Sage Journals: Discover world-class research

Abstract

Degus (Octodon degus) that were kept at a breeding facility presented with neurological or respiratory symptoms and died. Necropsies were performed on 9 individuals, and no significant gross lesions were found. Histologically, spinal cord necrosis was observed in all 9 cases and granulomatous myelitis in 5 of the 9 cases. Locally extensive necrosis of the brain and encephalitis were observed in 7 of the 9 cases. Acid-fast bacteria were found in the spinal cords, brains, and lungs from all 9 cases. Immunohistochemically, Mycobacterium tuberculosis antigen was observed in the spinal cords, brains, and lungs from all 9 cases. Double-labeling immunofluorescence revealed M. tuberculosis antigen in IBA1- and myeloperoxidase-immunopositive cells. Extracted genomic DNA from 8 of the 9 cases was successfully amplified with the primers for Mycobacterium genavense ITS1 and hypothetical 21 kDa protein genes, and the polymerase chain reaction products were identified as M. genavense by DNA sequencing. This report highlights the susceptibility of degus to M. genavense infection in the central nervous system.

Keywords

central nervous system degus spinal cord necrosis spinal cord

Mycobacterium genavense is a nontuberculous mycobacterium that causes granulomatous pneumonia in various animal species.¹⁸ Some reports suggest M. genavense is a potential zoonotic pathogen.^30,31 In humans, abdominal lymphadenopathy associated with M. genavense infection has been reported in immunocompromised patients, especially in patients with acquired immunodeficiency syndrome (AIDS).⁶ In birds, M. genavense is one of the most common causes of mycobacteriosis, along with M. avium.³⁷ M. genavense infection has been commonly identified in psittacines and other pet birds^{11,27,28,30,37} and is associated with granulomatous pneumonia and splenomegaly.^30,31 Clinical signs include sudden death, weight loss, diarrhea, neurological changes, and respiratory disorders.^30,31 M. genavense has also been detected in the feces of clinically healthy parrots.²⁰ Thus, birds are considered to be a possible reservoir of M. genavense.

M. genavense infection has caused generalized lymphadenopathy in dogs, cats, horse, small mammals, birds, and immunocompromised humans.^{4,5,7,9,11–13,18,21,24,28} In small mammals, M. genavense infections have been reported in a dwarf rabbit, a grizzled giant squirrel, a chinchilla, a guinea pig, and two ferrets.^{14,21,22,25,34} Systemic granulomatous inflammation was observed in these cases. Here, we report an outbreak of M. genavense infection resulting in spinal cord necrosis in degus (Octodon degus) that were kept at a breeding facility.

Materials and Methods

Cases and Pathological Examinations

Forty degus were kept in the facility (at least 22.5% of the degus were affected). No predisposing factors were identified. Eight degus showed neurological or respiratory signs; one degu died suddenly without any neurological signs. The degus were kept in the same room, and their cages were situated under birdcages. The age, sex, and clinical signs of the degus are provided in Table 1. Necropsies were performed on all 9 degus, and tissue samples from the heart, lung, gastrointestinal tract, liver, pancreas, spleen, kidney, brain, and spinal cord were collected. Tissues were fixed in 10% neutral-buffered formalin and embedded in paraffin. Formalin-fixed, paraffin-embedded tissues were sectioned to a thickness of 3 µm and stained with hematoxylin and eosin (HE) and Ziehl-Neelsen staining.

Table 1.

Clinical information of degus.

Case	Age	Sex	Clinical Signs
No. 1	6y	Male	Paresis of hind limb
No. 2	ND	Female	Torticollis
No. 3	2y	Male	Paresis of hind limb
No. 4	3y	Female	Paresis of hind limb
No. 5	4y2m	Female	Respiratory disorder
No. 6	3y	Male	Paresis of hind limb
No. 7	4m	Female	Sudden death
No. 8	6y	Male	Paresis of hind limb
No. 9	5y5m	Female	Paresis of hind limb

Abbreviations: y, years; m, months; ND, no data.

