Crocin attenuates CCl 4 -induced liver fibrosis via PPAR-γ mediated modulation of inflammation and fibrogenesis in rats

Abstract

Background:

Liver fibrosis is a chronic pathological condition with a leading cause of liver-related mortality worldwide. In the present study, we have evaluated the antifibrotic effect of crocin, a carotenoid present in the stigma of Crocus sativus, and also explored its putative mechanism of action.

Methods:

Liver fibrosis was induced by intraperitoneal administration of 30% carbon tetrachloride (CCl₄). The crocin was administered orally at 20, 40 and 80 mg/kg body weight along with CCl₄ up to 8 weeks.

Results:

Chronic exposure to CCl₄ resulted in elevated levels of liver enzymes and reduced cytochrome P450 2E1 (CYP2E1) activity in the liver. The liver tissue showed cellular swelling, vacuolization, necrosis, infiltration of inflammatory cells and fibrotic changes. The crocin treatment significantly lowered the levels of liver enzymes in serum and improved the liver CYP2E1 mRNA levels. The pathological changes in the liver were also lowered by crocin treatment. The level of pro-inflammatory cytokines, nuclear factor-kappa B, interleukin-6 and tumor necrosis factor α and fibrogenic factor, transforming growth factor β, and α-smooth muscle actin were elevated by the CCl₄ in the liver tissue. However, crocin treatment at different doses significantly reduced the expression of these factors. The increased caspase 3/7 activity was also lowered by crocin. CCl₄ administration decreased the expression of peroxisome proliferator-activated receptor γ (PPAR-γ) in liver tissue. The improved PPAR-γ expression in the liver by crocin treatment indicates its role in the therapeutic effect of crocin.

Conclusions:

Crocin attenuated the various events in the progression of liver fibrosis via PPAR-γ mediated modulation of inflammatory and fibrogenic pathways.

Keywords

Crocin fibrosis hepatic stellate cells inflammation PPAR-γ

Introduction

Liver fibrosis, a typical pathological process in chronic liver diseases, is becoming an increasing health burden worldwide. With the leading causes of liver-related morbidity and mortality, liver cirrhosis causes about 1.16 million deaths per year globally, making it the 11th most common causes of death with the growth of 10.3% from 2005.¹ Most common causes of liver fibrosis include viral infections, alcohol consumption, metabolic disorders and chemical/drug toxicities.² Liver fibrosis may further progress to cirrhosis, hepatocellular carcinoma and end-stage liver disease in untreated cases. It is characterized by progressive deposition of extracellular matrix (ECM) proteins in response to chronic liver injury. The pathogenic cascade of liver fibrosis begins with oxidative stress leading to hepatocyte injury, which further releases various inflammatory cytokines, chemokines and adhesion molecules were leading to activation of hepatic stellate cells (HSCs).² Stimulation of transforming growth factor (TGF)-β signalling and proliferation of HSCs are mainly responsible for excessive accumulation and deposition of ECM, resulting in liver fibrosis.³

Peroxisome proliferator-activated receptor γ (PPAR-γ) is a ligand-activated transcription factor of the nuclear receptor superfamily. It regulates the gene expression of various proteins involved in a wide variety of biological functions, including lipid and glucose metabolism, adipogenesis, cell growth and differentiation and immunity.⁴ These receptors are highly expressed in the adipose tissue, but other tissues like liver, skeletal muscles, pancreatic β cells, macrophages, and myeloid dendritic cells also express these receptors for their essential functions.⁵ In recent years, a close interlay of PPAR-γ was studied in the pathogenesis of liver fibrosis. PPAR-γ agonists were reported to have an important role in preventing liver fibrosis by inhibiting TGF-β signalling, HSC activation, lowering of α-smooth muscle actin (α-SMA) and collagen expression as well as cell proliferation.^3,6

Carbon tetrachloride (CCl₄)-induced fibrosis model is extensively used to study the underlying mechanism of liver fibrosis and the effect of various molecules on its development. The mixed-function cytochrome P450 oxygenase system of the liver converts CCl₄ to trichloromethyl free radical (CCl₃) or trichloroperoxyl radical (CCl₃O₂−), which leads to oxidative stress, membrane damage, hepatocellular necrosis, inflammation and fibrosis.⁷

Crocus sativus L. (Iridaceae) is a well-known medicinal plant of Mediterranean, Irano-Turanian and East Asia region. It has high therapeutic value and great demand as a food additive, flavouring and colouring agent in various parts of the world.⁸ Crocin is a naturally occurring carotenoid obtained from the stigma of C. sativus L., commonly referred to as saffron. It is reported to possess antioxidant, anticancer, antidiabetic, neuroprotective and hepatoprotective properties.^8

–11 Recent reports suggested the therapeutic effect of crocin against hepatic steatosis, diabetes-induced liver damage and liver fibrosis through the activation of 5' AMP-activated protein kinase (AMPK) signalling, antioxidant and anti-inflammatory mechanisms.^12
–14 The present study investigates the therapeutic mechanism of crocin through PPAR-γ and associated signalling pathways in liver fibrosis.

