group contains six rats (n = 6). ^##p <0.001 versus sham group, ^#p <0.05 versus sham group; ^*p <0.05, ^**p <0.01, and ^***p <0.001 versus MCAO/R group.

Calycosin Inhibits the HMGB1/TLR4/NF-kB Signaling Pathway to Attenuate the Inflammatory Response to CIRI

We further examined the expression levels of genes and proteins associated with inflammation since cerebral I/R damage can result in an inflammatory response (Franke et al., 2021). In the MCAO/R group compared with the sham operation group, the mRNA and protein levels of HMGB1, TLR4, p-NF-κB, NF-κB inhibitor kappa B alpha (IκB-α), and phosphorylation inhibitor kappa B alpha (p-IκB-α) were all significantly increased (p <0.05, Figure 2), and with increasing concentrations of calycosin administration HMGB1, the mRNA and protein levels of TLR4 and p-NF-κB decreased (p <0.05, Figure 2). The findings imply that calycosin lessens the inflammatory reaction to CIRI. It was postulated that calycosin could control the HMGB1/TLR4/NF-kB flagging pathway to reduce the inflammatory response of neuronal cells in CIRI.

Figure 2.

Note: Each group has parallels. The results were statistically analyzed and represented as mean ± SD of triplicates. Each group contains six rats (n = 6). ^##p <0.001 versus sham group, ^#p <0.05 versus sham group; ^*p <0.05, ^**p <0.01 and ^***p <0.001 versus MCAO/R group.

Calycosin Attenuates Neuronal Apoptosis After CIRI

At 24 h post-MCAO reperfusion, we concentrated on the counter-apoptotic impact of calycosin. We looked at Bcl-2 and Bax’s mRNA and protein articulation. As displayed in Figure 3, compared to the sham group, rats in the MCAO/R model group had higher protein and mRNA levels of Bax and lower levels of Bcl-2 in their brain tissue. Still, this pattern was reversed after calycosin treatment (Figure 3). The effect of calycosin showed a dose-dependent trend, indicating that calycosin can reduce apoptosis of neuronal cells in CIRI.

Figure 3.

Calycosin Enhances the Activity of PC12 Cells After OGD/R

Next, we performed in vitro experiments with PC12 cells, which were treated with calycosin and OGD/R models after 24 h of culture, and CCK-8 measured cell viability. The results showed that calycosin promoted cell growth at 10⁻⁷ to 10⁻⁴ mol/L concentrations, with the most significant promotion at 10⁻⁶ mol/L (p <0.05, Figure 4A). Calycosin induced cell death when increased to 10⁻³ mol/L. Therefore, (1, 4, 16) × 10⁻⁶ mol/L was selected for subsequent experiments. By CCK-8 assay, PC12 cells were significantly damaged after 1–8 h under OGD conditions (Figure 4B). Then 2 h were chosen for additional research since there was only a minor degree of cell harm (64% viability) (Figure 4C). After 2 h of OGD, the cells were perfused for 24 h. The outcomes showed that calycosin might increase PC12 cell viability dose-dependently. Calycosin can thereby increase PC12 cell survival in OGD/R circumstances.

Figure 4.

Note: The results were statistically analyzed and represented as mean ± SD of triplicates. Each group contains six samples (n = 6). ^**p <0.01, ^***p <0.001 versus the control bunch or OGD/R bunch. ^#p <0.05, the OGD/R bunch versus the control bunch.

Calycosin Inhibits the HMGB1/TLR4/NF-kB Signaling Pathway, Thereby Attenuating the Inflammatory Response of PC12 Cells Under OGD Conditions

We conducted in vitro tests to get PC12 cells to examine the effects of calycosin on PC12 cells under OGD/R conditions to expand on those mentioned above. We found significantly increased protein levels of HMGB1, TLR4, p-IκB-α, and p-NF-κB after OGD/R treatment compared to controls (p <0.05, Figure 5), whereas HMGB1, TLR4, p-IκB-α, and p-NF-κB were dose-dependently reduced after calycosin treatment (Figure 5). RT-PCR results likewise showed that mRNA and protein articulation of these provocative elements were diminished by calycosin treatment, as was predictable from the in vivo results.

Figure 5.