Immunohistochemistry

Serial sections were subjected to immunohistochemical analysis using primary antibodies including anti-Mycobacterium tuberculosis antigen, Iba1, glial fibrillary acidic protein (GFAP), neurofilament, and myeloperoxidase antibodies. Detailed information about the primary antibodies is listed in Supplemental Table S1. A previous report has shown that anti-M. tuberculosis antibody cross-reacts with nontuberculous mycobacteria.³² Deparaffinized tissue sections were immersed in 3% hydrogen peroxide (H₂O₂) in methanol at room temperature for 5 minutes and then incubated in 8% skim milk in Tris-buffered saline (TBS) at 37°C for 40 minutes to avoid nonspecific reactions. After the blocking reaction, the sections were treated with a primary antibody at 4°C overnight. After washing with TBS, the sections were incubated with the Envision+ polymer (Dako, Denmark). Finally, the sections were visualized using diaminobenzidine tetrahydrochloride and counterstained with hematoxylin. Brain and spleen from a degu were used as positive controls for IBA1, glial fibrillary acidic protein (GFAP), neurofilament, and myeloperoxidase. A lymph node from a cat with mycobacterium infection was used as a positive control for M. tuberculosis immunohistochemistry. A negative control was prepared by applying an irrelevant antibody and buffer instead of the primary antibodies.

Double-Labeling Immunofluorescence

Double-labeling immunofluorescence was performed on spinal cord sections to identify M. tuberculosis antigen-positive cells using the anti-IBA1, neurofilament, and myeloperoxidase antibodies. Double-labeling immunofluorescence with primary antibodies from same host was performed using a method previously described.³³ Sections were blocked with 8% skim milk in Tris-buffered saline (TBS) at 37°C for 40 minutes and then incubated with the anti-M. tuberculosis antibody at 4°C overnight. After washing with TBS, sections were incubated with a fluorescein-conjugated goat anti-rabbit IgG antibody (1:500, Vector Laboratories, United States). Sections were then heated at 121°C for 10 minutes in the citrate buffer (pH 6.0) to inactivate the anti-M. tuberculosis antibody and the anti-rabbit secondary antibody. Sections were blocked with 8% skim milk in TBS at 37°C for 40 minutes and then incubated with each primary antibody (IBA1, GFAP, neurofilament, or myeloperoxidase) at 4°C overnight. After washing with TBS, sections were incubated with an Alexa 594-conjugated goat anti-rabbit IgG antibody (1:500, Invitrogen, Japan).

When primary antibodies were raised in different hosts (anti-neurofilament and anti-M. tuburculosis antibodies), after antigen retrieval, a mixture of 2 primary antibodies was applied to each section and incubated at 4°C overnight. After washing with TBS, sections were incubated with an Alexa 488-conjugated goat anti-mouse IgG antibody (1:500, Invitrogen, Japan) and Alexa 594-conjugated goat anti-rabbit IgG antibody (1:500, Invitrogen, Japan) at 37°C for 40 minutes. After washing with TBS, sections were counterstained with DAPI (Vector Laboratories, USA) and the slides were examined with a laser scanning confocal microscope (LSM700, Carl Zeiss Meditec, Japan).