Materials and methods

Chemicals

The CCl₄ was purchased from Ranbaxy Fine Chemicals Ltd (Chandigarh, Punjab, India). Crocin, sirius red, anti-α-SMA and anti-nuclear factor-kappa B (NF-κB) antibodies were obtained from Sigma-Aldrich (St Louis, Missouri, USA). Anti-TGF-β and anti-PPAR-γ antibodies were procured from Santa Cruz Biotechnology Inc. (Dallas, Texas, USA). Serum biochemical analysis kits were purchased from ERBA Diagnostics (Mannheim GmbH, Germany). The kits for immunohistochemistry (IHC) and quantitative real-time polymerase chain reaction (qRT-PCR) were purchased from Vector Labs (Burlingame, California, USA) and Thermo Fisher Scientific (Waltham, Massachusetts, USA), respectively. Apo-ONE homogenous caspase 3/7 assay kit from Promega (Madison, Wisconsin, USA) was used in the study.

Animals

Adult 6-week-old male Wistar rats were acquired from CSIR-Institute of Himalayan Bioresource Technology, Palampur, India, animal house facility. The animals were kept at standard room temperature (23 ± 2°C) and humidity (45–50%). The pellet rodent diet and water were provided to rats ad libitum. Animal handling and experimental protocols were performed as per the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) guidelines and were approved by the Institutional Animal Ethical Committee.

Experimental protocol

Rats were divided into five groups, with six rats in each group. Group I served as normal control (CNT) and received corn oil in equivalent doses. Groups II to V were administered with 30% CCl₄ (0.3 ml/kg body weight) in corn oil, intraperitoneally thrice a week for 8 weeks. The dose of CCl₄ was selected based on previous reports.¹⁵ Groups III, IV, and V received crocin treatment at 20, 40 and 80 mg/kg body weight dose, respectively, from the day 1 onward up to eighth week. Group II served as a vehicle control (VC) group. After 8 weeks, the blood was collected through retro-orbital plexus and serum was separated for further biochemical analysis. The animals were euthanized by carbon dioxide asphyxiation and the liver tissues were collected and stored at −80°C for protein expression studies and in 10% neutral buffered formalin for histopathology studies.

Serum biochemistry

Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were analyzed by serum biochemical kits (ERBA, Transasia, India), using fully automated biochemistry analyzer (ERBA).

Histopathology

After proper fixation, the liver tissues collected in 10% neutral buffered formalin were subjected to processing following overnight washing under running water. Tissues then dehydrated with increasing grades of alcohol, cleared using xylene, and embedded in liquid paraffin. The paraffin-embedded tissues were sectioned at 4–5 µm and stained with hematoxylin and eosin stain. The stained tissue sections were analyzed using Olympus BX53F microscope (DSS IMAGETECH Pvt. Ltd., India) .¹⁶

Picrosirius stain

The fibrous tissue deposition in the liver was evaluated using picrosirius staining. The liver sections were first stained with Weigert’s hematoxylin and then incubated with picrosirius red. The sections were dehydrated after removing the excess stain with acidified water, cleared in xylene, and mounted with dibutylphthalate polystyrene xylene (DPX) for observation. The sections were analyzed using a bright-field microscope, and the quantification of fibrous tissue was done with ImageJ software (ImageJ 1.52j) .¹⁶

Immunohistochemistry

IHC was performed to analyze the expression of various factors in the liver tissues. Deparaffinized and hydrated tissue sections were boiled with sodium citrate buffer (pH 6.0) for the retrieval of antigens. The IHC was performed using ImmPRESS Excel staining kit, as per the prescribed protocol. The antibodies of α-SMA, TGF-β, NF-κB and PPAR-γ were used for the study (1:50–1:100 dilutions). The stained slides were evaluated under microscope and quantification of the expression was done using ImageJ software.¹⁶

Total RNA isolation and RT-qPCR

Total RNA was isolated using trizol reagent from the liver tissues stored at −80°C. Liver tissues were (100 mg) homogenized in 1 ml of trizol reagent. Chloroform (0.2 ml) per ml of trizol was added and centrifuged (12,000 × g; 15 min; 4°C) to separate the nucleic acids into the aqueous phase. The isopropanol was inserted into the aqueous layer and centrifuged to pellet down the RNA. The RNA pellet then washed with 70% ethanol, air-dried, and suspended in RNase free water.¹⁶ Nanodrop (Thermo Fisher Scientific) was used to measure the quantity and purity of RNA.

