Sage Journals: Discover world-class research

Abstract

Overdose of acetaminophen (APAP) is the main reason for acute liver failure. Oxidative stress is associated with hepatotoxicity caused by APAP. Betaine is a methyl donor and S-adenosylmethionine precursor. The present study investigated the effect of betaine and the role of nuclear factor-erythroid-2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) genes in hepatotoxicity induced by APAP in mice. In this study, male Naval Medical Research Institute (NMRI) mice were treated with 500 mg/kg of betaine for 5 days followed with a single dose of APAP 300 mg/kg on the fifth day. Biochemical, histological, immunohistochemical, Western blot, and real-time polymerase chain reaction (PCR) analyses were then conducted. The results of the present study showed that betaine pretreatment improved hepatotoxicity through the reduction of serum ALT and AST levels and ameliorating histopathological finding. Betaine pretreatment also increased glutathione level and decreased malondialdehyde level. Importantly, the results of immunohistochemical, Western blot and real-time PCR showed that the APAP increased the expression of the genes and proteins of Nrf2 and HO-1. While betaine decreased Nrf2 and HO-1 expression in comparison with the APAP group. The findings of this study demonstrated that the increased expression of Nrf2 and HO-1 genes and proteins by APAP is a compensatory mechanism to combat acute liver toxicity. While the protective effect of betaine against acute liver injury induced by APAP is independent on the Nrf2 and HO-1 genes but occurs via modifying cysteine supply as a precursor of glutathione in the transsulfuration pathway in the liver.

Keywords

Acetaminophen HO-1 Nrf2 betaine hepatotoxicity

Introduction

Liver as the largest body organ for drug metabolism is accordingly the most common site suffering from drug-related damages. Drug-induced liver damage is a serious concern for many drugs and a major challenge for their potential therapeutic design.¹ One of the drugs inducing hepatotoxicity at high doses is acetaminophen (also known as paracetamol and APAP), which is widely used as an analgesic and antipyretic medicine around the world. In therapeutic doses, N-acetyl-p-benzoquinone imine (NAPQI) as the toxic metabolite of APAP is detoxified by binding with glutathione. At the doses higher than the therapeutic level, because of the saturation of sulfate or glucuronic acid conjugation pathway, a large amount of APAP is converted to NAPQI, which results in the depletion of glutathione deposits, and then the formation of the covalent bond of NAPQI with cellular proteins and the inhibition of the main functions of proteins, so that APAP at high doses causes massive centrilobular hepatic necrosis.²

In our previous study, mice pretreated with 125, 250, 500, and 1000 mg/kg betaine and the dose of 500 mg/kg was selected as the effective dose against hepatotoxicity induced by APAP.³ So, in this study, complementary tests were performed at a dose of 500 mg/kg to evaluate APAP hepatotoxicity.

Previous studies have shown that oxidative stress in the liver is related to the toxicity of APAP and that the lipid peroxidation as the final step of oxidative stress is associated with the onset and progression of liver damage. Therefore, it is guessed that eliminating oxidative stress is a protective mechanism to stop the hepatotoxicity of APAP. Accordingly, the detoxifying enzymes along with increased intracellular antioxidant activity are important in protecting and healing the liver damage.

Nuclear factor-erythroid-2-related factor 2 (Nrf2) is a transcription factor normally inactive in cytosol and is activated under acute oxidative stress conditions, transferred to the nucleus and bonded to antioxidant response element sequence in upstream promoter region of the different cytoprotective genes, including antioxidant genes and phase II detoxifying enzymes, thereby inducing cellular cytoprotective genes against the oxidative stress.⁴

Moreover, heme oxygenase-1 (HO-1) is the greatest key among the antioxidant and detoxification enzymes.⁵ HO-1 serves as an enzyme to convert heme into bilirubin. The bilirubin is an antioxidant that, after reduction by HO-1, reduces cytotoxic agents generated by oxidative stress.^6,7 Recent animal studies have shown that the activation of the Nrf2 pathway followed by the expression of phase II detoxification enzymes had effective function in healing liver damage.

N-acetylcysteine (NAC) is an antidote for APAP overdose, which is effective in the early stages of the hepatotoxicity of APAP, but it imposes side effects from nausea to death. The NAC renders nausea and vomiting in oral route and anaphylaxis-like reaction in intravascular administration, but it is positioned in the anaphylactoid group because of nonimmunological mechanisms and is associated with symptoms of rash, angioedema, bronchospasm, and rarely hypotension. Long-term consumption of NAC with high doses leads to a defect in liver regeneration.^8,9 Therefore, according to the presented introduction, it is valuable and significant to develop new drugs to treat acute APAP-induced liver injury (AILI).