Polymerase Chain Reaction and Sequencing

Genomic DNA was extracted from formalin-fixed, paraffin-embedded spinal cord tissues using the QIAamp DNA FFPE Tissue Kit (Qiagen, Deutschland). Primer pairs for internal transcribed spacer region 1 (ITS1) and M. genavense hypothetical 21kDa protein gene were used (Table 2).^1,8,31 Polymerase chain reaction (PCR) was performed in a thermocycler (C1000 Touch Thermocycler, USA) using KOD FX Neo DNA polymerase (TOYOBO, Japan) by preparing the following reaction mixture: 10 µL 2× PCR Buffer for KOD FX Neo, 4 µL dNTPs (2 mM), 0.4 µL forward primer (10 µM), 0.4 µL reverse primer (10 µM), and 0.4 µL KOD FX Neo (1 U/µL). Template DNA was added between 30 and 40 ng per PCR reaction followed by distilled water to a total volume of 20 µL. A negative control was included by adding 1 µL of ultrapure water (Wako, Japan) instead of DNA extracts. Synthetic genes of M. genavense ITS1 and hypothetical 21 kDa protein genes were used as positive controls (Eurofins, Japan; Supplemental Table S2). PCR using primer pairs 1 and 2 was performed as follows: initial denaturation at 95°C for 3 minutes, followed by 45 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 1 second. After 45 cycles, samples were kept at 72°C for 5 minutes and then stored at 4°C. PCR for primer pair 3 was performed as follows: initial denaturation at 95°C for 3 minutes, followed by 45 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 5 seconds, and extension at 68°C for 1 second. After 45 cycles, samples were kept at 72°C for 5 minutes and then stored at 4°C. The PCR products were submitted for sequence analysis (FASMAC, Japan). Sequence analysis was performed using the Basic Local Alignment Search Tool, and multi-sequence alignment was performed using CLUSTALW (https://www.genome.jp/tools-bin/clustalw).

Table 2.

PCR primers used in the present study.

Target Gene	Primer Pair and Name		Arrangement	Reference
ITS1	Primer pair 1	F (SP1)	ACCTCCTTTCTAAGGAGCACC	Fyfe et al⁸
ITS1	Primer pair 1	R (SP2)	GATGCTCGCAACCACTATCCA	Fyfe et al⁸
M. genavense hypothetical 21 kDa protein gene	Primer pair 2	F (Mgen1F)	TGACTGGTCGTTTGAGATGAAT	Babacan et al¹
M. genavense hypothetical 21 kDa protein gene	Primer pair 2	R (Mgen1R)	GATCGGAGGCAGTTCAATGTAG	Babacan et al¹
M. genavense hypothetical 21 kDa protein gene	Primer pair 3	F	AAACAGCGTCAGGAAATC	Palmieri et al²⁷
M. genavense hypothetical 21 kDa protein gene	Primer pair 3	R	GTGGGACGAAGATGTAGT	Palmieri et al²⁷

Abbreviations: PCR, polymerase chain reaction; ITS, internal transcribed spacer; F, forward; R, reverse.

Results

Gross and Histological Finding

At necropsy, the animals were in fair to good body condition, and no gross lesions were found. Microscopically, all cases had spinal cord necrosis affecting the white and gray matter of the spinal cord (Fig. 1a). The lesions were characterized by extensive granulomatous inflammation with macrophages, neutrophils, and multinucleated giant cells surrounding the vessels (Fig. 1b, c). The macrophages had moderate pale eosinophilic or foamy cytoplasm. Lesions in the brain were milder in comparison to the spinal cord. Locally extensive necrosis and granulomatous encephalitis were observed in 7 of the 9 cases. Furthermore, diffuse meningitis was observed in the spinal cord and brain. In the lungs, a few macrophages and lymphocytes infiltrated the alveolar walls and bronchioles. Ziehl-Neelsen staining revealed acid-fast bacteria in the cytoplasm of macrophages within the lesions of the spinal cord, brain, and lungs (Fig. 1d). No significant lesions were observed in the heart, spleen, gastrointestinal tract, liver, or kidney.

Figure 1.

Mycobacteriosis, spinal cord, degu. (a) Diffuse spinal cord necrosis in the white and gray matter. Case 3: Hematoxylin and eosin staining (HE). (b) Macrophage infiltration around a vessel. Case 3: HE. (c) Macrophages, neutrophils, and a multinucleated giant cell in the lesion. Case 3: HE. (d) Macrophages and a multinucleated giant cell contain acid-fast bacteria. Case 3: Ziehl-Neelsen staining. (e) Immunolabelling is present in the white and gray matter. Case 3: Immunohistochemistry (IHC) for Mycobacterium tuberculosis antigen. (f) Immunolabelling is present in microvascular endothelial cells. Case 2: IHC for M. tuberculosis antigen. (g) Immunolabelling is present in macrophages and neutrophils. Case 2: IHC for M. tuberculosis antigen.