For RT-qPCR, complementary DNA synthesized from 2 µg of RNA as per the manufacturer’s instructions (Applied Biosystems, Foster City, California, USA) and specific primers sequences for target genes have been given in Table 1.

Table 1.

Specific primers sequences for target genes.

CYP2E1	F: GACCCCACATTTCTGATTGG R: GGGTGCTCAGCAGGTAGAAG
IL-6	F: TCTCTCCGCAAGAGACTTCCA R: ATACTGGTCTGTTGTGGGTGG
TNF-α	F: GAAACACAAGATGCTGGGACAGT R: CATTCGAGGCTCCAGTGAATTC
TGF-β	F: GAGAAGAACTGCTGTGTGCG R: GTGTCCAGGCTCCAAATATAG
α-SMA	F: ACTGGGACGACATGGAAAAG R: GTTCAGTGGTGCCTCTGTCA

CYP2E1: cytochrome P450 2E1; TGF-β: transforming growth factor-β; α-SMA: α-smooth muscle actin; IL-6: interleukin-6; TNF-α: tumor necrosis factor-α.

Caspase 3/7 assay

The liver tissue (50 mg) was homogenized in 1 ml of chilled phosphate-buffered saline. The samples were then centrifuged at 12,000 r/min for 15 min to collect the supernatant. The 100 µl of supernatant from each sample was taken in a black-walled 96-well plate and 100 µl of caspase 3/7 reaction mixture was added to it, followed by 30 min of incubation at room temperature, as per the manufacturer’s protocol. The fluorescence was measured at an excitation/emission wavelength of 480/560 nm in an ELISA plate reader. The formula (Net relative fluorescence unit (RFU) = Assay RFU − Blank RFU) was used to calculate the net RFU.

Western blotting

The liver tissues were micronized by hand homogenizer in a modified radioimmunoprecipitationassay buffer (RIPA) lysis buffer. The samples were then sonicated, and the protein was extracted by centrifugation at 14,000 r/min for 15 min at 4°C. The protein was quantified using Bradford reagent colorimetric assay at a wavelength of 595 nm in an ELISA plate reader. Western blotting was performed as per earlier reported method and quantification of blots was done using ImageJ software.¹⁷

Statistical analysis

The results expressed as mean ± standard error of the mean. The statistical significance was carried out using one-way analysis of variance among all groups followed by Tukey’s post hoc test. The significance level was considered at p <0.05.

Results

Effect of crocin on cytochrome P450 (CYP2E1) activity

Cytochrome P450 2E1 (CYP2E1) earlier marked as ethanol degradation enzyme but later also identified for its active role in the biotransformation of many xenobiotics. The mRNA levels of CYP2E1 in the CCl₄ group found significantly (p < 0.05) downregulated as compared to the normal group. However, the administration of crocin resulted in significant (p < 0.05) dose-dependent upregulation of CYP2E1 in the livers of all the treatment groups (Figure 1(a)).

Figure 1.

(a) Liver CYP2E1 mRNA levels, (b) serum ALT and (c) AST activity in different groups. *p < 0.05, significantly different from the vehicle control group. CYP2E1: cytochrome P450 2E1; ALT: alanine aminotransferase; AST: aspartate aminotransferase.

Effect of crocin on liver injury markers

The serum levels of ALT and AST enzymes are the markers of liver injury. The CCl₄ treatment significantly (p < 0.05) increased the levels of these enzymes in the VC group as compared to the CNT group. Crocin treatment at 20, 40 and 80 mg/kg body weight doses reduced the levels of serum liver injury markers significantly (p < 0.05). However, no dose-dependent effect of crocin was observed on these enzymes (Figure 1(b) and (c)).

