Sage Journals: Discover world-class research

Abstract

Brain ischemia triggers an inflammatory reaction that progresses for days to weeks and seems to have a role in secondary progression of injury. Inflammation induces a complex pattern of signaling molecules with partly contradictory actions, and the responses may be different in the immature and adult brain. The authors characterized the global inflammatory gene expression in the developing brain as a first step toward understanding the protective and deleterious effects of inflammation after hypoxia-ischemia. Oligonucleotide arrays were used to investigate inflammatory genes in cortex, hippocampus, thalamus, and striatum at 2, 8, 24, and 72 hours after hypoxia-ischemia, which was induced in 9-day-old mice by left carotid artery ligation followed by hypoxia. After hypoxia-ischemia, 148 inflammatory genes were differentially expressed. More than 97% of the genes were upregulated and 93% had not previously been reported after hypoxia-ischemia in the immature brain. The results indicate that microglia/macrophages, T-and B-cells, NK-cells, mast cells, dendritic cells, and polymorphonuclear leukocytes may participate in the response to hypoxia-ischemia. In addition, novel cytokines/chemokines, complement-related, interferon-regulated, components of the TIR/nuclear factor-κB pathway, and a number of immunomodulatory genes were induced. Several of these genes may be of pathophysiologic significance after neonatal hypoxia-ischemia.

Keywords

Microarray Hypoxia-ischemia Immature Brain Inflammation Microglia

Inflammation is a complex process involving hundreds of signaling molecules that can arise in any tissue in response to, for example, trauma, infections, and ischemia. The initial proinflammatory phase, which may be tissue damaging, involves the recruitment and activation of diverse immune cells and their interactions with parenchymal cells. Later on in the inflammatory process, a crucial commitment converts the proinflammatory phase into an anti-inflammatory phase, promoting tissue repair and recovery (Nathan, 2002). The molecular phenotype of the immune response in CNS diseases is largely uncharacterized, but brain ischemia triggers an inflammatory reaction that progresses from days to weeks and is believed to contribute to the secondary progression of ischemic injury. Several different mediators participate in the inflammatory reaction, such as chemokines and cytokines, which are induced after ischemia in the adult and neonatal brain (Barone and Feuerstein, 1999; Bona et al., 1999; Cowell et al., 2002; Hagberg et al., 1996; Hedtjarn et al., 2002; Ivacko et al., 1997; Szaflarski et al., 1995). In addition, other inflammatory proteins, such as adhesion molecules (Frijns and Kappelle, 2002), and the activity of inducible nitric oxide synthase (Forster et al., 1999) and cyclooxygenase-2 (Nogawa et al., 1997), are also increased after ischemia.

The involvement of inflammatory mediators in the progression of ischemic injury has been shown by several studies in which neuroprotection was achieved by intervening with their functions. In the adult brain, inhibition of interleukin-1 (Loddick and Rothwell, 1996; Relton and Rothwell, 1992), tumor necrosis factor (TNF)-α (Yang et al., 1998), adhesion molecules (Connolly et al., 1997; Connolly et al., 1996; Zhang et al., 1994), and depletion of leukocytes (Heinel et al., 1994) have proven to be protective strategies after ischemia. In the neonatal brain, mice deficient in caspase-1 (Liu et al., 1999) or interleukin-18 (Hedtjarn et al., 2002) showed reduced injury after hypoxia-ischemia (HI), and inhibition of interleukin-1 by administration of interleukin-1ra decreased CNS vulnerability to HI (Hagberg et al., 1996; Martin et al., 1994).

Despite these findings, no anti-inflammatory drug has been shown to improve outcome after brain ischemia in humans (Brott and Bogousslavsky, 2000). To find efficient neuroprotective strategies based on modulation of the inflammatory response, it is important to gain a better understanding of the underlying molecular mechanisms. Inflammation is a double-edged sword in the sense that it confers both protective and deleterious effects. It is therefore necessary to characterize the molecular signals that sequentially regulate the various components of the pro- and anti-inflammatory responses, as well as the mediators responsible for repair and restitution.

Microarray analyses are useful in studying the expression of many genes in one sample, but are especially useful for studying genes involved in inflammation because the protein expression of most of the mediators involved in immune-inflammatory processes is preceded by de novo transcription. Several microarray analyses have been performed to study the gene expression after ischemic brain injury (Kim et al., 2002; Lu et al., 2003; Schmidt-Kastner et al., 2002; Tang et al., 2002), but none has focused on the inflammatory response, and in the various studies only a limited number of novel genes have been reported.

In this study, microarray analyses were performed in those regions of the gray matter where injury develops after neonatal HI (cortex, hippocampus, thalamus, and striatum), at 2, 8, 24, and 72 hours after HI, to better understand the complex nature of the inflammatory response that arises in the immature brain after HI.

In total, 148 genes belonging to the immune-inflammatory system were differentially expressed after HI. In addition to the inflammatory genes, 343 genes belonging to other functional categories were differentially expressed after neonatal HI, and are presented in our companion article in this issue. Of the inflammatory genes, 70% were previously unreported after ischemia and 93% had not been reported after HI in the immature brain.

MATERIALS AND METHODS

The methods used for neonatal HI, RNA preparation, GeneChip analysis, significance analysis of microarrays, and database searching is described in detail in our companion article.

Real-time polymerase chain reaction

The microarray data for nine genes were confirmed by real-time polymerase chain reaction (PCR), using a Light Cycler (Roche) as described in our companion article. The following primer pairs (from CyberGene AB, Huddinge, Sweden), annealing temperatures, and elongation times were used: CD44: forward: 5′-AATTCCGAGGATTCATCCCA-3′, reverse: 5′-CGCTGCTGACATCGTCATC-3′, 57°C, 12 seconds; glycoprotein 49A (gp49A): forward: 5′-TGTTCTGGATGCTGTTGCTC-3′, reverse: 5′-TGTTCAGCTCTGCATTGTCC-3′, 57°C, 13 seconds; GAPDH: forward: 5′-CATCACCATCTTCCAGGAGCG-3′, reverse: 5′-GAGGGGCCATCCACAGTCTTC-3′, 58°C, 15 seconds; lysozyme M: forward: 5′-CTGCTTATAGGAGACCAGT-3′, reverse: 5′-ACATCCTCTCAAGGGTT-3′, 55°C, 11 seconds; large multifunctional protease 7: forward: 5′-CGGGACAGATGTTTTCCACT-3′, reverse: 5′-CGGAACTCTCCACTTTCACC-3′, 57°C, 9 seconds; MCP-5: forward: 5′-AGCTTTCATTTCGAAGTCTTTG-3′, reverse: 5′-CTCCTTATCCAGTATGGTCC-3′, 56°C, 10 seconds; osteopontin: forward: 5′-ACACTTTCACTCCAATCGTCC-3′, reverse: 5′-TGCCCTTTCCGTTGTTGTCC, 58°C, 10 seconds; MIP-1 gamma: forward: 5′-TCACAACCACGGACCTACAA-3′, reverse: CTCCAGACCTTGCCCATTTA, 57°C, 12 seconds, oncostatin receptor: forward: 5′-GATGTACCCACTAAGCCGCC-3′, reverse: 5′-GAGGACCGTTGAGGTCAAGC-3′, 56°C, 17 seconds; SOCS-3: forward: 5′-TGGAGGGTTCTGCTTTGTCT-3′, reverse: 5′-GCCAATGTCTTCCCAGTGTT-3′, 57°C, 9 seconds.