Immunohistochemistry and Double-Labeling Immunofluorescence

Positive reactions for M. tuberculosis antigen were observed in the spinal cords of all cases (Fig. 1e). M. tuberculosis antigen was found in the endothelial cells and macrophages of the lesions (Fig. 1f, g). A few positive reactions were observed in the lesions of the brain and lungs. M. tuberculosis antigen was not detected in the heart, spleen, gastrointestinal tract, liver, or kidney from 8 of the 9 cases and was observed in the heart and liver of case 7. Double-labeling immunofluorescence revealed M. tuberculosis antigens in the cytoplasm of myeloperoxidase-positive cells and IBA1-positive cells (Fig. 2), but not in GFAP- or neurofilament-positive cells.

Figure 2.

Mycobacteriosis, spinal cord, degu. Case 3: Double-labeling immunofluorescence (IF) for M. tuberculosis antigen (green) and inflammatory cell markers (red: myeloperoxidase and IBA1). Immunolabelling for M. tuberculosis is present in (a) the myeloperoxidase immunolabeled cells and (b) IBA1 immunolabeled cells.

Polymerase Chain Reaction

The extracted genomic DNA samples of 7 cases (cases 1–6, and 9) were successfully amplified with all 3 primer pairs, and that of case 8 was successfully amplified with primer pairs 1 and 3. The sequenced PCR products using primer pair 1 had >98% identity with M. genavense ITS1 in all tissues tested, except for those from case 5. The sequenced PCR products using primer pairs 2 and 3 had >98% identity with M. genavense hypothetical 21 kDa protein gene in all tissues tested. The DNA sequence alignment using CLUSTALW among the amplified DNA and M. genavense gene are shown in Supplemental Tables S3–S5. The quality of the extracted genomic DNA from case 7 was too poor and could not be successfully amplified with the 3 primer pairs.

Discussion

M. genavense is a slow-growing, fastidious mycobacterium that is difficult to culture.⁵ In previous reports, M. genavense was detected by PCR.^14,21,22,34 In the present study, M. genavense was detected in 8 of the 9 cases by PCR using primer pairs for ITS1 and hypothetical 21 kDa protein genes. The authors hypothesize that the negative PCR result in 1 case was associated with poor DNA quality, possibly related to significant postmortem changes. M. genavense infection of the central nervous system (CNS) is rare. Intracranial infection has been reported in severely immunocompromised humans.^3,5,19,35,36 In such cases, multiple intracranial masses were found during imaging and diagnosed by biopsies. Mass lesions were not found in other visceral organs. Granulomatous encephalomyelitis with M. genavense infection has been reported in a spectacled Amazon parrot.⁹ The parrot exhibited infection of the CNS with perivascular inflammation. The present study shows that M. genavense infection causes severe lesions in the CNS of degus without significantly affecting other visceral organs. In the present study, spinal cord necrosis with infiltration of macrophages and neutrophils was observed around the blood vessels. Ziehl-Neelsen staining and M. tuberculosis antigen-positive bacilli were detected in macrophages and neutrophils. The animals were in fair to good body condition, which may be associated with the localized lesions in the CNS and that other visceral organs were spared. The perivascular distribution of the lesions suggests a hematogenous invasion of the bacteria. The hematogenous route of infection has also been suggested in the parrot with CNS M. genavense infection and other CNS mycobacterial infections in cattle and humans.^9,17,26 In addition to immune cells and endothelial cells, experimental infection studies suggested mycobacterium could infect neurons and astrocytes.^10,29 In the present study, mycobacterium was not detected within neurons and astrocytes by double-labeled immunofluorescence.