Effect of crocin on liver histopathology

The control group showed typical liver architecture with well-arranged hepatocytes and associated structures with no degenerative changes. The CCl₄ administration caused ballooning of hepatocytes in the centrilobular area and bridging necrosis. The infiltration of the mononuclear cells was also evident. Crocin treatment at 40 and 80 mg/kg body weight significantly (p < 0.05) found to reduce the extent of degenerative changes in dose-dependent manner as compared to the VC group. However, no significant effect was observed at 20 mg/kg dose (Figure 2(a) to (f)).

Figure 2.

Liver tissue in (a) control group showing normal lobular arrangement of hepatocytes around blood vessel (arrow); (b) vehicle control group showing bridging necrosis with ballooning degeneration (arrows) and inflammatory cells (arrowhead) around centrilobular area; (c–e) liver tissue in 20, 40, and 80 mg/kg dose groups showing reduced intensity of pathological lesions, respectively; (f) mean lesion score of degenerative changes in various groups. *p < 0.05, significantly different from vehicle control group; magnification: 100×, scale bar: 100 µm.

Effect of crocin on fibrous tissue deposition in the liver

The fibrous tissue deposition in the liver was evaluated by picrosirius staining. The control group showed the normal presence of fibrous tissue around vessels. The VC group showed significantly (p < 0.05) increased deposition of fibrous tissue around the vessels as well as in the sinusoidal space in comparison to the CNT group. Crocin treatment at all three doses significantly (p < 0.05) lowered the fibrous tissue accumulation in the liver as compared to the VC group in dose-dependent manner (Figure 3(a) to (f)).

Figure 3.

Fibrous tissue deposition (a) CNT showing minimal fibrous tissue around blood vessels; (b) vehicle control group showing increased deposition of fibrous tissue (arrow) around blood vessels as well as in liver parenchyma (arrowhead); (c–e) 20, 40, and 80 mg/kg dose groups, respectively, showing the effect of crocin in reducing fibrous tissue deposition; (f) mean percentage of fibrous tissue deposition in different groups. *p < 0.05, significantly different from vehicle control group; magnification: 100×, scale bar: 100 µm.

Effect of crocin on liver inflammation

The level of pro-inflammatory cytokines is the indicator of an inflammatory response in the tissue. The gene expression studies revealed that CCl₄ treatment significantly (p < 0.05) increased the interleukin-6 (IL-6) and tumor necrosis factor α (TNF-α) levels in the VC group as compared to CNT. On the other hand, crocin treatment significantly (p < 0.05) downregulated the liver expression of IL-6 and TNF-α in a dose-dependent manner. Besides, the expression of NF-κB, which is a crucial mediator of inflammatory responses, was evaluated in liver tissue by IHC. NF-κB expression found significantly (p < 0.05) increased in the liver tissues of the VC group as compared to CNT. Further, crocin treatment at 40 and 80 mg/kg significantly (p < 0.05) reduced the NF-κB expression in the liver in comparison to the VC group. However, no significant effect was observed at 20 mg/kg dose (Figures 4 and 5).

Figure 4.

Immunohistochemical expression of various markers in the liver tissue of different group. (a–f) TGF-β expression in different groups, (g–l) NF-κB expression in different groups and (m–r) α-SMA expression in different groups. *p < 0.05, significantly different from vehicle control group; magnification: 100×, scale bar: 100 µm. TGF-β: transforming growth factor-β; NF-κB: nuclear factor kappa B; α-SMA: α-smooth muscle actin.

Figure 5.

mRNA levels of various genes in different groups. (a) TGF-β, (b) α-SMA, (c) IL-6 and (d) TNF-α. *p < 0.05, significantly different from vehicle control group. TGF-β: transforming growth factor-β; α-SMA: α-smooth muscle actin; IL-6: interleukin-6; TNF-α: tumor necrosis factor-α.

Effect of crocin on fibrogenic factors

TGF-β and α-SMA are considered to be the prominent markers in the progression of fibrosis. The expressions of TGF-β and α-SMA in liver were studied by IHC. The tissue expression of TGF-β and α-SMA found significantly (p < 0.05) elevated in the VC group as compared to CNT. The crocin treatment at 20, 40 and 80 mg/kg doses significantly (p < 0.05) decreased the expression of TGF-β and α-SMA in liver tissues in a dose-dependent manner. The results were further confirmed by analyzing their gene expression levels in liver tissue using qRT-PCR. The mRNA level of TGF-β and α-SMA found significantly (p < 0.05) elevated in the VC group as compared to normal. However, crocin treatment significantly downregulated the mRNA level of TGF-β and α-SMA in a dose-dependent manner (Figures 4 and 5).