Immunohistochemistry

Pups were deeply anesthetized by intraperitoneal injection of 150 μL Pentothal (50 mg/mL) and perfused intracardially with 0.9% NaCl followed by 5% buffered formaldehyde (Histofix, Histolab, Göteborg, Sweden) at 3, 10, 24, and 72 hours after HI (n = 5 at each time point). Control pups were killed at postnatal day (PND) 9, 10, and 12 (n = 3), and brains were prepared and immunohistochemistry performed as described elsewhere (Hedtjarn et al., 2002). The following primary antibodies, dilutions, and incubation times were used: rabbit anti–mouse osteopontin (O-17, IBL, Gunma, Japan; 1:400 in phosphate-buffered saline [PBS], overnight at 4°C), rabbit anti–human lysozyme (A48, Biomeda (Foster City, CA, U.S.A.); 1:1,000 in PBS, overnight at 4°C), and goat anti-GP49 (N-20; Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.; 1:400 in PBS, overnight at 4°C). Before immunohistochemical staining, sections were deparaffinized and boiled in citric acid buffer (0.01 mol/L, pH 6.0, 10 minutes). For lysozyme and GP49 staining, sections were also treated with proteinase K (10 μg/mL in PBS, 7 minutes; Roche-Boehringer Mannheim, Indianapolis, IN, U.S.A.). For double-labeling experiments, Alexa-Fluor 488 or 594 streptavidin (4 μg/mL in PBS; Molecular Probes, Eugene, OR, U.S.A.) was used after incubation with biotinylated secondary antibody, or secondary antibodies directly conjugated to Alexa-Fluor 488 or 594 (5 μg/mL in PBS) were used. Microglia were detected using FITC-labeled Isolectin B₄ (10 μg/mL in PBS, 1 hour, L-2895; Sigma, St. Louis, MO, U.S.A.). Preabsorption of the different antibodies with a 100x excess of the corresponding proteins/peptides (recombinant osteopontin 441-OP/CF from R&D Systems, Inc., Minneapolis, MN, U.S.A. gp49 (N-20) blocking peptide, from Santa Cruz Biotechnology; Lysozyme L-8402, from Sigma) was performed to control for the specificity of the different antibodies. The preabsorption resulted in omitted immunohistochemical stainings for the different antibodies used.

RESULTS

Hypoxia-ischemia in the immature brain induced the expression of a significant number of genes related to the immune-inflammatory response. In total, 148 genes and expressed sequence tags (ESTs) were differentially expressed 2 to 72 hours after HI, using the previously described criteria (false discovery rate < 10%, fold change at least 1.5, and significant change when comparing the ipsilateral hemisphere with the contralateral hemisphere and with the appropriate control). Of the differentially expressed inflammatory genes and ESTs, as many as 144 were upregulated and only four were downregulated. At 2 hours after HI only three genes were upregulated, but at 8 hours after the injury the number of significantly upregulated genes had increased to 49. At 24 hours after HI 77 genes were upregulated, and at 72 hours after HI as many as 119 genes were upregulated. Of the downregulated genes, one was found at 24 hours and three at 72 hours after HI. By searching PubMed and investigating all previous articles concerning changes in gene expression after ischemia, it was estimated that 103 (70%) of the 148 regulated genes had not previously been reported after cerebral ischemia, and 137 (93%) of the genes had not previously been reported after ischemia in the immature brain. The percentage of upregulated genes in different functional categories, and the total number of upregulated genes at each time point is shown in Figure 1.

Fig. 1.

(A) Proportion of upregulated genes after HI in each functional category. (B) Total number of upregulated genes in each category at the different time points after HI.

Real-time polymerase chain reaction

The expression of the nine genes chosen for confirmation by PCR—MCP-5, osteopontin, lysozyme M, lmp7, oncostatin receptor, MIP-1 gamma, SOCS-3, CD44, and glycoprotein 49A—was significantly increased even when using this method (Fig. 2), indicating that there is a good agreement between the microarray analysis and real-time PCR. Not only were all genes upregulated, but the “fold change,” when comparing ipsilateral with contralateral hemisphere, was similar between PCR and microarray in that the genes with the highest fold change on the microarray analysis also had the highest fold change with PCR. However, the levels of expression were sometimes increased to an even higher extent using PCR (e.g., osteopontin and gp49A), indicating that real-time PCR is even more sensitive than microarray analysis.

Fig. 2.

Confirmation of upregulated genes by real-time PCR. In the left column the results from the microarray analysis are shown, and the right column displays the PCR results for the same genes. Error bars indicate ± SD; ^**P < 0.01 and ^*P< 0.05 versus contralateral hemisphere using (Mann-Whitney U-test). I, ipsilateral hemisphere; C, contralateral hemisphere; PND9, control at postnatal day 9; n = 5 in each group.

Immunohistochemistry

Glycoprotein 49. The antibody used against glycoprotein 49 (gp49) detects both gp49A and gp49B, so it cannot be distinguished from the stainings which of the isoforms are expressed at the different time points investigated. However, the gene-expression data from the microarray and the PCR tell us that both isoforms are expressed after HI, although the expression of gp49A seems to precede that of gp49B. At 3 and 10 hours after HI, no protein expression of gp49 was found in either ipsilateral or contralateral hemisphere. At 24 hours after HI, there was a tremendous increase in gp49 expression in the ipsilateral hemisphere in the area of tissue injury (i.e., in the cortex, hippocampus, thalamus, and striatum), whereas with the exception of a few cells in the white matter, the contralateral hemisphere showed no immunoreactivity for gp49. Three days after the injury, even more cells in the injured part of the brain showed immunoreactivity for gp49 (Fig. 3A). The cells expressing gp49 were identified as microglia with double-labeling immunofluorescence (Figs. 4A–4C). Brains from control animals showed no immunoreactivity for gp49.