Betaine or trimethylglycine is naturally found in humans, animals, microorganisms, and in many foods, such as sugar beet, wheat, shellfish, shrimp, and spinach. Betaine is derived from the choline metabolism in the body and is one of the key components of the methionine–homocysteine cycle, and as a methyl donor, it plays an important role in neutralizing homocysteine and converting it into methionine and cysteine in the liver. Betaine is converted to ultimately into glycine, methionine, and cysteine amino acids during metabolism. Cysteine and glycine are precursor amino acids for the production of glutathione.^10,11

The hepatoprotective effect of betaine has been studied in many animal models of liver diseases, such as alcohol-induced liver injury, bile acid-induced liver injury, liver damage caused by chloroform and carbon tetrachloride, as well as in nonalcoholic fatty liver disorder. Various hepatoprotective mechanisms of betaine include improved endoplasmic reticulum stress, improved mitochondrial function, and improved insulin resistance, and one of the most important hepatoprotective mechanisms of betaine is to produce the sulfur-containing amino acids.^{12

–19}

It has been well documented that oxidative stress occurs in APAP toxicity, but the effect of betaine on APAP toxicity is still unknown. Given the ability of betaine, the question arises as to whether betaine can be effective against the hepatotoxicity of APAP? Moreover, if it is effective, can these beneficial effects be dependent on the cytoprotective genes associated with Nrf2? Hence, this study examined the Nrf2 pathway and the related target cytoprotective genes that activate phase II detoxification enzymes.

Materials and methods

Chemicals

APAP, betaine, glutathione (GSH), Coomassie blue, thiobarbituric acid (TBA), trichloroacetic acid (TCA), dithiobis-2-nitrobenzoic acid (DTNB), ethylenediaminetetraacetic acid (EDTA), and bovine serum albumin were purchased from Sigma Chemical Co. (St Louis, Missouri, USA). Antibodies against Nrf2, HO-l, and β-actin and also antirabbit immunoglobulin (IgG)-horseradish peroxidase (HRP) secondary antibody and antimouse IgG (H+L)-HRP secondary antibody were purchased from Abcam (Cambridge, UK). All other chemicals of the analytical grade were commercially available.

Animals

In the present study, adult male NMRI mice were used weighing 22–25 g. Mice were permitted to acclimate to their condition environment for 1 week before starting the experiments. Animals were housed in an air-conditioned room of 20 ± 4°C, humidity of 10%, and 12-h light/12-h dark with free access to standard mice chow and water. Animals were conducted with the guidelines of Animal Ethics Committee of Ahvaz Jundishapur University of Medical Sciences and (ethical approval ID: IR.AJUMS.REC.1396.653).

Experimental design

In the present study, 28 mice randomly divided into four groups.

Group 1: as the control group intraperitoneally administrated normal saline once a day for five consecutive days.

Group 2: intraperitoneally administrated APAP 300 mg/kg, i.p., a single dose on the fifth day.

Group 3: intraperitoneally administrated betaine 500 mg/kg, i.p., once a day for five consecutive days and on the fifth day received a single dose of APAP 300 mg/kg, i.p.

Group 4: intraperitoneally administrated betaine 500 mg/kg, i.p., once a day for five consecutive days alone.

APAP dissolved in warm normal saline and betaine dissolved in normal saline. The doses of betaine and APAP were chosen based on our previous study.^3,20 Twenty-four hours after administration of APAP, all mice were anesthetized and blood samples were collected from heart. Blood samples then at 3000 for 10 min were centrifuged and serum separated. A part of the liver was kept at 10% formalin for histopathological and immunohistochemical studies. The other part of the liver was kept at −80°C for assessments of oxidative stress, Western blot, and real-time PCR.

Determination of serum enzymes

Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities were measured by diagnostic kits (Pars Azmoon Co., St Tohid, Tehran, Iran) and spectrophotometer (UV-1650 PC, Shimadzu, Japan).

Measurement of GSH

GSH test was performed using DTNB reagent. Firstly, the livers were homogenized with phosphate-buffered saline (PBS) at a ratio of 1:10 with homogenizer. Then, samples were mixed with PBS and Ellman reagent. After 10 min, optical density (OD) was read by a spectrophotometer at a wavelength of 412 nm. The GSH content was calculated (mmol/g tissue) using molar extinction coefficient of ε = 1.36 × 104/M/cm.²¹

Measurement of MDA

Lipid peroxidation of the liver tissue is examined by measuring malondialdehyde (MDA). The MDA reacts with TBA and produces a color complex that has a maximum absorbance at a wavelength of 532 nm. The method is as follows: First, 0.5 ml of homogenate was mixed in 0.5 ml of 30% TCA and centrifuged with 3000 r/min for 5 min, and then 0.5 ml of the supernatant was blended with 0.5 ml of 1% TBA and placed in a water bath for 30 min. Next, the tubes were placed in cold water for 10 min and the OD of the supernatant was read at a wavelength of 532 nm and the MDA content was calculated (µmol/g tissue) using the molar extinction coefficient of ε = 1.56 × 105/M/cm.²²