Following OGD/R Therapy, Calycosin Lowers Apoptosis in PC12 Cells

To thoroughly examine calycosin’s effect on apoptosis in PC12 cells under OGD/R conditions, we looked at the changes in Bcl-2 and Bax. Bax levels rose compared to the baseline group, and Bcl-2 levels fell in PC12 cells gathered for the OGD/R model. However, following calycosin treatment, the trend, as mentioned above, was reversed (Figure 6), and the above results were consistent with the in vivo experiments.

Figure 6.

Note: The results were statistically analyzed and represented as the mean ± SD of triplicates. Each group contains six samples (n = 6). ^**p <0.01, ^***p <0.001 versus the control bunch or OGD/R bunch. ^#p <0.05, the OGD/R bunch versus the control bunch.

Discussion

Epidemiological findings recommend estrogens, and estrogen-like compounds are powerful agents to protect neurons from neuropathological and neurotoxic challenges and promote their survival (Engler-Chiurazzi et al., 2017; Ma et al., 2016; Simpkins et al., 2004). Calycosin, an isoflavone phytoestrogen isolated from Astragalus membranaceus, is found to possess various potential pharmacological activities. Calycosin exerted anti-tumorigenesis (Chen et al., 2015), anti-oxidation (Zhao et al., 2016), anti-virus (Wang & Zhao, 2016), and apoptosis-modulation effects (Zhu et al., 2009). In this study, we have analyzed the role of calycosin in cerebral I/R-induced SD.

As of late, many examinations have shown that ischemic stroke remains one of the main sources of death worldwide, with the primary drivers being cerebral ischemia and reperfusion injury (Tuttolomondo et al., 2011; Xie et al., 2018). The inability of the brain to supply blood adequately can lead to structural damage to brain tissue and a range of dysfunctions. Complete or severe ischemia for an extended period might result in tissue necrosis and neuronal death (Khoshnam et al., 2017). Blood–brain barrier breakdown and brain tissue edema frequently occur in the I/R region after brain I/R injury (Chomova & Zitnanova, 2016). Proinflammatory substances are also more likely to penetrate the tissues and worsen the injury because the blood–brain barrier is compromised (Durukan & Tatlisumak, 2007). Guo et al. (2012) showed that calycosin reduced neurobehavioral scores and brain infarct volume in rats after cerebral I/R. Our results showed calycosin can minimize I/R injury in animal models (Sato et al., 2011; Watanabe et al., 2007). Neuroinflammation and increased neuronal deficit scores were reported in the untreated MCAO-injured rats.

The most life-threatening complication of cerebral ischemia is cerebral edema, which causes 5% mortality in stroke patients (Thorén et al., 2017). Cerebral edema occurs due to blood–brain barrier disruption, causing infiltration and leading to increased intracranial pressure (Brogan & Manno, 2015; Jüttler et al., 2007). Therefore, treating cerebral edema is a critical step in preventing the complications induced by ischemic conditions. Calycosin treatment significantly decreased the percentage of water content in the brain of MCAO-injured rats, thereby decreasing the cerebral infarct percentage and neuronal deficiency in rats.

As an endogenous damage-associated molecular pattern, HMGB1 contributes to inflammatory and innate immune responses in various neurological disorders (Huang et al., 2020; Paudel et al., 2019). In inflammatory states, HMGB1 can be released passively from necrotic cells (Wang et al., 2020). TLR4 is a pattern recognition receptor that recognizes its endogenous ligand, HMGB1, to promote neuroinflammation. When CIRI occurs, HMGB1 binds to TLR4 to activate myeloid differentiation factor, leading to phosphorylation of NF-κB (IκB). NF-κB immediately dissociates from the complex and translocates into the nucleus. In the nucleus, NF-κB binds with specific DNA sequences and initiates gene transcription and expression of inflammatory response proteins, thereby promoting I/R injury (Tornatore et al., 2012). Several recent studies have reported that activation of the HMGB1/TLR4/NF-κB signaling pathway is responsible for the worsening of CIRI, and inhibition of this signaling pathway attenuates the injury (Zhang et al., 2020; Zhu et al., 2018). Our results confirmed increased TLR 4 protein expression, enhanced NF-κB and IκBα phosphorylation, and increased production of HMGB1 in MCAO/R brain tissues and in OGD/R PC12 cells, demonstrating activation of the HMGB1/TLR4/NF-κB signaling pathway.