Fig. 3.

Immunoreactivity of glycoprotein 49 (gp49), lysozyme, and osteopontin after HI. (A) Immunoreactivity for gp49 in the thalamus of the ipsilateral hemisphere 72 hours after HI. (B) Absence of gp in the thalamus of the contralateral hemisphere. (C) Cells positive for lysozyme in the cortex of the ipsilateral hemisphere 24 hours after HI. (D) Cortex of the contralateral hemisphere 24 hours after HI. (E) Immunoreactivity for osteopontin in the thalamus of the ipsilateral hemisphere 72 hours after HI. (F) Cells positive for osteopontin in the white matter of the contralateral hemisphere.

Fig. 4.

Double-labeling immunofluorescence of gp49 (A), lysozyme (D), and osteopontin (G) with isolectin (C, F, and I) after HI. In the middle row, the pictures from the left and right columns are merged. Scale bar = 50 μm.

Lysozyme. The antibody used to identify the cellular expression of lysozyme after HI is directed against human lysozyme, which means that it probably reacts with both lysozyme M and lysozyme P, which are closely related proteins with similar functions. In tissue sections, the immunoreactivity for lysozyme was detected at 24 and 72 hours in the ipsilateral hemisphere, in the cortex, thalamus, hippocampus, and striatum (Fig. 3C). Double-labeling immunofluorescence identified the cells as microglia (Figs. 4D–4F). However, the cells expressing lysozyme had a very different morphology when compared with those expressing gp49 and not all microglia were immunoreactive for lysozyme, indicating that a subpopulation of microglia with particular function express lysozyme after HI. Contralateral hemispheres and controls showed no immunoreactivity for lysozyme at any time point (Fig. 3C).

Osteopontin. Three days after HI, cells immunoreactive for osteopontin were found in the ipsilateral hemisphere; in addition, it looked like there was an extensive amount of secreted osteopontin in the whole injured part of the brain because a very punctuate staining was detected (Fig. 3E). At all time points investigated after HI and in controls, some cells in the contralateral hemisphere were also immunoreactive for osteopontin. These cells were located in the subcortical white matter (Fig. 3F). The cells expressing osteopontin exhibited a certain morphology, where immunoreactivity was mainly localized in a small part of the cytoplasm, as if osteopontin was stored in a specific vesicle (Figs. 3E and 3F). Cells expressing osteopontin were identified as microglia (Figs. 4G–4I). Except for the cells in the white matter, no immunoreactivity for osteopontin was detected at any time after HI in contralateral hemispheres or in controls.

Functional categories of differently expressed genes

The differentially expressed genes were broadly divided into nine different functional categories (Tables 1–9) based on their function and cellular expression. The genes that were already induced at 2 hours after HI belonged to the chemokine family. Otherwise, the upregulation of genes in all other functional groups started at 8 hours after HI, and the amount of upregulated genes in each category continued to increase further at 24 and 72 hours after HI in a quite similar pattern, with two exceptions. The interferon-regulated genes showed an elevated and quite stable expression from 8 to 72 hours after HI, and in the group of MHC class I– and II–related genes, only one gene was induced at 8 hours, whereas a quite extensive increase was detected at 24 and 72 hours after the injury (Fig. 1). The downregulated genes were found in the categories chemokines, “others,” and adhesion-related genes.

Chemokines

Several chemokines that are known to be induced by ischemia in both adult and immature brain, such as MIP-1 alpha, MIP-1 beta, MCP-1, and GRO, as well as some of their receptors (e.g., CCR2 and CCR5), were upregulated on the array. In addition, MCP-3, IP-10, and the chemokine receptor CX3CR1, all of which have previously been reported after ischemia in the adult but not the immature brain, were upregulated. MIP-1 gamma, MCP-5, eotaxin, and chemokinelike factor superfamily 3 were induced by HI, and have not previously been reported after ischemia in the brain (Table 1).

Complement-related genes

A number of genes involved in the complement system were induced by HI in the immature brain, none of which has previously been reported after neonatal HI. Complement component 3a receptor 1, complement component 5 receptor 1, complement component 1, q subcomponent, beta polypeptide, and complement C4 precursor have been reported after adult ischemia, but complement component 1, q subcomponent, c polypeptide, complement component 1, q subcomponent, receptor 1, and complement factor H-related protein are newly reported genes (Table 2).

Genes expressed by leukocytes

Twenty-one different genes and ESTs known to be expressed by leukocytes were induced by HI in the immature brain, and only two of them, lysozyme M and Fc gamma RIIB, have been reported after ischemia. At 8 hours after HI, an upregulation of cysteine-rich intestinal protein, glycoprotein 49A, L-plastin, cell surface glycoprotein 53, and retinoic acid–inducible E3 protein was detected, and these genes stayed upregulated until 72 hours after the injury. Ly-6A.2 and paired-Ig-like receptor A3 were transiently induced at 24 hours after HI, whereas glycoprotein 49B, lymphocyte cytosolic protein 2, TYRO protein tyrosine kinase binding protein, lysozyme P, CD52 antigen, and Fc gamma RI were induced at 24 hours and further upregulated at 72 hours after HI. At 72 hours after HI an upregulation of hemopoietic cell kinase, lymphocyte-specific protein 1, CSF-3 receptor, FcR-gamma, dedicator of cytokinesis 2, and immunoglobulin superfamily, member 7 was detected (Table 3).

Macrophage-related genes

Five macrophage-related genes were identified after HI that had not previously been reported after ischemia: capping protein gelsolin-like, macrophage metalloelastase, and natural resistance–associated macrophage protein 1 were induced 24 hours after HI and further upregulated at 72 hours, whereas macrophage scavenger receptor 1 and ADAM-8 were upregulated 72 hours after the injury. CD68 antigen, mac-2 antigen, M-CSF, and osteopontin, which previously have been reported after ischemia in the adult but not immature brain, were induced at 8 hours and stayed upregulated until 72 hours after HI; CD63 antigen was induced at 24 hours and lymphocyte antigen 71 and colony stimulating factor 1 receptor were upregulated at 72 hours. CD14 was the only gene that had previously been shown to be induced after ischemia in both adult and immature brain; its expression was upregulated at 8 hours after HI, and the levels stayed increased until 72 hours after HI (Table 4).