Effect of crocin on apoptosis

Caspase-3/7 are the key enzymes of the apoptotic pathway, and their elevated levels are an indicator of apoptosis. The level of caspase-3/7 activity found significantly (p < 0.05) higher in the VC group in comparison to the control group. Crocin treatment at 40 and 80 mg/kg doses showed significant (p < 0.05) reduction in the caspase 3/7 activity. However, no significant effect observed at 20 mg/kg dose (Figure 6).

Figure 6.

Caspase 3/7 activity in different groups. *p < 0.05, significantly different from the vehicle control group.

Effect of crocin on PPAR-γ induction

The ligand-dependent transcription factor, PPAR-γ, plays a major role in liver fibrosis by regulating the activation and differentiation of stellate cells. The expression of PPAR-γ in liver tissues was evaluated by IHC. The VC group showed significantly (p < 0.05) reduced expression of PPAR-γ as compared to the CNT group. However, crocin treatment increased the expression of PPAR-γ in the liver tissue at all three doses, but the effect was found significant (p < 0.05) only at 80 mg/kg dose. This was further confirmed by Western blot analysis. CCl₄ treatment downregulated the expression of PPAR-γ in the VC group as compared to the normal group. However, crocin treatment significantly (p < 0.05) upregulated the expression of PPAR-γ at 40 and 80 mg/kg doses as compared to the VC group, indicating the role of PPAR-γ in the protective effect of crocin (Figure 7(a) to (g)).

Figure 7.

PPAR-γ expression in the liver of different groups (a) Normal control group; (b) vehicle control group showing reduced expression; (c–e) 20, 40 and 80 mg/kg dose groups showing improved expression respectively; (f) comparative expression in liver tissue of different groups; (g, h) protein expression of PPAR-γ in different groups. *p < 0.05, significantly different from vehicle control group; magnification: 100×, scale bar: 100 µm. PPAR-γ: peroxisome proliferator-activated receptor γ.

Discussion

The demand for traditional medicines and nutraceuticals of natural origin has increased many folds over the years due to their therapeutic value without any side effect. C. sativa is a rich source of medicinally important crocin, a naturally occurring carotenoid. The present study was designed to explore the efficacy and mechanism of action of crocin against liver fibrosis in rats.

Liver fibrosis is a common response to chronic toxin-mediated liver injury. CYP2E1-dependent metabolism of CCl₄ generates toxic metabolites and reactive oxygen species, leading to hepatocellular necrosis and subsequent fibrosis in the liver.¹⁸ CCl₄ metabolites reduce the CYP2E1 activity in the liver tissue in a phosphorylation-dependent manner, and a resistance to CCL₄ toxicity was reported in CYP2E1 knockout mice.^18,19 In the present study, we observed a significant reduction in CYP2E1 activity in the CCl₄-treated group. However, crocin in all the treatment groups restored the activity of CYP2E1 by maintaining its level to sustain the detoxifying capacity of the liver.

Hepatocyte injury leaks certain transaminases in the circulation as a valid indicator of liver damage. The elevated serum ALT and AST levels reported to being associated with hepatocyte injury and seepage of these enzymes from cell cytosol into circulation.²⁰ In the current study, these biochemical markers were noted to be significantly elevated after CCl₄ exposure. However, improved levels of liver injury marker enzymes by crocin treatment might be due to its potent antioxidant effect, maintaining the integrity of the hepatic cellular membrane and preventing the transfusion of these cellular enzymes into serum.^12,21 Similarly, the hepatoprotective effect of crocin on liver transaminases has been well reported against amiodarone-induced liver damage, respectively.²²

The histopathology of liver supported the serum biochemistry findings, where CCl₄ administration completely altered the liver histology leading to cellular swelling, necrosis, infiltration of mononuclear inflammatory cells and fibrous tissue deposition. The main pathological alterations after CCl₄ administration were observed in the centrilobular area as the CYP2E1 is mainly expressed in the endoplasmic reticulum of centrilobular hepatocytes, which is primarily responsible for toxin metabolism.²³ Crocin treatment eminently improved the microscopic liver pathology by reducing these degenerative changes. In the previous report also, crocin administration showed a protective effect in CCl₄-induced liver damage model by improving the liver pathology.²¹ CCl₄ induces fibrotic changes in the liver, which were well evident after 8 weeks of its repeated administration in the present study. The fibrous tissue deposition induced by CCl₄ was substantially lowered by crocin in all the treatment groups. Recently, a study also supported the antifibrotic potential of crocin along with the reduction of liver damage in the mice model.¹²