A large number of studies have confirmed that apoptosis plays an important role in cerebral reperfusion injury. Apoptosis is the most critical molecular process in reperfusion injury. In fact, apoptosis is a key pathological mechanism in I/R-induced brain injury and neuronal cell loss (Thorburn, 2008). Sustained I/R accelerates irreversible apoptosis. Cell survival is substantially impacted by the interaction of the anti-apoptotic Bcl-2 family protein and the proapoptotic Bax protein on the outer mitochondrial membrane (Vela et al., 2013). Bcl-2 is an anti-apoptotic protein, a crucial protein in the Bcl-2 family that regulates apoptosis. It plays a significant role in advancing cell endurance and restraining the activity of supportive apoptotic proteins. Transgenic mice overexpressing Bcl-2 are tolerant of cerebral ischemia (Chen et al., 2000). Moreover, calycosin strongly protected rats with CIRI by increasing Bcl-2 expression and reducing apoptosis (Wang et al., 2014). The outcomes showed that calycosin diminished Bax’s outflow and expanded the expression of Bcl-2 in the cerebral cortex of OGD/R-actuated PC12 cells and rodents.

Conclusion

Overall, the results of this review indicate that calycosin has significant neuroprotective effects in cerebral ischemia and reperfusion injury. It may do this by directly or indirectly inhibiting HMGB1 emission and NF-κB nuclear movement in the brain tissue of MCAO/R rodents and OGD/R-activated PC12 cells. Hence, we propose that calycosin be regarded as an efficient pretreatment strategy to prevent ischemic stroke, characterized by delayed damage following acute and severe neuroinflammation. This is because calycosin modulates the interaction between HMGB1, TLR4, and NF-κB. Then, further research is required to fully understand calycosin’s mode of action before it is used to treat people experiencing ischemic attacks.

Footnotes

Abbreviations

MCAO/R: Middle cerebral artery occlusion/reperfusion; CIRI: Cerebral ischemia/reperfusion injury; RT-qPCR: Real-time quantitative; PC12: Rat adrenal pheochromocytoma; OGD/R: Oxygen and glucose deprivation/reperfusion; NF-κB: Nuclear factor kappa-B; HMGB1: High mobility group protein 1; TLR4: Toll-like receptor 4; ROS: Reactive oxygen species; Bcl-2: Bax B-cell lymphoma-2; BCL2: Associated X; ERK1/2: Extracellular regulated protein kinases; JNK: c-Jun N-terminal kinase; p38MAPK: p38 mitogen-activated protein kinases.

Acknowledgments

This work was supported by Guilin Medical University, China and Hainan University, Hainan Province. This work was supported by Guilin Medical University, China and Hainan University, Hainan Province. Yong Wang and Shifeng Wang are Co-first author.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by National Natural Science Foundation (81860231), the Open Project Program of Guangxi Key Laboratory of Brain and Cognitive Neuroscience, Guilin Medical University (GKLBCN-20200108-02), and Guangxi University Young And Middle-aged Teachers Basic Ability Improvement Project (2021KY0515).

Statement of Informed Consent and Ethical Approval

All the animal experiments were conducted according to the animal ethical guidelines.

ORCID iD

Zihan Chen

References

Brogan

M. E.

, & Manno

E. M.

(2015). Treatment of malignant brain edema and increased intracranial pressure after stroke. Current Treatment Options in Neurology , 17(1), 327. http://doi.org/10.1007/s11940-014-0327-0

Chen

C. L.

, Qin

H. Y.

, Tan

J. Q.

, Hu

Z. P.

, & Zeng

L. W.

(2020). The role of ubiquitin-proteasome pathway and autophagy-lysosome pathway in cerebral ischemia. Oxidative Medicine and Cellular Longevity , 2020, 5457049. http://doi.org/10.1155/2020/5457049

Chen

, Lin

C. R.

, Yong

, Ye

, & Huang

Z. Q.

(2015). Calycosin and genistein induce apoptosis by inactivation of HOTAIR/p-Akt signaling pathway in human breast cancer MCF-7 cells. Cellular Physiology and Biochemistry , 35(2), 722–728. http://doi.org/10.1159/000369732

Chen

, Simon

R. P.

, Nagayama

, Zhu

, Loeffert

J. E.

, Watkins

S. C.

, & Graham

S. H.

(2000). Suppression of endogenous bcl-2 expression by antisense treatment exacerbates ischemic neuronal death. Journal of Cerebral Blood Flow and Metabolism , 20(7), 1033–1039. http://doi.org/10.1097/00004647-200007000-00002