Immunohistochemical assessment

Paraffin-embedded liver sections were deparaffinized at 56°C for 3 h, rehydrated, and then, endogenous peroxidase activity was inactivated with incubation in 3% H₂O₂ for 30 min. Retrieval antigen was done by citrate buffer at 98°C for 15 min. Then, blocking step was performed by 10% gout serum. The slides were incubated at 4°C overnight with primary antibodies of anti-HO-1 (1:100, ab52947) and anti-Nrf2 (1:100, ab62352) followed with a secondary antibody (1:100) at room temperature for 2 h. The reaction site of antigen–antibody was detected with 3,3-diaminobenzidine (D5637, Sigma Chemical Co., St Louis, Missouri, USA). Finally, slides were stained by hematoxylin. The slides were examined to calculate the intensity of staining, semiquantitative calculations, and scoring by light microscope. Six sections of each mouse were blindly considered and staining intensity was assessed by a semiquantitative score. The algorithm application was used to measure the histoscore (H-score) for each section. H-score = ∑Pi (i+1), where Pi was the percentage of stained cells for each intensity and i was the intensity of staining.²³

Western blot assessment

Liver tissue in ice-cold lysis buffer along with protease inhibitor cocktail (Roche Diagnostics GmbH, Berlin, Germany, Cat. No. 11 836 153 001) was homogenized. Then, quantities of proteins were determined by Bradford assay. Extracted proteins (25 μg) were separated using sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (10%) and transferred to polyvinylidene difluoride membranes. Membranes were blocked at 4°C overnight with skimmed milk 5% in phosphate buffer and then were immunoblotted at 4°C overnight with primary antibodies of anti-HO-1 (1: 100, ab52947), anti-Nrf2 (1: 500, ab62352), and anti-β-actin (1:2000, ab8226) and then were incubated for 2 h with secondary antibodies. The membranes were exposed to enhanced chemiluminescence kit and protein bonds were detected with the chemiluminescence imaging system. β-Actin was used as the housekeeping protein. The relative mass of protein bands was quantified by ImageJ software version 1.51.²⁴

Real-time PCR assessment

The total RNA of liver tissue was extracted by Super RNA Extraction kit (Yekta Tajhiz Azma, IRI, St Baghdarnia, Tehran, Iran, Cat No: YT9080). Reverse transcription was done with complementary DNA synthesis kit (Yekta Tajhiz Azma, IRI, Cat No: YT4500). Real-time PCR reaction was then completed with (Step One Plus™ real-time PCR System, Thermo Fisher Scientific, Inc.) SYBR Green Master Mix (2×, BIOFACT Co., Ltd.) and primers according to the manufacturer’s instructions. In the first step, denaturation: high-temperature incubation (95°C, 10 min, one cycle) was used for double-stranded DNA into single strands. Next, the annealing step: during annealing, complementary sequences had an opportunity to hybridize, so an appropriate temperature (60°C) was used that was based on the calculated melting temperature (T _m) of the primers. The last step, extension: the activity of the DNA polymerase was optimal, and primer extension occurred at rates of up to 100 bases/s for 40 cycles. Data were normalized using the housekeeping gene of glyceraldehyde-3-phosphate dehydrogenase.²⁵ The primers used in the present study were presented in Table 1.

Table 1.

Sequences of primers for real-time PCR.

Genes	Reverse primers	Forward primers
Nrf2	TCCTGCCAAACTTGCTCCAT	TGTAGATGACCATGAGTCGC
HO-1	AGGAAGGCGGTCTTAGCCTC	CCCACCAAGTTCAAACAGCTC
GAPDH	ATGCCACAGGATTCCATACC	GTGCTATGTTGCTCTAGACTTCG

Nrf2: nuclear factor (erythroid-derived 2)-like 2; HO-1: heme oxygenase-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Histopathological staining

Liver tissues were fixed in 10% formalin. After 24 hours, tissues were embedded in paraffin. Next, 5-μm-thick sections were prepared and placed on the slides. Slides were then stained with hematoxylin and eosin (H&E). Histopathological changes including necrosis, inflammation, and semiquantitative calculations and scoring were evaluated by a light microscope.

Statistical analysis

The average of data in each group was expressed as mean ± standard error of the mean. For matching the significance of difference among groups, one-way analysis of variance following Tukey’s post hoc test was evaluated. Differences were considered statistically significant by p <0.05. GraphPad Prism software (version 5; GraphPad Software, Inc., La Jolla, California, USA) was used for analyses.