CCl₄ metabolism in the liver results in the free-radical generation and induce oxidative stress, lipid peroxidation and alteration of membrane permeability. The oxidative stress-induced cellular injury triggers the production of a variety of cytokines that are capable of modulating various cellular events, such as necrosis, inflammation, apoptosis and fibrosis.^24,25 NF-κB signalling has been reported as one of the most crucial pathways involved in inflammatory diseases like liver fibrosis. Chronic administration of CCl₄ is believed to prolong hepatic inflammation through the NF-κB signalling pathway, resulting in the production and secretion of TNF-α and IL-6 that are actively involved in the progression of fibrosis.²⁶ Our study demonstrated that CCl₄-induced oxidative stress resulted in inflammatory response and activation of HSC, eventually leading to the progression of fibrosis. Moreover, evaluation of different inflammatory markers disclosed that CCl₄-induced injury caused an inflammatory response in liver tissue with a substantial rise in hepatic NF-κB expressions along with a considerable increase in TNF-α and IL-6 mRNA.²⁷ The crocin treatment offered beneficial effect against CCl₄-induced liver inflammation by significantly reducing the levels of NF-κB, TNF-α and IL-6. The earlier study also reported the anti-inflammatory effect of crocin by preventing NF-κB pathway activation and lowering the levels of pro-inflammatory cytokines TNF-α and IL-6.²⁸

Persistent inflammation may trigger fibrotic/cirrhotic response causing irreversible damage to hepatocytes and decline in liver function. Chronic liver injury leads to HSC activation and their transformation into myofibroblast-like cells with elevated α-SMA expression and increased synthesis of collagen and ECM.²⁹ TGF-β and α-SMA are considered to be the most prominent markers of fibrosis progression. Studies have confirmed that TGF-β contributes to HSC activation, which produces a number of profibrotic cytokines and growth factors, thus contributing to the progression of fibrosis both by autocrine and paracrine mechanism.³⁰ TGF- β/Smad pathway activates underlying cellular mechanisms, such as cell survival and proliferation. This further initiates the induction of pro-inflammatory cytokines, such as IL-1β and TNF-α along with other profibrotic factors to trigger fibrosis and tumorigenesis.^30,31 In our study, an elevated level of profibrotic markers, TGF-β and α-SMA, in liver tissues confirmed the fibrotic effect of CCl₄. However, crocin treatment considerably abrogated the liver tissue expression of TGF-β and α-SMA. Similar reports have suggested by Algandaby, where crocin administration at 100 mg/kg dose weakened the expression of TGF-β and α-SMA against thioacetamide-induced liver fibrosis.¹²

Apoptosis is considered to be a pivotal event in toxin-induced hepatotoxicity. It has reported that inflammatory cytokines possibly induce the activation of caspases and initiate cell apoptosis.³² CCl₄-induced apoptotic cell death is said to be mediated through the activation of caspase-3/7.³³ In our study, crocin administration ameliorated the CCl₄-induced liver cells apoptosis by inhibiting the caspase-3/7-dependent apoptotic signalling pathway. Similarly, Sun et al. have suggested the role of crocin in reducing cisplatin-induced liver injury via inhibiting p38 mitogen-activated protein kinase (MAPK) and caspase-3 activity.³⁴

PPAR-γ is a nuclear family receptor and transcription factor that helps to maintain the quiescent stage of HSC by transcriptional regulation of multiple genes, including TNF-α, platelet-derived growth factor (PDGF)-β and TGF-β1.³⁵ The role of PPAR-γ has widely accepted in liver fibrosis, and its signalling pathway has a direct link to HSC activation. Rosiglitazone, a PPAR-γ agonist, has been found to inhibit HSC activation by suppressing inflammatory mediators, such as NF-κB, IL-6 and TNF-α.³⁶ Also, a PPAR-γ agonist was found to be capable of inhibiting oxidative stress and apoptosis in rat astrocyte cell line.³⁷ In our study, IHC and Western blot analysis have revealed that there was a substantial decrease in PPAR-γ expression in CCl₄-administered rats. Nevertheless, there was a significant upregulation of PPAR-γ in crocin-treated groups, suggesting its potential role in preventing liver fibrosis by activating PPAR-γ signalling.