Chen

, Zhang

, Wu

H. G.

, Zhang

D. B.

, You

G. L.

, You

, & Zheng

N. D.

(2022). Protective effect of phillyrin against cerebral ischemia/reperfusion injury in rats and oxidative stress-induced cell apoptosis and autophagy in neurons. Bioengineered , 13(3), 7940–7950. http://doi.org/10.1080/21655979.2022.2042142

Cherubini

, & Miles

(2015). The CA3 region of the hippocampus: How is it? What is it for? How does it do it? Frontiers in Cellular Neuroscience , 9, 19. http://doi.org/10.3389/fncel.2015.00019

Chomova

, & Zitnanova

(2016). Look into brain energy crisis and membrane pathophysiology in ischemia and reperfusion. Stress , 19(4), 341–348. http://doi.org/10.1080/10253890.20161174848

Durukan

, & Tatlisumak

(2007). Acute ischemic stroke: Overview of major experimental rodent models, pathophysiology, and therapy of focal cerebral ischemia. Pharmacology, Biochemistry, and Behavior , 87(1), 179–197. http://doi.org/10.1016/j.pbb.2007.04.015

Efferth

, Shan

L. T.

, & Zhang

Z. W.

(2016). Tonic herbs and herbal mixtures in Chinese medicine. World Journal of Traditional Chinese Medicine , 2(1), 10–25. https://doi.org/10.15806/j.issn.2311-8571.20150037

10.

Eltzschig

H. K.

, & Eckle

(2011). Ischemia and reperfusion—From mechanism to translation. Nature Medicine , 17(11), 1391–1401. https://doi.org/10.1038/nm.2507

11.

Engler-Chiurazzi

E. B.

, Brown

C. M.

, Povroznik

J. M.

, & Simpkins

J. W.

(2017). Estrogens as neuroprotectants: Estrogenic actions in the context of cognitive aging and brain injury. Progress in Neurobiology , 157, 188–211. http://doi.org/10.1016/j.pneurobio.2015.12.008

12.

Franke

, Bieber

, Kraft

, Weber

A. N. R.

, Stoll

, & Schuhmann

M. K.

(2021). The NLRP3 inflammasome drives inflammation in ischemia/reperfusion injury after transient middle cerebral artery occlusion in mice. Brain, Behavior, and Immunity , 92, 223–233. http://doi.org/10.1016/j.bbi.2020.12.009

13.

Goldstein

R. S.

, Gallowitsch-Puerta

, Yang

, Rosas-Ballina

, Huston

J. M.

, Czura

C. J.

, Lee

D. C.

, Ward

M. F.

, Bruchfeld

A. N.

, Wang

, Lesser

M. L.

, Church

A. L.

, Litroff

A. H.

, Sama

A. E.

, & Tracey

K. J.

(2006). Elevated high-mobility group box 1 levels in patients with cerebral and myocardial ischemia. Shock , 25(6), 571–574. http://doi.org/10.1097/01.shk.0000209540.99176.72

14.

Green

A. R.

(2008). Pharmacological approaches to acute ischaemic stroke: Reperfusion certainly, neuroprotection possibly. British Journal of Pharmacology , 153(Suppl 1), S325–S338. http://doi.org/10.1038/sj.bjp.0707594

15.

Guo

, Tong

, Xi

M. M.

, Yang

H. F.

, Dong

H. L.

, & Wen

A. D.

(2012). Neuroprotective effect of calycosin on cerebral ischemia and reperfusion injury in rats. Journal of Ethnopharmacology , 144(3), 768–774. http://doi.org/10.1016/j.jep.2012.09.056

16.

Guo

M. M.

, Qu

S. B.

, Lu

H. L.

, Wang

W. B.

, He

M. L.

, Su

J. L.

, Chen

, & Wang

(2021). Biochanin A alleviates cerebral ischemia/reperfusion injury by suppressing endoplasmic reticulum stress-induced apoptosis and p38MAPK signaling pathway in vivo and in vitro. Frontiers in Endocrinology , 12, 646720. http://doi.org/10.3389/fendo.2021646720

17.

Huang

, Guo

M. Z.

, Wang

, Wu

K. X.

, Li

Y. Y.

, Tian

, Wang

Y. F.

, Yan

W. G.

, Zhou

Z. J.

, & Yang

H. F.

(2020). HMGB1 mediates paraquat-induced neuroinflammatory responses via activating RAGE signaling pathway. Neurotoxicity Research , 37(4), 913–925. http://doi.org/10.1007/s12640-019-00148-1

18.