Results

Betaine improves APAP-induced acute liver injury

Results obtained from analyzing the serum AST and ALT levels in the mice exposed to doses of 300 mg/kg of APAP and 500 mg/kg of betaine are presented in Table 2. The mere betaine group exhibited no change in the serum AST and ALT levels compared to the control group, which indicates that the betaine itself has no hepatotoxicity at the used dose. The APAP group significantly increased the serum AST and ALT levels compared to the control group (p < 0.001). The serum levels of these two enzymes were significantly lower in the betaine + APAP group than in the mere APAP group (p < 0.001). The histological examinations also confirm the analysis of serum enzymes (Figure 1). In the histological examinations, the control and the mere betaine groups had a completely normal tissue. However, the APAP group showed massive centrilobular hepatic necrosis with the accumulation of inflammatory cells, whereas the betaine + APAP group improved the AILI.

Table 2.

Effect of betaine and APAP on serum ALT and AST activities and GSH and MDA levels.

Groups	ALT (U/l)	AST (U/l)	GSH (mmol/g tissue)	MDA (µmol/g tissue)
Control	71.29 ± 4.602	117.7 ± 11.57	15.78 ± 0.474	21.48 ± 2.69
APAP	405.84 ± 31.14^b	845.5 ± 30. 17^b	3.93 ± 0.322^b	105.27 ± 4.145^b
Betaine + APAP	154.28 ± 8.78^c	304.6 ± 9.69^c	12.15 ± 0.456^c	68.17 ± 4.799^c
Betaine	90.29 ± 3.708	138.8 ± 7.631	15.59 ±0.328	19.75 ± 2.469

^a Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Then, serum AST and ALT activities, GSH and MDA levels were measured. Data are expressed as mean ± SEM, n = 7. APAP: acetaminophen; GSH: glutathione; MDA: malondialdehyde; AST: asparate aminotransferase; ALT: alanine aminotransferase.

^b p < 0.001 versus the control group.

^c p < 0.001 versus the APAP group.

Figure 1.

Effect of betaine and APAP on the alterations of liver tissue. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Then, hematoxylin and eosin staining of liver tissue was done. C: congestion of RBC; I: infiltration of inflammatory cells; P: pyknosis; APAP: acetaminophen.

Betaine prevents from GSH depletion

GSH measurement is one of the best biomarkers to assess the extent of APAP-induced hepatotoxicity because the toxic metabolite of APAP (NAPQI) is detoxified by GSH in the liver. As presented in Table 2, the mere betaine group revealed no change in the GSH content compared to the control group. After the administration of APAP by the mice, the GSH content was significantly decreased (p < 0.001), but it was increased with a significant difference in the group receiving betaine pretreatment compared to the APAP group (p < 0.001). This indicates that the betaine at the used dose through increasing the GSH was able to prevent further APAP-induced hepatotoxicity.

Betaine prevents from lipid peroxidation

To evaluate the association between lipid peroxidation and APAP-induced hepatotoxicity, the MDA was measured in the liver tissue of the control and treatment groups. As presented in Table 2, the mere betaine group showed no change in the MDA value compared to the control group, but the APAP group showed a significant increase in the extent of MDA (p < 0.001). However, the extent of MDA was significantly decreased in the betaine + APAP group compared with the APAP group (p < 0.001), indicating that the betaine at the used dose improved AILI by decreasing the lipid peroxidation.

HO-1 and Nrf2 proteins expression by immunohistochemistry

The results of immunohistochemical staining of the liver tissue to assess the expression of the HO-1 and Nrf2 proteins are shown in Figures 2(a) and 3(a). As can be seen, the control group and the mere betaine group exhibit very bright staining, while the APAP group shows a much higher level of staining than the control group, but the betaine + APAP group displays much weaker staining than the APAP group. The staining intensity indicates the extent of antigen–antibody reaction. The semiquantitative results of HO-1 and Nrf2 immunohistochemistry are shown in Figures 2(b) and 3(b). As seen, the extent of antigen–antibody reaction in the APAP group was significantly higher than that of the control group (p < 0.001). In the betaine pretreatment group, this reaction level was significantly reduced compared to the APAP group (p < 0.001). These results indicated that the increased expression of Nrf2 and HO-1 proteins by APAP is a compensatory mechanism to combat acute liver toxicity.

Figure 2.

Results of immunohistochemistry of HO-1 in the control and therapeutic groups. (a) Immunohistochemistry staining and (b) H-score of HO-1. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Data are expressed as mean ± SEM, n = 7. **p < 0.01 and ***p < 0.001versus the control group; ^### p < 0.001 versus the APAP group. APAP: acetaminophen; BT: betaine; HO-1: heme oxygenase-1.

Figure 3.

