Abstract
The MUC 6 mucin cDNA was isolated from a human stomach cDNA library and has been shown to be expressed in a number of other tissues in the gastrointestinal tract, including the gallbladder, pancreas, and parts of the ileum and colon. Here we establish that MUC 6 is expressed transiently in the nephrogenic zone of the kidney in the early mid-trimester of development. MUC 6 transcripts were detected in the epithelium of ureteric buds at 13 weeks and at lower levels from 17 to 23 weeks of gestation. Traces of MUC 6 mRNA were seen in the collecting ducts but not elsewhere in the developing kidney, and MUC 6 glycoprotein was detected in the epithelium of ureteric buds and collecting ducts. MUC 6 transcripts were absent from adult kidney. This pattern of expression of MUC 6 in the developing kidney suggests a role in epithelial organogenesis. MUC 6 transcripts were also present at low levels in mid-trimester epididymal epithelium.
Keywords
T
The MUC 6 cDNA was isolated by expression cloning from a human stomach library (Toribara et al. 1993; Ho et al. 1995). A full-length cDNA has not been obtained. It appears to be at least 15-16 KB long and contains a serine- and threonine-rich tandem repeat sequence with an individual repeat unit of 507 BP and 169 amino acids. The gene was initially reported to be expressed at the highest level in the stomach and gallbladder, with weaker expression in the terminal ileum and right colon and in the endocervix (Toribara et al. 1993; De Bolos et al. 1995; Ho et al. 1995). All previous MUC 6 expression studies have used Northern blot analysis of RNA extracted from tissues or immu-nocytochemistry. We used mRNA in situ hybridization to detect MUC 6 mRNA in a variety of tissues through fetal development and showed protein expression by immunocytochemistry in the pancreas (Chambers et al. 1994; Reid et al. 1997a,1997b; Reid and Harris 1998). Our results confirmed the expression of MUC 6 in the stomach and small intestine and also detected high levels of MUC 6 mRNA in the pancreas (Reid et al. 1997b; Reid and Harris 1998). Another important novel finding was the pattern of expression of MUC 6 in the kidney that is reported here. We have detected MUC 6 mRNA in the nephrogenic zone of the kidney at 13 weeks of gestation, followed by reduced expression levels through 17 to 23 weeks. MUC 6 expression is not seen in adult kidney. These observations are of particular interest in terms of epithelial differentiation because it is known that a number of genes are expressed in the tips of ureteric branches at this gestational age (Woolf et al. 1995; Kispert et al. 1996) and that normal kidney development is dependent on co-expression of proteoglycans (PGs) in the adjacent mesenchyme at this stage. In addition, we have detected low levels of MUC 6 expression in the epithelium of the epididymis during the mid-trimester of gestation.
Materials and Methods
Tissues from mid-trimester terminations were obtained with local ethical committee approval and age was determined on the basis of foot length. Data presented here are derived from two female fetuses aged 17 and 23 weeks and four male fetuses aged 13, 16.5, 18, and 19.5 weeks. Adult kidney was normal tissue obtained from a 65-year-old man undergoing nephrectomy for a renal tumor. Tissues for in situ hybridization were fixed directly in 4% paraformaldehyde (pH 9.5) overnight at 4C, embedded, and frozen in liquid nitrogen before cutting 10-μm sections. Frozen sections were mounted on Vectabond-treated slides (Vector Laboratories; Burlingame, CA) and stored dessicated at —20C until used.