Jiang

M. J.

, Li

, Peng

Q. X.

, Liu

, Luo

C. H.

, Peng

, Li

J. K.

, Yung

K. K. L.

, & Mo

Z. X.

(2014). Neuroprotective effects of bilobalide on cerebral ischemia and reperfusion injury are associated with inhibition of pro-inflammatory mediator production and down-regulation of JNK1/2 and p38 MAPK activation. Journal of Neuroinflammation , 11, 167. http://doi.org/10.1186/s12974-014-0167-6

19.

Jüttler

, Schellinger

P. D.

, Aschoff

, Zweckberger

, Unterberg

, & Hacke

(2007). Clinical review: Therapy for refractory intracranial hypertension in ischaemic stroke. Critical Care , 11(5), 231. http://doi.org/10.1186/cc6087

20.

Khatri

, Mckinney

A. M.

, Swenson

, & Janardhan

(2012). Blood–brain barrier, reperfusion injury, and hemorrhagic transformation in acute ischemic stroke. Neurology , 79(13 Suppl 1), S52–S57. http://doi.org/10.1212/WNL.0b013e3182697e70

21.

Khoshnam

S. E.

, Winlow

, Farzaneh

, Farbood

, & Moghaddam

H. F.

(2017). Pathogenic mechanisms following ischemic stroke. Neurological Sciences , 38(7), 1167–1186. http://doi.org/10.1007/s10072-017-2938-1

22.

Klemm

, Eipel

, Cantré

, Abshagen

, Menger

M. D.

, & Vollmar

(2008). Multiple doses of erythropoietin impair liver regeneration by increasing TNF-alpha, the Bax to Bcl-xL ratio and apoptotic cell death. PLOS ONE , 3(12), e3924. http://doi.org/10.1371/journal.pone.0003924

23.

Laird

M. D.

, Shields

J. S.

, Sukumari-Ramesh

, Kimbler

D. E.

, Fessler

R. D.

, Shakir

, Youssef

, Yanasak

, Vender

J. R.

, & Dhandapani

K. M.

(2014). High mobility group box protein-1 promotes cerebral edema after traumatic brain injury via activation of toll-like receptor 4. Glia , 62(1), 26–38. http://doi.org/10.1002/glia.22581

24.

Y. N.

, Zheng

J. L.

, Zhu

Y. M.

, Qu

Y. Y.

, Suo

, & Zhu

Y. L.

(2021). Neuroprotective effects of methylcobalamin in cerebral ischemia/reperfusion injury through activation of the ERK1/2 signaling pathway. International Immunopharmacology , 99, 108040. http://doi.org/10.1016/j.intimp.2021108040

25.

Liu

, Wang

, Yang

S. L.

, Huang

J. K.

, Feng

, Peng

, Lin

, Liu

, Tao

, & Chen

(2018). Electroacupuncture inhibits apoptosis of peri-ischemic regions via modulating p38, extracellular signal-regulated kinase (ERK1/2), and c-Jun N terminal kinases (JNK) in cerebral ischemia-reperfusion – Injured rats. Medical Science Monitor , 24, 4395–4404. http://doi.org/10.12659/MSM.908473

26.

Liu

, Che

, Di

, Sun

, Tian

, & Ren

(2020). Calycosin-7-O-β-D-glucoside attenuates myocardial ischemia–reperfusion injury by activating JAK2/STAT3 signaling pathway via the regulation of IL-10 secretion in mice. Molecular and Cellular Biochemistry , 463(1–2), 175–187. http://doi.org/10.1007/s11010-019-03639-z

27.

Longa

E. Z.

, Weinstein

P. R.

, Carlson

, & Cummins

(1989). Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke , 20(1), 84–91. http://doi.org/10.1161/01.str.20.1.84

28.

Mayor

, & Tymianski

(2018). Neurotransmitters in the mediation of cerebral ischemic injury. Neuropharmacology , 134(B), 178–188. http://doi.org/10.1016/j.neuropharm.2017.11.050

29.

Y. L.

, Guo

, Zhang

L. X.

, Tao

, Yin

A. Q.

, Liu

Z. Y.

, Li

, Dong

H. L.

, Xiong

L. Z.

, & Hou

W. G.

(2016). Estrogen replacement therapy induced neuroprotection against brain ischemia-reperfusion injury involves the activation of astrocytes via estrogen receptor β. Scientific Reports , 6, 21467. http://doi.org/10.1038/srep21467

30.