Genes related to B- and T-lymphocytes

Thirteen genes related to B- and T-lymphocytes were induced after HI, none of which had previously been reported after cerebral ischemia. CD72 antigen, which is important in B-cell proliferation and differentiation, was induced at 8 hours with a subsequent increase in expression at 24 and 72 hours after HI, whereas other B-cell–related genes were induced at 24 hours (e.g., Bruton agammaglobulinemia tyrosine kinase and lyn) and at 72 hours (CD22) after HI. CD45R, which is an important regulator of T- and B-cell antigen receptor signaling, and NF-ATc, a transcription factor involved in B- and T-cell activation, were induced at 8 hours after HI; vav-1 oncogene, which is involved in B- and T-cell development and activation, was induced at 24 hours after HI. Lymphocyte antigen 9, cytotoxic T-lymphocyte–associated protein 2 alpha and beta, cytoplasmic tyrosine kinase, CD48 antigen, and lymphocyte antigen 57 are other T-cell–related genes induced by neonatal HI (Table 5).

TABLE 1.

Chemokines

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
MIP-1 alpha, CCL3*	Monokine with inflammatory and chemokinetic properties, binds to ccr1, ccr4 and ccr5	J04491	0.21	0.83	0.19	1.73	0.32	0.80	0.28	0.57	0.23
MIP-1 beta, CCL4*	Monokine with inflammatory and chemokinetic properties, binds to ccr5 and to ccr8	X62502	0.07	0.32	0.11	0.88	0.12	0.32	0.07	0.11	0.05
MIP-1 gamma, CCL9	Monokine with inflammatory, pyrogenic and chemokinetic properties	U49513	0.10	0.13	0.14	2.53	0.23	1.32	0.15	0.88	0.13
MCP-1 CCL2*	Chemotactic factor that attracts monocytes and basophils, binds to ccr2 and ccr4	M19681	0.06	0.97	0.09	1.54	0.15	1.48	0.16	0.33	0.08
MCP-3, CCL7	Chemotactic factor that attracts monocytes and eosinophils, binds to ccr1, ccr2 and ccr3	X70058	0.02	0.16	0.03	0.24	0.04	0.18	0.03	0.06	0.04
MCP-5, CCL12	Potent chemoattractant for peripheral blood monocytes	U50712	0.08	0.13	0.07	0.67	0.13	0.97	0.29	0.23	0.10
Chemokine receptor ccr2*	Receptor for the MCP-1, MCP-3 and MCP-5 chemokines, detected in monocyte and macrophage cell lines	U56819	0.06	0.06	0.05	0.10	0.07	0.23	0.08	0.10	0.04
GRO1, CXCL1*	Chemotactic activity for neutrophils	J04596	0.14	0.36	0.12	0.97	0.18	0.23	0.06	0.10	0.07
Eotaxin, CCL11	Promotes the accumulation of eosinophils, binds to ccr3	U77462	0.02	0.06	0.03	0.11	0.03	0.05	0.03	0.02	0.06
IP-10, CCL10	Chemotactic for monocytes and T-lymphocytes, binds to cxcr3	M33266	0.04	0.07	0.03	0.20	0.12	0.58	0.05	0.12	0.02
Chemokine receptor CX3CR1	Receptor for fractalkine and mediates both its adhesive and migratory functions	AF074912	1.09	1.13	1.00	1.09	1.07	1.13	1.00	1.74	0.90
Neurotactin	May play a role in regulating leukocyte adhesion and migration processes at the endothelium, binds to cx3cr1	U92565	9.93	10.2	11.6	9.43	12.0	8.52	13.1	10.9	15.7
Genes from EST clusters
Chemokine receptor ccr5*	Binds to MIP-1-alpha, MIP-1-beta and rantes	AV370035	0.05	0.04	0.02	0.14	0.05	0.12	0.06	0.22	0.10
Chemokine-like factor super family 3	Unknown	AI841689	0.12	0.09	0.10	0.17	0.11	0.24	0.11	0.29	0.08

Genes previously reported to be changed after HI in the immature brain are indicated with an asterisk after the gene name. Signal average values (n = 5 at each time point) normalized against housekeeping genes are shown for control animals at postnatal day 9 (PND 9) and for all time points examined after HI (2, 8, 24, and 72 hours). Figures in bold indicate where a significant increase was detected, and underlined figures indicate where a significant decrease was detected compared with the corresponding contralateral hemisphere using the criteria described in significance of microassays analysis in the Material and Methods section of our companion article.

I, ipsilateral hemisphere; C, contralateral hemisphere.

TABLE 2.

Complement

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
Complement component 3a receptor 1	Receptor for the chemotactic and inflammatory complement anaphylatoxin C3a	U77461	0.15	0.29	0.18	0.45	0.20	0.65	0.24	0.11	0.15
Complement component 5 receptor 1	Receptor for the chemotactic and inflammatory complement anaphylatoxin C5a, stimulates chemotaxis, granule enzyme release and superoxide anion production	S46665	0.59	0.65	0.64	0.74	0.60	0.98	0.60	0.68	0.51
Complement component 1, q subcomponent, beta polypeptide	C1q associates with the proenzymes C1r and C1s to yield C1, the first component of the serum complement system, complement activation, classical pathway	M22531	0.83	1.01	0.87	1.57	1.04	2.65	1.51	6.43	1.31
Complement component 1, q subcomponent, c polypeptide	C1q associates with the proenzymes C1r and C1s to yield C1, the first component of the serum complement system, complement activation, classical pathway	X66295	2.23	2.68	2.50	2.56	2.50	4.78	2.80	11.1	2.44
Complement component 1, q subcomponent, receptor 1	Receptor for complement protein C1q, involved in ligand-mediated enhancement of phagocytosis	AF081789	0.68	0.85	0.59	0.93	0.51	1.08	0.52	1.07	0.85
Complement C4 precursor	Plays a central role in the activation of the classical pathway of the complement system, is cleaved by activated C1 into C4a anaphylatoxin and C4b	X06454	0.61	0.66	0.62	0.81	0.71	1.43	0.87	2.79	0.61
Complement factor H-related protein	Functions as a cofactor in the inactivation of C3b and also increases the rate of dissociation of the c3 convertase and the c5 convertase in the alternative complement pathway	M29009	0.14	0.15	0.11	0.18	0.16	0.16	0.11	0.26	0.13

For a detailed explanation, see the legend for Table 1.

Genes induced or regulated by interferons

Of the 12 genes in this category, only one, interferon-related developmental regulator 1, had previously been described after ischemia in the immature brain; the others were previously unreported. Several genes, including interferon-γ-induced GTPase, interferon-induced protein with tetratricopeptide repeats (Ifit) 1, guanylate nucleotide binding protein (GBP) 2 and 3, and interferon-γ-inducible protein 30, were induced at 8 hours, and all except for interferon-γ-induced GTPase remained upregulated at 72 hours after HI. Interferon-activated gene 205, Ifit-2, fragilis, and interferon-inducible protein were transiently upregulated at 24 hours, whereas interferon-inducible protein 1, Ifit-3, and interferon-induced 35-kd protein homolog were induced 72 hours after the insult (Table 6).