Conclusion

In conclusion, the present study speculates that the protective effect of crocin on CCl₄-induced liver fibrosis was probably mediated through the PPAR-γ activation, leading to the suppression of oxidative stress and inhibition of apoptosis. Furthermore, crocin effectively reduced the course of fibrosis progression by inhibiting inflammatory and fibrogenic factors in the liver. However, further studies in this direction suggested that our results project crocin as a future therapeutic agent involving PPAR-γ mediated efficacy.

Footnotes

Acknowledgements

The authors would like to thank the Director, CSIR-IHBT, Palampur, India, for providing all the necessary facilities. We also acknowledge CSIR, India, for providing financial support in the form of a project (MLP0204). The CSIR-IHBT communication number is 4455.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The authors received financial support from CSIR, India.

ORCID iDs

J Chhimwal

V Patial

References

Asrani

Devarbhavi

Eaton

, et al. Burden of liver diseases in the world. J Hepatol 2019; 70: 151–171.

Sánchez-Valle

C Chavez-Tapia

Uribe

, et al. Role of oxidative stress and molecular changes in liver fibrosis: a review. Curr Med Chem 2012; 19(28):4850–4860.

Deng

Xiong

Cheng

. Organ fibrosis inhibited by blocking transforming growth factor-β signaling via peroxisome proliferator-activated receptor γ agonists. Hepatobiliary Pancreat Dis Int 2012; 11(5):467–478.

Croasdell

Duffney

Kim

, et al. PPAR-γ and the innate immune system mediate the resolution of inflammation. PPAR Res 2015; 549691.

Pferschy-Wenzig

Atanasov

Malainer

, et al. Identification of isosilybin a from milk thistle seeds as an agonist of peroxisome proliferator-activated receptor gamma. J Nat Prod 2014; 77(4): 842–847.

Wang

Zheng

, et al. Peroxisome proliferator-activated receptor gamma inhibits hepatic fibrosis in rats. Hepatobiliary Pancreat Dis Int 2011; 10(1): 64–71.

Huang

Wang

Zhang

, et al. Hepatoprotective effects of baicalein against CCl4-induced acute liver injury in mice. World J Gastroenterol 2012; 18(45): 6605–6613.

Mazumder

Sharma

Patial

, et al. Crocin attenuates kindling development and associated cognitive impairments in mice via inhibiting reactive oxygen species-mediated NF-κB activation. Basic Clin Pharmacol Toxicol 2017; 120(5): 426–433.

Farshid

Tamaddonfard

Moradi-Arzeloo

, et al. The effects of crocin, insulin and their co-administration on the heart function and pathology in streptozotocin-induced diabetic rats. Avicenna J Phytomed 2016; 6(6): 658–670.

10.

Ahmadi

Rajaei

Hadjzadeh

, et al. Crocin improves spatial learning and memory deficits in the Morris water maze via attenuating cortical oxidative damage in diabetic rats. Neurosci Lett 2017; 642: 1–6.

11.

Roshankhah

Jalili

Salahshoor

. Effects of crocin on sperm parameters and seminiferous tubules in diabetic rats. Adv Biomed Res 2019; 8: 4.

12.

Algandaby

. Antifibrotic effects of crocin on thioacetamide-induced liver fibrosis in mice. Saudi J Biol Sci 2018; 25(4): 747–754.

13.

Yaribeygi

Mohammadi

Sahebkar

. Crocin potentiates antioxidant defense system and improves oxidative damage in liver tissue in diabetic rats. Biomed Pharmacother 2018; 98: 333–337.

14.

Luo

Fang

Dan

, et al. Crocin ameliorates hepatic steatosis through activation of AMPK signaling in db/db mice. Lipids Health Dis 2019; 18(1): 11.

15.

Fortea

Fernández-Mena

Puerto

, et al. Comparison of two protocols of carbon tetrachloride-induced cirrhosis in rats–Improving yield and reproducibility. Sci Rep 2018; 8(1): 1–10.

16.

Sharma

Mishra

Chhimwal

, et al. Dendrimer conjugated podophyllotoxin suppresses DENA induced HCC progression by modulation of inflammatory and fibrogenic factors. Toxicol Res 2019; 8(4): 560–567.

17.

Love

Mudasir

Bhardwaj

, et al. Long-term administration of tacrolimus and everolimus prevents high cholesterol-high fructose-induced steatosis in C57BL/6 J mice by inhibiting de-novo lipogenesis. Oncotarget 2017; 8(69): 113403.