O’Connell

G. C.

, Chantler

P. D.

, & Barr

T. L.

(2017). Stroke-associated pattern of gene expression previously identified by machine-learning is diagnostically robust in an independent patient population. Genomics Data , 14, 47–52. http://doi.org/10.1016/j.gdata.2017.08.006

31.

Paudel

Y. N.

, Angelopoulou

, Piperi

, & Balasubramaniam

V. R.

(2019). Enlightening the role of high mobility group box 1 (HMGB1) in inflammation: Updates on receptor signalling. European Journal of Pharmacology , 858, 172487. http://doi.org/10.1016/j.ejphar.2019.172487

32.

Qian

Y. S.

, Guan

, Huang

M. H.

, Cao

L. X.

, Li

Y. M.

, Cheng

, Jin

H. X.

, & Yu

D. Y.

(2012). Neuroprotection by the soy isoflavone, genistein, via inhibition of mitochondria-dependent apoptosis pathways and reactive oxygen induced-NF-κB activation in a cerebral ischemia mouse model. Neurochemistry International , 60(8), 759–767. http://doi.org/10.1016/j.neuint.2012.03.011

33.

Qiu

, Nishimura

, Wang

, Sims

J. R.

, Qiu

, Savitz

S. I.

, Salomone

, & Moskowitz

M. A.

(2008). Early release of HMGB-1 from neurons after the onset of brain ischemia. Journal of Cerebral Blood Flow and Metabolism , 28(5), 927–938. http://doi.org/10.1038/sj.jcbfm.9600582

34.

Sato

, Itagaki

, Oikawa

, Ogura

, Kobayashi

, Hirano

, Sugawara

, & Iseki

(2011). Protective effect of soy isoflavone genistein on ischemia-reperfusion in the rat small intestine. Biological and Pharmaceutical Bulletin , 34(9), 1448–1454. http://doi.org/10.1248/bpb.34.1448

35.

Schreihofer

D. A.

, & Redmond

(2009). Soy phytoestrogens are neuroprotective against stroke-like injury in vitro. Neuroscience , 158(2), 602–609. http://doi.org/10.1016/j.neuroscience.2008.10.003

36.

Simpkins

J. W.

, Yang

S. H.

, Liu

, Perez

, Cai

Z. Y.

, Covey

D. F.

, & Green

P. S.

(2004). Estrogen-like compounds for ischemic neuroprotection. Stroke , 35(11) Suppl, 2648–2651. http://doi.org/10.1161/01.STR.0000143734.59507.88

37.

Shi

K. B.

, Tian

D. C.

, Li

Z. G.

, Ducruet

A. F.

, Lawton

M. T.

, & Shi

F. D.

(2019). Global brain inflammation in stroke. The Lancet Neurology , 18(11), 1058–1066. http://doi.org/10.1016/S1474-4422(19)30078-X

38.

Sun

Z. Z.

, Nyanzu

, Yang

, Zhu

X. H.

, Wang

K. K.

, Ru

J. N.

, Yu

E. X.

, Zhang

H. L.

, Wang

Z. Z.

, Shen

, Zhuge

Q. C.

, & Huang

L. J.

(2020). VX765 attenuates pyroptosis and HMGB1/TLR4/NF-κB pathways to improve functional outcomes in TBI mice. Oxidative Medicine and Cellular Longevity , 2020, 7879629. http://doi.org/10.1155/2020/7879629

39.

Tao

X. F.

, Sun

X. C.

, Yin

L. H.

, Han

, Xu

L. N.

, Qi

, Xu

Y. W.

, Li

, Lin

, Liu

K. X.

, & Peng

J. Y.

(2015). Dioscin ameliorates cerebral ischemia/reperfusion injury through the downregulation of TLR4 signaling via HMGB-1 inhibition. Free Radical Biology and Medicine , 84, 103–115. https://doi.org/10.1016/j.freeradbiomed.2015.03.003

40.

Thorburn

(2008). Apoptosis and autophagy: Regulatory connections between two supposedly different processes. Apoptosis , 13(1), 1–9. http://doi.org/10.1007/s10495-007-0154-9

41.

Thorén

, Azevedo

, Dawson

, Egido

J. A.

, Falcou

, Ford

G. A.

, Holmin

, Mikulik

, Ollikainen

, Wahlgren

, & Ahmed

(2017). Predictors for cere-bral edema in acute ischemic stroke treated with intravenous thrombolysis. Stroke , 48(9), 2464–2471. http://doi.org/10.1161/STROKEAHA.117.018223

42.