Major histocompatibility complex class I– and II–related genes

Several genes related to major histocompatibility complex (MHC) class I receptors, such as MHC (A.CA/J (H-2K-f) class I antigen, histocompatibility 2, K region, T region locus 17, D region locus 1, Q region locus 2, beta-2 microglobulin, Q8/9d gene, MHC class I related, and hemochromatosis were upregulated after HI. In addition, lmp-2 and lmp-7, MDR/TAP, tapasin, and tap-binding protein, which are involved in the processing and transportation of antigens for presentation in these receptors, were also induced. Ia-associated invariant chain, histocompatibility 2, class II antigen A alpha and beta1 and histocompatibility 2, class II antigen E beta, which are involved in presentation of antigens in MHC class II molecules, were also induced. All genes except for Ia-associated invariant chain were previously unreported (Table 7).

TABLE 3.

Genes expressed by leukocytes

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
Cysteine-rich intestinal protein	Zinc ion binding activity, expressed in immune cells and tissues, specificially in peritoneal macrophages and peripheral blood mononuclear cells	M13018	0.10	0.09	0.08	0.74	0.12	0.86	0.17	0.38	0.13
Glycoprotein 49A	Activating Ig-like receptor expressed on NK cells, mast cells and macrophages	M65027	0.04	0.04	0.02	0.17	0.03	0.50	0.07	0.49	0.03
Glycoprotein 49B	Inhibitory Ig-like receptor expressed on NK cells, mast cells and macrophages	U05265	0.05	0.02	0.02	0.10	0.05	0.20	0.02	0.23	0.03
L-plastin	Actin-binding protein, expressed only in hemopoietic cell lineages, seems to be involved in macrophage activation by LPS, and neutrophil mediated toxicity	D37837	0.60	0.85	0.72	0.68	0.44	1.04	0.64	1.32	0.47
Cell surface glycoprotein CD53	Member of the tetraspanin family, contributes to the transduction of CD2-generated signals in T cells and natural killer cells, expressed by B-cells, T-cells, monocytes, macrophages, neutrophils	X97227	0.12	0.19	0.12	0.49	0.15	0.52	0.23	1.77	0.28
Retinoic acid-inducible E3 protein/LAPTm5	Involved in the dynamics of lysosomal membranes, expressed in hematopoietic cells, associated with microglial activation in response to neuronal apoptosis	U29539	1.18	1.42	1.25	1.62	1.05	2.05	1.39	4.96	1.54
Lymphocyte cytosolic protein 2	Plays a positive role in promoting T cell development and activation as well as mast cell and platelet function, expressed by T- and B-cells and monocytes	U20159	0.15	0.20	0.17	0.17	0.15	0.33	0.17	0.38	0.18
DAP12	Transmembrane protein that acts as a key activating signal transduction element in NK-cells	AF024637	0.40	0.52	0.40	0.65	0.46	1.69	0.62	4.32	0.63
Lysozyme P	Antimicrobial peptide, one of the principal components of both primary and secondary granules of neutrophils and the major secretory product of macrophages	X51547	0.03	0.03	0.03	0.03	0.02	0.60	0.03	2.45	0.03
Lysozyme M	Same function as Lysozyme P	M21050	0.12	0.09	0.06	0.12	0.05	0.69	0.12	2.45	0.12
CD52 antigen	Expressed by thymocytes, T-cells, B-cells, monocytes, granulocytes	M55561	0.36	0.40	0.35	0.46	0.35	1.00	0.38	1.18	0.36
Ly-6A.2	Lymphocyte antigen, regulates CD4+ T cell proliferation and cytokine production	X04653	0.61	0.83	0.90	1.46	1.02	2.48	1.15	1.35	0.98
Paired-Ig–like receptor A3	Expressed on B-cells, mast cells, macrophages and dendritic cells	U96684	0.20	0.27	0.29	0.28	0.25	0.55	0.23	0.29	0.17
Fc receptor, IgG, high affinity I, Fc gamma RI, CD64	Binds to the Fc region of immunoglobulins gamma, early participant in Fc-dependent cell activation and in the development of immune responses, expressed mainly on mononuclear phagocytes	M31314	0.05	0.05	0.04	0.06	0.05	0.33	0.05	0.44	0.05
Hemopoietic cell kinase	Protein-tyrosine kinase, predominantly expressed in hemopoietic cell types, may serve as part of a signaling pathway coupling the fc receptor to the activation of the respiratory burst	J03023	0.40	0.33	0.31	0.40	0.28	0.48	0.39	0.48	0.31
Fc gamma RIIB, CD32	Low affinity receptor for the Fc region, involved in e.g. phagocytosis of immune complexes and modulation of antibody production by B-cells	M31312	0.04	0.03	0.03	0.07	0.05	0.13	0.07	0.29	0.06
Lymphocyte specific protein1	Expressed in B- and T-cells, macrophages and neutrophils, negatively regulates neutrophil chemotaxis and polarization	D49691	0.09	0.08	0.10	0.09	0.08	0.15	0.09	0.47	0.09
CSF-3 receptor	Receptor for CSF-3, that controls the production, differentiation, and function of granulocytes	M58288	0.06	0.08	0.07	0.07	0.07	0.07	0.06	0.14	0.06
Genes from EST clusters
FcR-gamma, CD23	Has a critical role in allowing the IgE Fc receptor to reach the cell surface	AV012229	0.03	0.03	0.03	0.04	0.03	0.03	0.04	0.17	0.03
Dedicator of cytokinesis 2	Encodes a hematopoietic cell-specific protein that is indispensable for lymphocyte chemotaxis	AW122239	0.07	0.08	0.06	0.07	0.05	0.11	0.09	0.20	0.06
Immunoglobulin superfamily, member 7	Present on the surface of monocytes, neutrophils, a proportion of peripheral blood T- and B lymphocytes and lymphocytic cell lines	AW060457	0.74	0.69	0.62	0.58	0.65	0.74	0.62	1.09	0.54

For a detailed explanation, see the legend for Table 1.