An in vivo study utilizing CD18 leukocyte adhesion deficient mice suggested that free mycobacteria may traverse the blood–brain barrier independent of leukocytes or macrophages.³⁸ In addition, in vitro studies demonstrated that free mycobacterium invades brain microvascular endothelial cells.^2,15 In the present cases, mycobacterium antigens were detected in endothelial cells by immunohistochemistry. However, we could not confirm it by double-labeling immunofluorescence using endothelial cell markers, such as CD31 and von Willebrand factor, due to the lack of cross-reactive primary antibodies for these samples.

Nontuberculous mycobacteria have been isolated from tap water and feces of both healthy and diseased birds, which acted as reservoirs.^{1,16,20,23,24,30} Furthermore, the presence of M. genavense DNA in the feces of birds has been reported.¹ In the present cases, the degus and birds were kept in the same room, and the degus’ cages were under the cages of birds. Although the route of infection and M. genavense reservoir in this facility have not been clarified, we suspect that the degus inhaled bird feces containing M. genavense, which caused pulmonary infection, and then M. genavense invaded the blood vessels and spread to the CNS.

In addition to the present report, M. genavense infection has been reported in other mammals, such as chinchilla, ferrets, a dwarf rabbit, a guinea pig, and a grizzled giant squirrel.^{14,21,22,25,34} In contrast to M. genavense infection in other mammals,^{14,21,22,25,34} the present cases showed neurological signs and were part of a multi-animal disease outbreak. Immunosuppression can be responsible for the unusual CNS presentation.^{2,3,6,15,17,19} Although there was no evidence of immunosuppression in the animals examined, immune competence assessments such as blood tests and bone marrow examinations are necessary for more definitive evaluation of the immune status, but were not available in this study. Degus may be susceptible to developing CNS lesions from M. genavense infection, which has not been described in other animal species. The present report describes an outbreak of M. genavense in degus at a breeding facility. Exposure of animals in research settings to other species that can be carriers of infectious diseases should be prevented. This study highlighted the importance of good hygenic conditions in a confined environment for public health.

Supplemental Material

sj-pdf-1-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental material, sj-pdf-1-vet-10.1177_03009858231179094 for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus) by Tatsuhito Ii, James K. Chambers, Mizuho Uneyama, Ayumi Sumi, Yutaro Nakayama, Nanae Tsurita, Yasutsugu Miwa and Kazuyuki Uchida in Veterinary Pathology

Supplemental Material

sj-xlsx-2-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental material, sj-xlsx-2-vet-10.1177_03009858231179094 for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus) by Tatsuhito Ii, James K. Chambers, Mizuho Uneyama, Ayumi Sumi, Yutaro Nakayama, Nanae Tsurita, Yasutsugu Miwa and Kazuyuki Uchida in Veterinary Pathology

Supplemental Material

sj-xlsx-3-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental material, sj-xlsx-3-vet-10.1177_03009858231179094 for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus) by Tatsuhito Ii, James K. Chambers, Mizuho Uneyama, Ayumi Sumi, Yutaro Nakayama, Nanae Tsurita, Yasutsugu Miwa and Kazuyuki Uchida in Veterinary Pathology

Supplemental Material

sj-xlsx-4-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental material, sj-xlsx-4-vet-10.1177_03009858231179094 for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus) by Tatsuhito Ii, James K. Chambers, Mizuho Uneyama, Ayumi Sumi, Yutaro Nakayama, Nanae Tsurita, Yasutsugu Miwa and Kazuyuki Uchida in Veterinary Pathology

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iDs

Tatsuhito Ii

James K. Chambers

Supplemental Material for this article is available online.

References

Babacan

Baş

Sareyyüpoğlu

. PCR detection of Mycobacterium genevanse DNA in fecal samples of caged birds. Veteriner Fakültesi Dergisi. 2020;67:201–204.

Kim

Bishai

, et al. Pathogenesis of central nervous system tuberculosis. Curr Mol Med. 2009;9(2):94–99.

Berman

Kim

Haghighat

, et al. Mycobacterium genavense infection presenting as a solitary brain mass in a patient with AIDS: case report and review. Clin Infect Dis. 1994;19(6):1152–1154.