Tornatore

, Thotakura

A. K.

, Bennett

, Moretti

, & Franzoso

(2012). The nuclear factor kappa B signaling pathway: Integrating metabolism with inflammation. Trends in Cell Biology , 22(11), 557–566. http://doi.org/10.1016/j.tcb.2012.08.001

43.

Tuttolomondo

, Di Sciacca

, Di Raimondo

, Pedone

, La Placa

, Pinto

, & Licata

(2011). Effects of clinical and laboratory variables and of pretreatment with cardiovascular drugs in acute ischaemic stroke: A retrospective chart review from the GIFA study. International Journal of Cardiology , 151(3), 318–322. http://doi.org/10.1016/j.ijcard.2010.06.005

44.

Vela

, Gonzalo

, Naval

, & Marzo

(2013). Direct interaction of Bax and Bak proteins with Bcl-2 homology domain 3 (BH3)-only proteins in living cells revealed by fluorescence complementation. Journal of Biological Chemistry , 288(7), 4935–4946. http://doi.org/10.1074/jbc.M112.422204

45.

Wang

S. M.

, & Zhang

(2020). HMGB1 in inflammation and cancer. Journal of Hematology and Oncology , 13(1), 116. http://doi.org/10.1186/s13045-020-00950-x

46.

Wang

X. P.

, Li

W. L.

, Zhang

Y. W.

, Sun

Q. B.

, Cao

, Tan

N. N.

, Yang

S. J.

, Lu

L. H.

, Zhang

, Wei

, Ma

, Wang

, & Wang

(2022). Calycosin as a novel PI3K activator reduce inflammation and fibrosis in heart failure through AKT-IKK/STAT3 axis. Frontiers in Pharmacology , 13, 828061. http://doi.org/10.3389/fphar.2022.828061

47.

Wang

, & Zhao

L. H.

(2016). Calycosin ameliorates diabetes-induced cognitive impairments in rats by reducing oxidative stress via the PI3K/Akt/GSK-3β signaling pathway. Biochemical and Biophysical Research Communications , 473(2), 428–434. http://doi.org/10.1016/j.bbrc.2016.03.024

48.

Wang

, Dong

X. H.

, Li

Z. Z.

, Wang

W. B.

, Tian

, & Chen

(2014). Downregulated RASD1 and upregulated miR-375 are involved in protective effects of calycosin on cerebral ischemia/reperfusion rats. Journal of the Neurological Sciences , 339(1–2), 144–148. http://doi.org/10.1016/j.jns.2014.02.002

49.

Wang

, Ren

Q. Y.

, Zhang

, Lu

H. L.

, & Chen

(2018). Neuroprotective mechanisms of calycosin against focal cerebral ischemia and reperfusion injury in rats. Cellular Physiology and Biochemistry , 45(2), 537–546. http://doi.org/10.1159/000487031

50.

Wang

, Xiao

G. X.

, He

, Liu

X. Y.

, Zhu

, Yang

X. Y.

, Zhang

Y. Q.

, Orgah

, Feng

Y. X.

, Wang

X. Y.

, Zhang

B. L.

, & Zhu

(2020). Protection against acute cerebral ischemia/reperfusion injury by QiShenYiQi via neuroinflammatory network mobilization. Biomedicine and Pharmacotherapy , 125, 109945. http://doi.org/10.1016/j.biopha.2020.109945

51.

Watanabe

, de Moura Neiva

L.B.

, da Costa Santos

C.X.

, Martins Laurindo

F. R.

, & de Fátima Fernandes Vattimo

(2007). Isoflavone and the heme oxygenase system in ischemic acute kidney injury in rats. Food and Chemical Toxicology , 45(12), 2366–2371. http://doi.org/10.1016/j.fct.2007.06.013

52.

Wei

E. P.

, Kontos

H. A.

, & Beckman

J. S.

(1996). Mechanisms of cerebral vasodilation by superoxide, hydrogen peroxide, and peroxynitrite. American Journal of Physiology , 271(3), H1262–H1266. http://doi.org/10.1152/ajpheart.1996.271.3.H1262

53.

Xie

, Zhou

, Sun

Y. F.

, Meng

X. B.

, Dai

Z. R.

, Sun

G. B.

, & Sun

X. B.

(2018). Protective effects and target network analysis of ginsenoside Rg1 in cerebral ischemia and reperfusion injury: A comprehensive overview of experimental studies. Cells , 7(12), 270. http://doi.org/10.3390/cells7120270

54.