Results of immunohistochemistry of Nrf2 in the control and therapeutic groups. (a) Immunohistochemistry staining and (b) H-score of Nrf2. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Data are expressed as mean ± SEM, n = 7. **p < 0.01 and ***p < 0.001 versus the control group; ^### p < 0.001 versus the APAP group. APAP: acetaminophen; BT: betaine; Nrf-2: nuclear factor-erythroid-2-related factor 2.

HO-1 and Nrf2 proteins expression by Western blotting

The expression levels of Nrf2 and HO-1 proteins were investigated by Western blotting to determine whether the hepatoprotective effect of betaine against APAP-induced toxicity is related to the activity of Nrf2 and the cytoprotective enzymes of phase II metabolism. As shown in Figures 4 and 5, the betaine group alone had no effect on the expression level of these proteins, while the APAP group caused a significant increase in the expression level of these proteins compared to the control and the betaine + APAP groups (p < 0.001). These results indicated that the APAP induced the expression of these proteins following the oxidative stress, but the hepatoprotective effect of betaine has applied via a pathway other than the pathways of Nrf2 and phase II metabolism enzymes.

Figure 4.

Results of Western blot of HO-1 in the control and therapeutic groups. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Data are expressed as mean ± SEM, n = 7. ***p < 0.001versus the control group; ^### p < 0.001 versus the APAP group. APAP: acetaminophen; BT: betaine; HO-1: heme oxygenase-1.

Figure 5.

Results of Western blot of Nrf2 in the control and therapeutic groups. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Data are expressed as mean ± SEM, n = 7. ***p < 0.001 versus the control group; ^### p < 0.001 versus the APAP group. APAP: acetaminophen; BT: betaine; Nrf-2: nuclear factor-erythroid-2-related factor 2; SEM: standard error of the mean.

Nrf2 and HO-1 genes expression by real-time PCR

To verify that the Nrf2 and HO-1 are involved in the hepatoprotective effect of betaine against APAP toxicity, the expression levels of these genes were evaluated using the real-time PCR technique. As shown in Figure 6, the mere betaine group had no effect on the expression level of these genes, as compared to the control group. But the APAP group significantly increased the expression level of these genes in comparison with the control and the betaine + APAP groups (p < 0.001). These results underline that the APAP prompted the expression of these genes under oxidative stress conditions, but the betaine caused hepatoprotection against APAP via a route other than the mentioned pathway.

Figure 6.

Results of real-time PCR of Nrf2 and HO-1in the control and therapeutic groups. Mice pretreated with betaine (500 mg/kg, i.p. for 5 days) and then administrated a single dose of APAP (300 mg/kg, i.p.) on the fifth day. The animals were euthanized 24 h after APAP administration. Data are expressed as mean ± SEM, n = 7. ***p < 0.001versus the control group; ^### p < 0.001 versus the APAP group. APAP: acetaminophen; BT: betaine; SEM: standard error of the mean.

Discussion

It has been well documented that the use of toxic dose of APAP is the main cause of acute liver injury. Oxidative stress induced by the active metabolite of APAP (NAPQI) has a main correlation with hepatotoxicity caused by APAP. In this study, the pretreatment with betaine improved the AILIs. The betaine reduced the concentration of MDA as the final product of lipid peroxidation and increased the concentration of GSH as the pivotal antioxidant defense against the hepatotoxicity of APAP. The betaine did not change the genes and proteins expression of Nrf2-related cytoprotective genes.

The activity of ALT and AST enzymes is one of the most sensitive biomarkers to detect liver damage.³ Based on the findings of this study, the single dose of APAP (300 mg/kg) increased the serum AST and ALT levels. This increase is due to the release of these enzymes from the cytoplasm of the damaged cells to the bloodstream, indicating hepatocyte necrosis or hepatic inflammation. Meanwhile, the serum levels of these two enzymes in the betaine pretreatment group showed a significant decrease compared to the APAP group. Histopathological examinations in the APAP group highlighted centrilobular hepatic necrosis, inflammatory cell infiltration, and sinusoidal dilatation. The pathological changes in the betaine pretreatment group have been greatly improved. In concordance with our study, previous studies also reported that the single dose of APAP (300 mg/kg) resulted in centrilobular hepatic necrosis and hepatic inflammation with increased serum AST and ALT levels.^20,26,27 In agreement with the present study, many studies have shown that betaine has a protective role against the hepatotoxicity induced by chloroform,¹¹ lipopolysaccharide,¹³ and carbon tetrachloride.¹⁷ The betaine can also protect other tissues, such as kidneys,²⁸ brain,²⁹ heart,³⁰ and adipose tissue.⁹