Böttcher

Paar

Wittenbrink

, et al. Mycobacterium genavense infection as a cause of disseminated granulomatous inflammation in a horse. J Equine Vet Sci. 2016;39:76–79.

Böttger

Hirschel

Coyle

. Mycobacterium genavense sp. nov. Int J Syst Bacteriol. 1993;43(4):841–843.

Charles

Lortholary

Dechartres

, et al. Mycobacterium genavense infections: a retrospective multicenter study in France, 1996-2007. Medicine (Baltimore). 2011;90(4):223–230.

Ferrer

Ramis

Fernández

, et al. Granulomatous dermatitis caused by Mycobacterium genavense in two psittacine birds. Vet Dermatol. 1997;8(3):213–219.

Fyfe

McCowan

O’Brien

, et al. Molecular characterization of a novel fastidious mycobacterium causing lepromatous lesions of the skin, subcutis, cornea, and conjunctiva of cats living in Victoria, Australia. J Clin Microbiol. 2008;46(2):618–626.

Gomez

Saggese

Weeks

, et al. Granulomatous encephalomyelitis and intestinal ganglionitis in a spectacled Amazon parrot (Amazona albifrons) infected with Mycobacterium genavense. J Comp Pathol. 2011;144(2–3):219–222.

10.

Harris

Nuttall

Elkington

, et al. Monocyte-astrocyte networks regulate matrix metalloproteinase gene expression and secretion in central nervous system tuberculosis in vitro and in vivo. J Immunol. 2007;178(2):1199–1207.

11.

Hoop

Böttger

Ossent

, et al. Mycobacteriosis due to Mycobacterium genavense in six pet birds. J Clin Microbiol. 1993;31(4):990–993.

12.

Hoop

Böttger

Pfyffer

. Etiological agents of mycobacterioses in pet birds between 1986 and 1995. J Clin Microbiol. 1996;34(4):991–992.

13.

Hughes

Ball

Love

, et al. Disseminated Mycobacterium genavense infection in a FIV-positive cat. J Feline Med Surg. 1999;1(1):23–29.

14.

Huynh

Pingret

Nicolier

. Disseminated Mycobacterium genavense infection in a chinchilla (Chinchilla lanigera). J Comp Pathol. 2014;151(1):122–125.

15.

Jain

Paul-Satyaseela

Lamichhane

, et al. Mycobacterium tuberculosis invasion and traversal across an in vitro human blood-brain barrier as a pathogenic mechanism for central nervous system tuberculosis. J Infect Dis. 2006;193(9):1287–1295.

16.

Kanamori

Weber

Rutala

. Healthcare outbreaks associated with a water reservoir and infection prevention strategies. Clin Infect Dis. 2016;62(11):1423–1435.

17.

Katti

. Pathogenesis, diagnosis, treatment, and outcome aspects of cerebral tuberculosis. Med Sci Monit. 2004;10(9):RA215–RA229.

18.

Kiehn

Hoefer

Bottger

, et al. Mycobacterium genavense infections in pet animals. J Clin Microbiol. 1996;34(7):1840–1842.

19.

Kuczynski

Krajden

Spears

, et al. Mycobacterium genavense central nervous system infection in a patient with AIDS. Can J Neurol Sci. 2023;50:305–307.

20.

Ledwoń

Szeleszczuk

Zwolska

, et al. Occurrence of Mycobacterium in the feces of parrots kept in zoological gardens and private aviaries in Poland. Bull Vet Inst Pulawy. 2008;52:341–346.

21.

Lucas

Furber

, et al. Mycobacterium genavense infection in two aged ferrets with conjunctival lesions. Aust Vet J. 2000;78(10):685–689.

22.

Ludwig

Reischl

Janik

, et al. Granulomatous pneumonia caused by Mycobacterium genavense in a dwarf rabbit (Oryctolagus cuniculus). Vet Pathol. 2009;46(5):1000–1002.

23.