H. B.

, Qin

W. Y.

, Hu

, Mu

, Zhu

, Lu

W. H.

, & Luo

(2018). Lentivirus-mediated overexpression of OTULIN ameliorates microglia activation and neuroinflammation by depressing the activation of the NF-κB signaling pathway in cerebral ischemia/reperfusion rats. Journal of Neuroinflammation , 15(1), 83. http://doi.org/10.1186/s12974-018-1117-5

55.

Yang

, Jia

, Zhang

, & Wang

(2019). Calycosin attenuates MPTP-induced Parkinson’s disease by suppressing the activation of TLR/NF-κB and MAPK pathways. Phytotherapy Research , 33(2), 309–318. http://doi.org/10.1002/ptr.6221

56.

Zhang

, Fang

, Zhou

, Deng

, Lu

, Li

, Wang

, & Xu

(2015). The possible damaged mechanism and the preventive effect of Monosialotetrahexosylganglioside in a rat model of cerebral ischemia-reperfusion injury. Journal of Stroke and Cerebrovascular Diseases , 24(7), 1471–1478. http://doi.org/10.1016/j.jstrokecerebrovasdis.2015.02.008

57.

Zhang

, Song

J. K.

, Li

, Kong

, Liang

, Zhao

X. Y.

, & Du

G. H.

(2020). Salvianolic acid D alleviates cerebral ischemia-reperfusion injury by suppressing the cytoplasmic translocation and release of HMGB1-triggered NF-κB activation to inhibit inflammatory response. Mediators of Inflammation , 2020, 9049614. http://doi.org/10.1155/2020/9049614

58.

Zhao

X. G.

, Li

, Ren

Q. Y.

, Tian

, & Chen

(2016). Calycosin induces apoptosis in colorectal cancer cells, through modulating the Erβ/MiR-95 and IGF-1R, PI3K/Akt signaling pathways. Gene , 591(1), 123–128. http://doi.org/10.1016/j.gene.2016.07.012

59.

Zhu

H. Y.

, Zhang

Y. Y.

, Ye

, Li

Z. X.

, Zhou

, & Huang

C. G.

(2009). In vivo and in vitro antiviral activities of calycosin-7-O-beta-D-glucopyranoside against Coxsackie virus B3. Biological and Pharmaceutical Bulletin , 32(1), 68–73. http://doi.org/10.1248/bpb.32.68

60.

Zhu

J. R.

, Lu

H. D.

, Guo

, Fang

W. R.

, Zhao

H. D.

, Zhou

J. S.

, Wang

, Zhao

Y. L.

, Li

Y. M.

, Zhang

Y. D.

, Yang

C. Q.

, & Sun

J. G.

(2018). Berberine attenuates ischemia–reperfusion injury through inhibiting HMGB1 release and NF-κB nuclear translocation. Acta Pharmacologica Sinica , 39(11), 1706–1715. http://doi.org/10.1038/s41401-018-0160-1

Calycosin Protects against Focal Cerebral Ischemia/Reperfusion Injury via Inhibiting the HMGB1/TLR4/NF-κB Signaling Pathway

Abstract

Background

Materials and Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Chemicals and Materials

Animals and Animal Experiments

Assessment of Neurological Deficit

Infarct Volume Measurement

Brain Water Content

Cells Culture and OGD/R Modeling

Analyses of Cell Viability

Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

Primer sequences for RT-PCR assays.

Western Blotting

Statistical Analysis

Results

Calycosin’s Neuroprotective Effect in Focal CIRI

Calycosin Inhibits the HMGB1/TLR4/NF-kB Signaling Pathway to Attenuate the Inflammatory Response to CIRI

Calycosin Attenuates Neuronal Apoptosis After CIRI

Calycosin Enhances the Activity of PC12 Cells After OGD/R

Calycosin Inhibits the HMGB1/TLR4/NF-kB Signaling Pathway, Thereby Attenuating the Inflammatory Response of PC12 Cells Under OGD Conditions

Following OGD/R Therapy, Calycosin Lowers Apoptosis in PC12 Cells

Discussion

Conclusion

Footnotes

Abbreviations

Acknowledgments

Declaration of Conflicting Interests

Funding

Statement of Informed Consent and Ethical Approval

ORCID iD

References