Oxidative stress and reactive oxygen species are associated with APAP-induced hepatotoxicity and are indirectly indicative of a reduction in the hepatic antioxidant defense system. Glutathione conjugates are an important route of detoxification against reactive metabolite generated by the toxic dose of APAP.³¹ After evacuating glutathione, NAPQI reacts with other cysteine-containing proteins and also with lipids in the cell membrane and leads to lipid peroxidation. Thus, the MDA as the final product of lipid peroxidation is considered as a good marker to detect the AILIs.³²

In our study, the exposure to APAP significantly increased the MDA content and reduced the glutathione content. These changes in MDA and glutathione levels mean the oxidative stress induction and the cell membrane lipid damage, resulting in the hepatocyte necrosis. However, the pretreatment with betaine increased the glutathione content and reduced the MDA content, indicating the improved hepatic injury. A possible hepatoprotective mechanism of betaine is attributed to its chaperone-like and osmotic properties. The betaine easily penetrates into the cell across the bilayer cell membrane from the bloodstream due to its structure with the help of the Na⁺ and Cl⁻ dependent betaine–gamma aminobutyric acid (GABA) transporter as well as could utilize the ubiquitous transport systems for amino acids and carnitine and accumulates in the cell with high concentrations (mM/l), circumfuses around the intracellular components, surrounds the intracellular macromolecules as a chaperone, and acts like a shield. The betaine in the cell also acts as an organic osmolyte. When the betaine enters the cell, it is distributed in a nonuniform manner around proteins and creates a thermodynamic force that reduces their water and compresses their volume, thereby preserving the main protein structure and preventing them from damage under stressful conditions. This possible betaine mechanism is supported by studies in this regard. A recent study demonstrated that the betaine as an osmolyte promotes protein structure stability because the betaine in aqueous solutions establishes easily and firmly the hydrogen bond with water molecules due to the molecular structure. When the betaine content increases in the cell, each betaine molecule can store up to 12 molecules of water through a solid hydrogen bond. Therefore, the betaine dehydrates the peptides and then compresses them, thereby preventing damage to their structure.^18,33

The Nrf2 induces cytoprotective enzymes in oxidative stress conditions.³ Among these genes, HO-1 acts as an intracellular antioxidant and causes cytoprotection against tissue damage caused by oxidative stress. The relationship between HO-1 and liver injury has been tested for many of the damages caused by hepatotoxicity in various models using substances, such as concanavalin A and D-galactosamine/lipopolysaccharide. In addition, the researchers examined some of the agents used for hepatoprotection against apoptosis and necrosis, such as HO-1-inducing cobalt protoporphyrin, in many mouse models.^34

–37 The findings from real-time PCR, Western blot, and immunohistochemistry in this study revealed that the APAP significantly increased the expression of Nrf2 and HO-1 genes and proteins in comparison with the control and the betaine + APAP groups. This finding suggests that the liver exposed to APAP toxicity began to induce genes and synthesize the enzymes of phase II metabolism to manage with oxidative stress, but these cellular mechanisms could not overcome the cytotoxicity, and the APAP ultimately caused hepatocyte necrosis. In contrast to our study, some studies have shown that the APAP had no effect on the activity of Nrf2 and enzymes of phase II metabolism.²⁷ Some studies similar to our study documented that the APAP increased these genes and proteins in comparison to the control group.²⁶

In the betaine + APAP group, the expression of Nrf2 and HO-1 genes and proteins showed a significant decrease compared to the APAP group. These findings indicate that the hepatoprotective effect of betaine against APAP toxicity may not be related to the pathway of the Nrf2-dependent genes. In line with us, a study reported that the hepatoprotective effect of betaine against chloroform toxicity was not associated with phase II metabolism enzymes, such as glutathione S-transferase, glutathione-disulfide reductase, and glutathione peroxidase.¹¹

This function of betaine is different from other antioxidants because of its unique molecular structure. Most of the antioxidants contain polyphenols and flavonoids in their structure, and these compounds play an important role in eliminating free radicals caused by oxidative stress. The effect of betaine on increasing hepatic glutathione content can be attributed to the preparation of essential cysteine as a precursor amino acid for the synthesis of glutathione. The betaine in the transsulfuration pathway in the liver is used as a substrate in combination with homocysteine in the synthesis of methionine, mediated by betaine-homocysteine methyltransferase. It should be noted that high dose of betaine is likely to be used to transfer and withdraw homocysteine and synthesis of cysteine through the formation of cystathionine and that the cysteine is an essential substrate for the synthesis of glutathione. This conjecture is strengthened particularly through clinical observations because the betaine is used to reduce plasma homocysteine in the treatment of patients with homocystinuria.³⁸

In summary, biochemical, histological, real-time PCR, immunohistochemical, and Western blot findings of this study demonstrated that the increased expression of Nrf2 and HO-1 genes and proteins by APAP is a compensatory mechanism to combat acute liver toxicity. While the protective effect of betaine against acute liver injury induced by APAP is independent on the Nrf2 and HO-1 genes but occurs via modifying cysteine supply as a precursor of glutathione in the transsulfuration pathway in the liver.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This article is issued from the thesis of LZ and was financially supported by Toxicology Research Center (Grant Number: TRC-9609) provided by the Vice Chancellor of Research, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

ORCID iDs

L Khorsandi

L Zeidooni

References

Kullak-Ublick

Andrade

Merz

, et al. Drug-induced liver injury: recent advances in diagnosis and risk assessment. Gut 2017; 66(6): 1154–1164.