In Situ Hybridization
In situ hybridization was carried out as described previously (Chambers et al. 1994). The following probes were used: for MUC 6, a 74-BP double-stranded oligonucleotide GGTCCACACACACAGCCCCACCAGTGACGCCGACCACCA GTGGGACGAGCCAAGCCGCGAGCTCATTCAGCACA) (bases 308-381, EMBL Accession number LO7517) with additional bases to enable direct cloning into the Bam HI and Hind III sites of pBluescript. Antisense and sense MUC 6 35 S-labeled riboprobes were generated from the T7 and T3 promoters, respectively. Purified probes were diluted to 5 × 106 −2 × 107 cpm/ml in a hybridization solution containing formamide (final concentration 60-65%), 1 × Denhardt's solution, 10% dextran sulfate, 0.5 mg/ml RNase-free tRNA, and 10 mM DTT. The vascular endothelial growth factor (VEGF) probe was a genomic DNA fragment (bases 2280–2502, EMBL Accession number M63791) (Gleadle et al. 1995).

Expression of MUC 6 mRNA in 13-week (A,B) and 17-week (C-E) fetal kidney. (A,C) Brightfield views of kidney sections hybridized with the MUC 6 antisense probe; (B,D) Darkfield images of A and C, respectively. (E) Darkfield view of a section consecutive to that shown in D, hybridized with the MUC 6 sense negative control probe. Bar = 200 μm.
Tissue sections were digested with 10 μg/ml proteinase K for 2 min at 37C, then treated with 25 mM acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min at room temperature (RT), briefly rinsed in 2 × SSC before rapid dehydration through a graded ethanol series, and air-dried. As a control for nonspecific binding of the antisense probe, some sections were treated with 20 μg/ml RNase A for 15 min at RT before incubation with proteinase K.
Hybridization was done overnight at 55-60C. After hybridization, slides were washed four times in 4 × SSC at RT and digested with RNase A for 30 min at 37C. Sections were washed at a final stringency of 0.1 × SSC at 60C or 70C for 30 min and dehydrated. Slides were exposed to Kodak Nuclear Tracking (NTB-2) liquid emulsion for 10-14 days at 4C. The slides were developed, fixed, and counterstained with hematoxylin and eosin. MUC 6 mRNA expression is seen as black dots on brightfield sections and as white dots on darkfield sections.
Immunocytochemistry
Sections 6 μm thick were cut from equivalent paraformaldehyde-fixed frozen tissues that were used for in situ hybridization experiments. Sections were rehydrated in PBS and then treated with 0.225% H2O2 in 80% methanol for 20 min. Sections were subsequently exposed to (a) 1:3000 diluted M6P (anti-MUC 6) chicken antipeptide polyclonal serum, preimmune serum or PBS for 1 hr, (b) 1:1000 diluted peroxidase-conjugated rabbit anti-chicken immunoglobulins for 1 hr, and (c) biotinylated swine anti-rabbit immunoglobulins for 1 hr. The M6P antibody recognizes a 23-amino-acid synthetic peptide (KPPFTTHSPPTGSSPFSSTGPMT) located within the 169-amino-acid tandem repeat unit of the MUC 6 mucin. Preabsorption of the M6P antibody with MUC 6 synthetic peptide largely abolished its reactivity. Peroxidase label was then visualized with the StreptABC complex/HRP kit (Dako; Glostrup, Denmark) according to the manufacturer's instructions. Tissue sections were stained with hematoxylin.
Results
MUC 6 expression was analyzed in the kidney at 13, 15, 17, 18, and 23 weeks of gestation, and in the epididymis at 16.5, 18, and 19.5 weeks.
Expression of MUC 6 in the Kidney
In the kidney, MUC 6 mRNA was detected in the ureteric bud epithelium at 13 weeks of gestation (Figures 1A and 1B) and at lower levels in the epithelium of some collecting ducts. By 17 weeks of gestation the pattern of expression of MUC 6 was rather more diffuse with transcripts detectable in the epithelium of ureteric buds and collecting ducts, although with a less clear differential distribution (Figures 1C–1E). The pattern of expression of MUC 6 at 23 weeks of gestation was similar to that seen at 17 weeks, again with most mRNA being present in the ureteric buds (not shown). Figure 2 shows MUC 6 glycoprotein in the epithelium of the ureteric buds and collecting ducts in 15-week (Figures 2A and 2C) and 18-week fetal kidney (Figure 2D).