Mahmood

Ajmal

Abu Saleh

, et al. Mycobacterium genavense infections in non-HIV immunocompromised hosts: a systematic review. Infect Dis (Lond). 2018;50(5):329–339.

24.

Manarolla

Liandris

Pisoni

, et al. Mycobacterium genavense and avian polyomavirus co-infection in a European goldfinch (Carduelis carduelis). Avian Pathol. 2007;36(5):423–426.

25.

Minich

Agrawal

Kania

, et al. Disseminated Mycobacterium genavense infection in a guinea pig (Cavia porcellus): a case report. Vet Res. 2022;18(1):93–94.

26.

Oruç

. Meningoencephalitis tuberculosa in a holstein cow. Vet Pathol. 2005;42(6):856–858.

27.

Palmieri

Roy

Dhillon

, et al. Avian mycobacteriosis in psittacines: a retrospective study of 123 cases. J Comp Pathol. 2013;148(2–3):126–138.

28.

Portaels

Realini

Bauwens

, et al. Mycobacteriosis caused by Mycobacterium genavense in birds kept in a zoo: 11-year survey. J Clin Microbiol. 1996;34(2):319–323.

29.

Randall

Hsu

Lang

, et al. Neurons are host cells for Mycobacterium tuberculosis. Infect Immun. 2014;82(5):1880–1890.

30.

Schmitz

Korbel

Thiel

, et al. High prevalence of Mycobacterium genavense within flocks of pet birds. Vet Microbiol. 2018;218:40–44.

31.

Schmitz

Rinder

Thiel

, et al. Retrospective evaluation of clinical signs and gross pathologic findings in birds infected with Mycobacterium genavense. J Avian Med Surg. 2018;32(3):194–204.

32.

Solomon

Johncilla

Hornick

, et al. The utility of immunohistochemistry in mycobacterial infection: a proposal for multimodality testing. Am J Surg Pathol. 2017;41(10):1364–1370.

33.

Suzuki

Tate

Ikeda

, et al. A novel multicolor immunofluorescence method using heat treatment. Acta Med Okayama. 2005;59(4):145–151.

34.

Theuss

Aupperle

Eulenberger

, et al. Disseminated infection with Mycobacterium genavense in a grizzled giant squirrel (Ratufa macroura) associated with the isolation of an unknown Mycobacterium. J Comp Pathol. 2010;143(2–3):195–198.

35.

Toussi

Goodarzi

Kulubya

, et al. Mycobacterium genavense granuloma mimicking a brain tumor: a case report. Cureus. 2017;9(8):e1547.

36.

Uchino

Terasaka

Yamaguchi

, et al. Multiple infectious intracranial lesions of Mycobacterium genavense in an immunocompromised patient. Brain Nerve. 2011;63(1):79–83.

37.

Witte

Fowler

Pfeiffer

, et al. Social network analysis and whole-genome sequencing to evaluate disease transmission in a large, dynamic population: a study of avian mycobacteriosis in zoo birds. PLoS ONE. 2021;16(6):e0252152.

38.

Kolonoski

Chang

, et al. Invasion of the brain and chronic central nervous system infection after systemic Mycobacterium avium complex infection in mice. Infect Immun. 2000;68(5):2979–2984.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.14 MB

0.02 MB

0.06 MB

Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus ( Octodon degus )

Abstract

Keywords

Materials and Methods

Cases and Pathological Examinations

Immunohistochemistry

Double-Labeling Immunofluorescence

Polymerase Chain Reaction and Sequencing

Results

Gross and Histological Finding

Immunohistochemistry and Double-Labeling Immunofluorescence

Polymerase Chain Reaction

Discussion

Supplemental Material

sj-pdf-1-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental Material

sj-xlsx-2-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental Material

sj-xlsx-3-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Supplemental Material

sj-xlsx-4-vet-10.1177_03009858231179094 – Supplemental material for Central nervous system mycobacteriosis caused by Mycobacterium genavense in degus (Octodon degus)

Footnotes

Declaration of Conflicting Interests

Funding

ORCID iDs

References

Supplementary Material