El-Sayed

ESM

Mansour

Nady

. Protective effects of pterostilbene against acetaminophen-induced hepatotoxicity in rats. J Biochem Mol Toxicol 2015; 29(1): 35–42.

Khodayar

Kalantari

Khorsandi

, et al. Betaine protects mice against acetaminophen hepatotoxicity possibly via mitochondrial complex II and glutathione availability. Biomed Pharmacother 2018; 103: 1436–1445.

Tong

Kobayashi

Katsuoka

, et al. Two-site substrate recognition model for the Keap1-Nrf2 system: a hinge and latch mechanism. Biol Chem 2006; 387(10/11): 1311–1320.

Maamoun

Zachariah

McVey

, et al. Heme oxygenase (HO)-1 induction prevents endoplasmic reticulum stress-mediated endothelial cell death and impaired angiogenic capacity. Biochem Pharmacol 2017; 127: 46–59.

Clark

Foresti

Green

, et al. Dynamics of heme oxygenase-1 expression and bilirubin production in cellular protection against oxidative stress. Biochem J 2000; 348(3): 615–619.

Ryter

Otterbein

. Carbon monoxide in biology and medicine. Bioessays 2004; 26(3): 270–280.

Sandilands

Bateman

. Adverse reactions associated with acetylcysteine. Clin Toxicol 2009; 47(2): 81–88.

Schmidt

. Identification of patients at risk of anaphylactoid reactions to N-acetylcysteine in the treatment of paracetamol overdose. Clin Toxicol 2013; 51(6): 467–472.

10.

Wang

Yao

Pini

, et al. Betaine improved adipose tissue function in mice fed a high-fat diet: a mechanism for hepatoprotective effect of betaine in nonalcoholic fatty liver disease. Am J Physiol Gastrointest Liver Physiol 2010; 298(5): G634–G42.

11.

Figueroa-Soto

Valenzuela-Soto

. Glycine betaine rather than acting only as an osmolyte also plays a role as regulator in cellular metabolism. Biochimie 2018; 147: 89–97.

12.

Kim

. Effects of singly administered betaine on hepatotoxicity of chloroform in mice. Food Chem Toxicol 1998; 36(8): 655–661.

13.

Kim

. Attenuation of bacterial lipopolysaccharide-induced hepatotoxicity by betaine or taurine in rats. Food Chem Toxicol 2002; 40(4): 545–549.

14.

Balkan

Parldar

Dogru-Abbasoglu

, et al. The effect of taurine or betaine pretreatment on hepatotoxicity and prooxidant status induced by lipopolysaccharide treatment in the liver of rats. Eur J Gastroenterol Hepatol 2005; 17(9): 917–921.

15.

Zhang

Warskulat

Wettstein

, et al. Identification of betaine as an osmolyte in rat liver macrophages (Kupffer cells). Gastroenterology 1996; 110(5): 1543–1552.

16.

Zhang

Warskulat

Häussinger

. Modulation of tumor necrosis factor-α release by anisoosmolarity and betaine in rat liver macrophages (Kupffer cells). FEBS Lett 1996; 391(3): 293–296.

17.

Kim

Seo

Chae

, et al. Alleviation of dimethyl nitrosamine-induced liver injury and fibrosis by betaine supplementation in rats. Chem Biol Interact 2009; 177(3): 204–211.

18.

Murakami

Nagamura

Hirano

. The recovering effect of betaine on carbon tetrachloride-induced liver injury. J Nutr Sci Vitaminol 1998; 44(2): 249–255.

19.

Day

Kempson

. Betaine chemistry, roles, and potential use in liver disease. Biochim Biophys Acta Gen Subj 2016; 1860(6): 1098–1106.

20.

McGill

Xie

, et al. Resveratrol prevents protein nitration and release of endonucleases from mitochondria during acetaminophen hepatotoxicity. Food Chem Toxicol 2015; 81: 62–70.

21.

Ellman

. Tissue sulfhydryl groups. Arch Biochem Biophys 1959; 82(1): 70–77.

22.