18.

Liang

, et al. The role of human cytochrome P450 2E1 in liver inflammation and fibrosis. Hepatol Commun 2017; 1(10): 1043–1057.

19.

Wong

Chan

Lee

. Resistance to carbon tetrachloride-induced hepatotoxicity in mice which lack CYP2E1 expression. Toxicol Appl Pharmacol 1998; 153(1): 109–118.

20.

Sharma

Rana

Patial

, et al. Antioxidant and hepatoprotective effect of polyphenols from apple pomace extract via apoptosis inhibition and Nrf2 activation in mice. Hum Exp Toxicol 2016; 35(12): 1264–1275.

21.

Cosgun

Erdemli

Gul

, et al. Crocin (active constituent of saffron) improves CCl4-induced liver damage by modulating oxidative stress in rats. Turk J Biochem 2019; 44(3): 370–378.

22.

Riaz

Saleem

Ahmad

, et al. Hepatoprotective effect of Crocus sativus on amiodarone-induced liver toxicity. Br J Pharmaceut Res 2016; 12: 1–11.

23.

Sutti

Rigamonti

Vidali

, et al. CYP2E1 autoantibodies in liver diseases. Redox Biol 2014; 3: 72–78.

24.

Lin

, et al. Protective effects of salidroside against carbon tetrachloride (CCl₄)-induced liver injury by initiating mitochondria to resist oxidative stress in mice. Int J Mol Sci 2019; 20(13): 3187.

25.

Dai

Xiao

, et al. Chloroquine ameliorates carbon tetrachloride-induced acute liver injury in mice via the concomitant inhibition of inflammation and induction of apoptosis. Cell Death Dis 2018; 9(12): 1–3.

26.

Wang

Zhang

Wang

, et al. Inhibitory effects of quercetin on the progression of liver fibrosis through the regulation of NF-κB/IκBα, p38 MAPK, and Bcl-2/Bax signaling. Int Immunopharmacol 2017; 47: 126–133.

27.

Wang

Song

, et al. Tanshinol ameliorates CCl4-induced liver fibrosis in rats through the regulation of Nrf2/HO-1 and NF-κB/IκBα signaling pathway. Drug Des Dev Ther 2018; 12: 1281.

28.

Yang

Dong

. Inhibition of inflammatory response by crocin attenuates hemorrhagic shock-induced organ damages in rats. J Interf Cytok Res 2019, 37(7): 295–302.

29.

Cai

Wang

, et al. miR-200c accelerates hepatic stellate cell-induced liver fibrosis via targeting the FOG2/PI3 K pathway. Biomed Res Int 2017: 2670658.

30.

Dewidar

Meyer

Dooley

. TGF-β in hepatic stellate cell activation and liver fibrogenesis—updated 2019. Cells 2019; 8(11): 1419.

31.

George

Tsuchishima

Tsutsumi

. Molecular mechanisms in the pathogenesis of N-nitrosodimethylamine induced hepatic fibrosis. Cell Death Dis 2019; 10(1): 1–9.

32.

Ooppachai

Yodkeeree

. Dicentrine potentiates TNF-α-induced apoptosis and suppresses invasion of A549 lung adenocarcinoma cells via modulation of NF-κB and AP-1 activation. Molecules 2019; 24(22): 4100.

33.

Ivan

Herman

Balta

, et al. Berberis vulgaris extract/β-cyclodextrin complex increases protection of hepatic cells via suppression of apoptosis and lipogenesis pathways. Exp Ther Med 2017; 13(5): 2143–2150.

34.

Sun

Yang

Wang

, et al. Crocin attenuates cisplatin-induced liver injury in the mice. Hum Exp Toxicol 2014; 33(8): 855–862.

35.

Kumar

Mundra

Mahato

. Nanomedicines of Hedgehog inhibitor and PPAR-γ agonist for treating liver fibrosis. Pharm Res 2014; 31(5): 1158–1169.

36.

Wei

Zhao

Zhang

, et al. Rosiglitazone ameliorates bile duct ligation-induced liver fibrosis by down-regulating NF-κB-TNF-α signaling pathway in a PPARγ-dependent manner. Biochem Biophys Res Commun 2019; 519(4): 854–860.

37.

Giampietro

Gallorini

De Filippis

, et al. PPAR-γ agonist GL516 reduces oxidative stress and apoptosis occurrence in a rat astrocyte cell line. Neurochem Int 2019; 126: 239–245.