Immunoperoxidase detection of MUC 6 glycoprotein in 15-week (A-C) and 18-week (D,E) fetal kidney. Arrows denote MUC 6 glycoprotein. A,C, and D are with M6P antibody; B and E are without M6P. Bars: A,B = 200 μm; C-E = 100 μm.

Expression of MUC 6 mRNA in 18-week epididymis. (A) Brightfield view of a genital duct section hybridized with the MUC 6 antisense probe; (B) darkfield image of the same section. (C) Dark-field view of a consecutive section hybridized with the MUC 6 sense negative control probe. Bar = 200 μm.
In adult kidney, no MUC 6 expression was seen, although the integrity of RNA within the tissue was confirmed with a cDNA probe for vascular endothelial growth factor (VEGF)/vascular permeability factor. VEGF mRNA expression in the adult kidney sections was localized to glomeruli (not shown), as shown in a previous report (Brown et al. 1992).
Expression of MUC 6 in Male Genital Ducts
Low levels of MUC 6 mRNA were detected in the epithelium of the epididymis at 16.5, 18 (Figure 3), and 19.5 weeks. No MUC 6 expression was detected elsewhere in the testis at any gestational age examined.
Discussion
Mucins are known to have a primary role in lubricating and protecting epithelial surfaces. It has also been suggested that they may be involved in epithelial organogenesis, primarily because of the predicted functions of the MUC 1 mucin (Lan et al. 1990; Spicer et al. 1995). We reported previously expression of the MUC 1 mucin gene in developing human kidney (Chambers et al. 1994) but have not seen transcripts of any other mucin gene in human kidney through gestation (Chambers et al. 1994; and our unpublished data). MUC 1 mRNA was detected in the epithelium of the collecting ducts by 12.5 weeks of gestation. The pattern and level of expression remained constant through development to term. In contrast, we have detected expression of the MUC 6 gene in the epithelium of collecting ducts in the nephrogenic zone of the kidney. MUC 6 mRNA was detected at the highest levels in the tips of the ureteric buds with only traces of mRNA elsewhere in the collecting ducts. This may be of significance because the pattern of expression of MUC 6 is coincident with other genes that are known to be involved in signaling between the collecting duct epithelium and the surrounding mesenchyme. This signaling is believed to be central to the development and differentation of the kidney collecting duct system. Further investigation of the role of the MUC 6 mucin is warranted to elucidate its role in kidney development. One possible mechanism of action would be direct interaction of the MUC 6 mucin in epithelial/mesenchymal signaling. Alternatively, the MUC 6 mucin molecule might be playing a physical role in duct genesis through extracellular mechanisms in the duct lumen.
The detection of MUC 6 mucin gene expression in the epididymal epithelium is also of interest. The maturation of sperm and their passage from the testis through the male genital duct system is dependent on the secretion of fluids, salts, and maturation factors from the epididymal epithelium. Among diseases associated with male genital duct obstruction or absence is cystic fibrosis (CF). In CF males, although often anatomically normal during the mid-trimester of human gestation, the male genital ducts become either obstructed or destroyed later in gestation, resulting in male infertility. The pathology of CF in many organ systems involves a failure to clear mucous secretions. We have previously examined the developmental expression all nine mucin genes in the human male genital duct system and have established that MUC 6 is the only mucin gene that is expressed in this tissue during prenatal development. This observation is of importance because it identifies the appropriate gene product to analyze in order to elucidate the biochemical cause of mucin deposition in the CF male genital duct system.
Footnotes
Acknowledgments
Supported by the Cystic Fibrosis Research Trust and grant DK46589 from the National Institutes of Health.
We thank Drs David Cranston, Stephen Gould, Christopher Pugh, and Patrick Maxwell for their assistance, and Dr Sam Ho for the M6P antibody.