Other genes involved in immune and inflammatory responses

Several previously unreported genes were induced in this category, such as MD-1, RP105, Myd88, cyclophilin C–associated protein, lipopolysaccharide-induced TNF (involved in toll-like receptor signaling and/or lipopolysaccharide responses), oncostatin M receptor (interleukin-6–signaling pathway), p22 phox, gp91 phox and p67 phox (subunits of the NADPH oxidase of phagocytes), proteoglycan secretory granule, galectin-9, interleukin-4 receptor alpha, granulin, TNF intracellular domain–interacting protein, caveolin-1, GAPR-1, and VHSV-induced gene 1. Some genes previously reported after ischemia in the adult brain were TNF receptor superfamily member 1a, pentaxin-related gene, SOCS-3, lipocortin-1, tissue inhibitor of metalloproteinase 1, iba1, cox-1, and gp130 (Table 8).

TABLE 4.

Macrophage-related genes

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
CD68 antigen	110-kd transmembrane glycoprotein that is highly expressed by monocytes and tissue macrophages, could play a role in phagocytic activities	X68273	0.63	0.71	0.60	0.93	0.61	1.69	0.86	3.37	0.63
Mac-2 antigen	Beta-galactoside-binding protein, secreted by activated macrophages, important for phagocytic activities of macrophages	X16834	0.06	0.09	0.06	0.48	0.08	1.01	0.13	1.27	0.03
M-CSF	Cytokine that controls the production, differentiation, and function of macrophages	M21952	0.74	0.99	0.69	1.43	0.82	1.41	0.74	1.21	0.54
CD14 antigen*	Surface protein preferentially expressed on monocytes/macrophages, binds LPS and apoptotic cells, acts via myd88 and traf6, leading to nuclear factor κ-B activation, cytokine secretion, and the inflammatory response	X13333	1.00	1.25	1.11	2.12	1.15	1.81	0.91	1.45	0.85
Osteopontin	Involved in recruiting and stimulating macrophages and lymphocytes as part of a nonspecific response to microbial infections	X13986	0.33	1.54	0.47	1.88	0.41	7.34	0.70	21.6	0.52
Capping protein (actin filament), gelsolin-like	Calcium-sensitive actin binding protein, expressed by macrophages	X54511	0.11	0.15	0.10	0.25	0.08	0.61	0.17	0.80	0.15
CD63 antigen	Member of the tetraspanin family, involved in the regulation of cell development, activation, growth and motility, expressed by monocytes and macrophages	D16432	4.32	4.20	3.79	5.31	3.96	7.74	4.32	9.34	3.34
Macrophage metallo-elastase	Involved in the breakdown of extracellular matrix, tissue injury, and remodeling	M82831	0.09	0.08	0.07	0.13	0.09	0.12	0.05	0.17	0.06
Natural resistance-associated macrophage protein 1	Iron and manganese transporter involved in iron metabolism and host resistance to certain pathogens, protects the macrophage against reactive oxygen species	L13732	0.24	0.28	0.25	0.29	0.26	0.42	0.23	0.54	0.21
Lymphocyte antigen 71	Involved in cell adhesion within tissues and receptor signalling, expressed by macrophages	X93328	0.11	0.15	0.07	0.13	0.10	0.28	0.10	0.85	0.09
Colony stimulating factor 1 receptor	Receptor for CSF1, a cytokine that controls the production, differentiation, and function of macrophages	X06368	1.19	1.42	1.26	1.21	1.31	1.61	1.31	4.50	1.99
Macrophage scavenger receptor 1	Mediates the endocytosis of a diverse group of macromolecules, including modified ldl	M59446	0.08	0.07	0.09	0.11	0.10	0.22	0.13	0.17	0.09
ADAM8	Possible involvment in extravasation of leukocytes, expressed by macrophages	X13335	0.04	0.04	0.04	0.06	0.04	0.07	0.04	0.15	0.04

For a detailed explanation, see the legend for Table 1.

Genes related to adhesion

Hypoxia-ischemia in the immature brain induced several genes related to adhesion that previously had been reported after adult ischemia, such as CD44 antigen, ICAM-1, decorin, thrombospondin 1, integrin beta 2, and CD9 antigen. In addition, a number of new genes were also identified, such as VCAM-1, catenin alpha 1, cell adhesion kinase, c-Ccl–associated protein CAP, integrin beta 5, glycam-1, carboxypeptidase X1, and several different members of the procollagen family (Table 9).

DISCUSSION

In this study, 148 inflammatory genes were differentially expressed from 2 to 72 hours after neonatal HI. Of these genes, 30% had previously been shown to be induced by ischemia in the adult brain, whereas only 7% had previously been reported after neonatal HI.

TABLE 5.

Genes related to B- and T-lymphocytes

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
CD72 antigen	Plays a role in B-cell proliferation and differentiation, associates with CD5	J04170	0.03	0.04	0.03	0.09	0.03	0.16	0.02	0.24	0.03
Btk	Important for the maturation of B-cells	L10627	0.22	0.22	0.22	0.11	0.25	0.36	0.16	0.31	0.11
Lyn	Expressed predominantly in b-lymphoid and myeloid cells	M57696	0.20	0.19	0.18	0.25	0.24	0.27	0.15	0.29	0.17
CD22 antigen	Involved in regulation of B-cell antigen receptor signaling, expressed by B-cells	L02844	0.05	0.06	0.05	0.07	0.07	0.05	0.07	0.13	0.05
CD45R	Essential regulator of T- and B-cell antigen receptor signaling, also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling	M23158	0.01	0.03	0.02	0.07	0.02	0.09	0.03	0.15	0.03
NF-ATc	Transcription factor, B and T-cell activation	AF087434	0.09	0.10	0.14	0.44	0.16	0.13	0.05	0.18	0.06
vav-1 oncogene	Important in hematopoiesis, playing a role in T-cell and B-cell development and activation	D83266	0.17	0.20	0.17	0.20	0.18	0.35	0.20	0.34	0.19
Lymphocyte antigen 9, CD229	Cell surface receptor selectively expressed on T and B lymphocytes, belongs to the CD150 receptor family	M84412	0.11	0.10	0.09	0.15	0.13	0.09	0.07	0.20	0.06
CTLA-2 beta	Expressed by cytotoxic T-cells	X15592	0.09	0.19	0.13	0.19	0.11	0.15	0.12	0.36	0.08
CTLA-2 alpha	Expressed by cytotoxic T-cells	X15591	0.75	1.59	1.04	2.20	1.16	1.26	0.70	0.96	0.59
Cytoplasmic tyrosine kinase	Belongs to the Tec family, is an integral component of T cell signaling and has a distinct role in T cell activation	X55663	0.14	0.16	0.09	0.29	0.20	0.30	0.15	0.32	0.09
CD48 antigen	Ligand for the T-cell adhesion molecule CD2, might facilitate interaction between activated lymphocytes, probably involved in regulating T-cell activation	X53526	0.07	0.04	0.05	0.05	0.09	0.23	0.07	0.31	0.07
Lymphocyte antigen 57	Involved in T-cell antigen receptor mediated signaling	AF068182	0.34	0.40	0.30	0.38	0.31	0.44	0.32	0.57	0.28

For a detailed explanation, see the legend for Table 1.