Bhutia

Ghosh

Sherpa

, et al. Serum malondialdehyde level: surrogate stress marker in the Sikkimese diabetics. J Nat Sci Biol Med 2011; 2(1): 107–112.

23.

Yokomori

Oda

Yoshimura

, et al. Recent advances in liver sinusoidal endothelial ultrastructure and fine structure immunocytochemistry. Micron 2012; 43(2–3): 129–134.

24.

Reisman

Aleksunes

Klaassen

. Oleanolic acid activates Nrf2 and protects from acetaminophen hepatotoxicity via Nrf2-dependent and Nrf2-independent processes. Biochem Pharmacol 2009; 77(7): 1273–1282.

25.

Tatsumi

Ohashi

Taminishi

, et al. Reference gene selection for real-time RT-PCR in regenerating mouse livers. Biochem Biophys Res Commun 2008; 374(1): 106–110.

26.

Lin

Zhai

Wang

, et al. Salvianolic acid B protects against acetaminophen hepatotoxicity by inducing Nrf2 and phase II detoxification gene expression via activation of the PI3 K and PKC signaling pathways. J Pharmacol Sci 2015; 127(2): 203–210.

27.

Noh

J-R

Kim

Y-H

Hwang

, et al. Sulforaphane protects against acetaminophen-induced hepatotoxicity. Food Chem Toxicol 2015; 80: 193–200.

28.

Hagar

Medany

Salam

, et al. Betaine supplementation mitigates cisplatin-induced nephrotoxicity by abrogation of oxidative/nitrosative stress and suppression of inflammation and apoptosis in rats. Exp Toxicol Pathol 2015; 67(2): 133–141.

29.

Kanbak

Arslan

Dokumacioglu

, et al. Effects of chronic ethanol consumption on brain synaptosomes and protective role of betaine. Neurochem Res 2008; 33(3): 539–544.

30.

Ganesan

Anandan

. Protective effect of betaine on changes in the levels of lysosomal enzyme activities in heart tissue in isoprenaline-induced myocardial infarction in Wistar rats. Cell Stress Chaperones 2009; 14(6): 661–667.

31.

Yuan

Jin

Piao

. Hepatoprotective effects of an active part from Artemisia sacrorum Ledeb. against acetaminophen-induced toxicity in mice. J Ethnopharmacol 2010; 127(2): 528–533.

32.

Wang

Jiang

Fan

, et al. Hepato-protective effect of resveratrol against acetaminophen-induced liver injury is associated with inhibition of CYP-mediated bioactivation and regulation of SIRT1-p53 signaling pathways. Toxicol Lett 2015; 236(2): 82–89.

33.

Kanbak

Akyuz

Inal

. Preventive effect of betaine on ethanol-induced membrane lipid composition and membrane ATPases. Arch Toxicol 2001; 75(1): 59–61.

34.

Bauer

Vollmar

Jaeschke

, et al. Transcriptional activation of heme oxygenase-1 and its functional significance in acetaminophen-induced hepatitis and hepatocellular injury in the rat. J Hepatol 2000; 33(3): 395–406.

35.

Bauer

Huse

Settmacher

, et al. The heme oxygenase-carbon monoxide system: regulation and role in stress response and organ failure. Intensive Care Med 2008; 34(4): 640–648.

36.

Sass

Soares

Yamashita

, et al. Heme oxygenase-1 and its reaction product, carbon monoxide, prevent inflammation-related apoptotic liver damage in mice. Hepatology 2003; 38(4): 909–918.

37.

Hervera

Leanez

Motterlini

, et al. Treatment with carbon monoxide-releasing molecules and an HO-1 inducer enhances the effects and expression of micro-opioid receptors during neuropathic pain. Anesthesiology 2013; 118(5): 1180–1197.

38.

Steenge

Verhoef

Katan

. Betaine supplementation lowers plasma homocysteine in healthy men and women. J Nutr 2003; 133(5): 1291–1295.

Upregulation of Nrf2-related cytoprotective genes expression by acetaminophen-induced acute hepatotoxicity in mice and the protective role of betaine

Abstract

Keywords

Introduction

Materials and methods

Chemicals

Animals

Experimental design

Determination of serum enzymes

Measurement of GSH

Measurement of MDA

Immunohistochemical assessment

Western blot assessment

Real-time PCR assessment

Histopathological staining

Statistical analysis

Results

Betaine improves APAP-induced acute liver injury

Betaine prevents from GSH depletion

Betaine prevents from lipid peroxidation

HO-1 and Nrf2 proteins expression by immunohistochemistry

HO-1 and Nrf2 proteins expression by Western blotting

Nrf2 and HO-1 genes expression by real-time PCR

Discussion

Footnotes

Declaration of conflicting interests

Funding

ORCID iDs

References