Because the injury after HI develops over 1 or 2 days (as discussed in our companion article), the changes in gene expression correspond to developing brain damage (including all cellular elements) in brain tissue sampled at 2 hours, 8 hours, and to some extent 24 hours, whereas tissue at 72 hours (and partly at 24 hours) corresponds to partly damaged tissue with fewer neurons and a higher contribution from glia in particular but also from other inflammatory cells. These cells are known to secrete a diverse subset of pro- and/or anti-inflammatory mediators, which are important in regulating the inflammatory response after ischemia. In addition to their important function in directing the inflammatory response either to sustained inflammation or to tissue repair, they may also influence neurons and glia in the nearby periinfarction area. Only investigating genes in the possible periinfarction area would leave out a lot of important information about changes in gene expression that may be involved in the inflammatory process after neonatal HI. The inclusion of injured (and partly injured) tissue in the analysis may be one further explanation for the large number of newly identified inflammatory genes in this study, in addition to the factors discussed in our companion article.

The results from this microarray analysis were supported by the fact that the induction of nine genes on the array was confirmed with real-time PCR; the protein expression for gp49, osteopontin, and lysozyme was confirmed by immunohistochemistry; and that some of the genes had previously been reported after neonatal HI. More than 97% of the genes were upregulated, showing that an extensive induction of genes belonging to the immune-inflammatory system occurs after HI. The induced genes belong to diverse categories, indicating that the inflammatory response after HI involves the activation of many different inflammatory mediators, which may be of importance in the injurious or repair process after HI. The functions and potential roles for some of the genes induced after neonatal HI will be discussed further.

TABLE 6.

Genes induced or regulated by interferons

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
Interferon-γ-induced GTPase	47–48-kd GTP-binding protein, localized to the endoplasmatic reticulum, produced in response to interferon-γ in macrophages as well as nonimmune cells, has a specialized role in antimicrobial resistance	U53219	0.14	0.15	0.12	0.22	0.14	0.38	0.19	0.22	0.16
LRG-47	47–48-kd GTP-binding protein, localized to the endoplasmatic reticulum, plays a central role in the interferon-γ mediated clearance of infection	U19119	0.15	0.16	0.14	0.30	0.20	0.42	0.14	0.32	0.14
Tis7*	Has antiviral, antibacterial and anticancer activities	V00756	1.08	1.49	1.29	1.59	0.98	0.87	0.81	0.54	0.70
Interferon-induced protein with tetratricopeptide repeats 1 (Ifit-1)	Regulated by interferon-α, may interact with Rho/Rac guanine nucleotide exchange factor, and regulate the activation of Rho/Rac proteins, has been described as a candidate gene for SLE	U43084	0.02	0.02	0.02	0.12	0.03	0.51	0.04	0.13	0.02
Ifit-2	Induced by interferon-α	U43085	0.20	0.12	0.12	0.16	0.16	0.42	0.18	0.31	0.22
Ifit-3	Induced by interferon-α	U43086	0.04	0.08	0.03	0.23	0.09	0.81	0.22	0.30	0.09
GBP-2	GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP), induced by interferon-γ during macrophage activation	AJ007970	0.04	0.04	0.05	0.37	0.07	1.00	0.11	0.41	0.05
Interferon-activated gene 205	Induced by lipopolysaccharides in mononuclear phagocytes	M74123	0.15	0.10	0.17	0.16	0.15	0.29	0.12	0.18	0.07
Genes from EST cluster
Gbp-3	Guanylate-binding protein	AW047476	0.35	0.39	0.38	0.65	0.37	1.56	0.42	0.86	0.38
Interferon gamma inducible protein 30	Cleaves disulfide bonds in proteins by reduction, expressed constitutively in antigen presenting cells and induced by interferon-γ in other cell types	AI844520	0.11	0.12	0.11	0.20	0.08	0.32	0.13	0.48	0.09
Fragilis	Unknown	AW125390	0.84	0.16	0.91	1.40	0.93	5.46	1.28	3.08	0.96
Interferon-induced 35-kd protein homolog	Unknown	AW121732	0.04	0.06	0.05	0.06	0.06	0.08	0.05	0.13	0.04

For a detailed explanation, see the legend for Table 1.

Macrophages/microglia

Retinoic acid–inducible protein E3/LAPTm5 was induced 8 hours after HI and increased even further at 24 and 72 hours after HI. LAPTm5 is a lysosomal protein expressed in microglia that is upregulated in response to neuronal apoptosis in vitro (Origasa et al., 2001). Interestingly, the increase in LAPTm5 seems to occur before the cells die, suggesting that it may be a prerequisite for phagocytosis of dead neurons. Speculatively, it could be involved in the process of converting resting microglia into amoeboid-activated microglia with phagocytic activity. Glycoprotein 49A and 49B are two closely related immunoglobulin-like receptors expressed on the cell surface of mast cells, NK cells, and macrophages. Glycoprotein 49B has immunoreceptor tyrosine-based inhibitory motifs and can inhibit mast cell and macrophage function (Katz, 2002; Matsumoto et al., 2001), whereas gp49A lacks these motifs and has stimulatory functions on mast cells (Lee et al., 2000). The effect of gp49A on macrophages is not known. We found expression of gp49 (A + B) in microglia at 24 and 72 hours after HI in the injured part of the brain. The increase in gene expression of gp49A preceded that of gp49B, suggesting that gp49A may have a stimulatory role on microglia, which subsequently is counteracted by gp49B. Capping protein, gelsolin-like (CapG), a protein involved in actin-based motility in nonmuscle cells, was induced after HI. CapG is required for receptor-mediated ruffling, facilitates phagocytosis, and accelerates the motility of vesicle rockets in macrophages (Witke et al., 2001), suggesting that it may be important in microglial function and activation after HI. Macrophage metalloelastase/matrix metalloproteinase 12 (MMP-12) was induced 24 hours after HI. MMPs are proteases involved in the remodeling of the extracellular matrix. MMP-12 upregulation after spinal cord trauma contributes to the development of secondary injury (Wells et al., 2003), indicating that its expression after HI may increase injury. Lysozyme, one of the principal proteins of phagocytes, is expressed in neutrophils (Cramer and Breton-Gorius, 1987) and macrophages (Gordon et al., 1974). Mice have two genes for lysozyme, lysozymes M and P, both of which were upregulated at 24 and 72 hours after HI. Lysozyme was expressed in a subpopulation of microglia with amoeboid and activated morphology at 24 and 72 hours after HI, implying that they were phagocytotic. Lysozyme is an enzyme with peptidoglycan as a common substrate (Ganz et al., 2003), but it also has bacteriocidal activity independent of its enzymatic activity (Ibrahim et al., 2001). The increased expression of lysozyme in the absence of bacteria suggests that under some circumstances it may also have tissue-damaging effects. Osteopontin is an adhesive glycoprotein that interacts with α_vβ3 integrins (Liaw et al., 1995) and is upregulated in microglia after ischemia in the adult brain (Ellison et al., 1998; Lee et al., 1999; Wang et al., 1998). The function of osteopontin after stroke is not known, but it may be involved in the repair process (Ellison et al., 1998). A recent publication reports that osteopontin is transiently expressed in activated phagocytic microglia in the embryonic and early postnatal brain (Choi et al., 2004), suggesting that osteopontin is important for microglial migration, activation, and phagocytosis in the immature brain after HI.

TABLE 7.

MHC class I– and II–related genes

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
MHC (A.CA/J(H-2K-f) class I antigen	Involved in presentation of foreign antigens to the immune system, MHC class I	M58156	0.32	0.33	0.21	0.50	0.23	0.52	0.22	0.66	0.24
Histocompatibility 2, K region	Target gene of C/EBP beta in the cellular response to TNF-α, MHC class I receptor activity	V00746	1.31	1.47	1.33	1.98	1.37	2.37	1.32	3.32	1.25
Histocompatibility 2, T region locus 17	Defense response, HCM class I	M35247	0.40	0.43	0.40	0.41	0.41	0.83	0.44	0.74	0.44
Histocompatibility 2, D region locus 1	Defense response, MHC class I	M69069	1.01	1.10	1.01	1.29	1.15	1.73	1.02	2.75	1.07
Histocompatibility 2, Q region locus 2	Defense response, MHC class I	X58609	0.83	0.82	0.67	0.93	0.80	1.33	0.88	1.44	0.85
Beta-2 microglobulin	Beta-chain of major histocompatibility complex class I molecules	X01838	1.39	2.22	1.54	2.35	1.62	3.60	1.74	8.60	2.04
Lmp7	Processing of antigens for presentation in MHC class I receptors, subunit of the immunoproteasome	U22033	0.15	0.17	0.11	0.23	0.14	0.69	0.24	0.75	0.17
Lmp2	Processing of antigens for presentation in MHC class I receptors, subunit of the immunoproteasome	D44456	0.05	0.06	0.06	0.05	0.06	0.18	0.07	0.26	0.05
MDR/TAP	Involved in antigen transport for presentation on MHC class I receptors	U60091	0.04	0.10	0.04	0.05	0.06	0.18	0.05	0.20	0.10
Q8/9d gene	MHC class I gene	D90146	0.07	0.10	0.05	0.16	0.12	0.22	0.08	0.34	0.11
Major histocompatibility complex, class I-related	A MHC class I–related gene conserved among mammals, can associate with beta-2 microglobulin	AF010452	0.06	0.06	0.05	0.04	0.04	0.06	0.08	0.13	0.04
Hemochromatosis	Similar to MHC class I–type proteins, iron absorption	Y12650	0.26	0.22	0.24	0.23	0.24	0.27	0.23	0.46	0.19
Ia-associated invariant chain	Plays a critical role in MHC class II antigen processing and presentation	X00496	0.57	0.61	0.59	0.82	0.62	1.09	0.62	1.02	0.51
Histocompatibility 2, class II antigen E beta	Involved in fragmentation by proteolysis of exogenous antigens and the association of the resulting peptides with MHC class II molecules	X00958	0.21	0.52	0.35	0.28	0.31	0.55	0.20	0.45	0.13
Histocompatibility 2, class II antigen A, beta 1	Involved in fragmentation by proteolysis of exogenous antigens and the association of the resulting peptides with MHC class II molecules	M21932	0.10	0.09	0.07	0.09	0.08	0.13	0.11	0.24	0.08
Histocompatibility 2, class II antigen A, alpha	Involved in fragmentation by proteolysis of exogenous antigens and the association of the resulting peptides with MHC class II molecules	X52643	0.05	0.06	0.06	0.05	0.06	0.06	0.05	0.09	0.04
Genes from EST clusters
Tapasin, Tap-binding protein	Involved in the association of MHC class I with TAP and in the assembly of MHC class I with peptide	AI836367	0.85	0.83	0.80	0.89	0.77	1.36	0.90	1.48	0.82

For a detailed explanation, see the legend for Table 1.

MHC, major histocompatibility complex; TNF, tumor necrosis factor.

TABLE 8.

Other genes involved in immune and inflammatory responses

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
Tumor necrosis factor receptor superfamily, member 1a	Member of the TNF-receptor superfamily, one of the major receptors for TNF-α, can activate NF-κB, mediate apoptosis, and function as a regulator of inflammation	X57796	0.36	0.39	0.31	0.80	0.37	1.01	0.46	0.84	0.37
Pentaxin related gene	Produced by endothelial cells, macrophages and dendritic cells in response to primary inflammatory signals, probably involved in the regulation of innate resistance to pathogens and inflammatory reactions	X83601	0.18	0.31	0.19	0.69	0.29	0.86	0.19	0.31	0.17
Oncostatin M receptor	Oncostatin M is a member of the IL-6 family of cytokines. OSMR is an alternative subunit for an OSM receptor complex (a heterodimer of gp130 and OSMR) that is activated by OSM but not by LIF	AB015978	0.19	0.22	0.21	0.65	0.32	0.67	0.28	0.62	0.19
Interleukin 6 receptor, alpha	Part of the receptor for IL-6, binds to IL-6 with low affinity, but does not transduce a signal, signal activation necessitate an association with gp130	X51975	0.32	0.34	0.41	0.51	0.33	0.42	0.23	0.38	0.19
SOCS-3	Involved in negative regulation of cytokines that signal through the jak/stat pathway, inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, lif, erythropoietin, insulin and leptin receptors	U88328	0.04	0.45	0.09	0.22	0.04	0.16	0.04	0.12	0.03
MD-1	Associates with RP105, a member of the TLR family, expressed on immune cells such as B-cells, macrophages and dendritic cells	AB007599	0.38	0.43	0.39	0.49	0.50	1.12	0.63	2.77	0.51
RP105	Member of the TLR family, associates with MD-1, similar to TLR4/MD-2, expressed on B-cells, macrophages and dendritic cells	D37797	0.13	0.14	0.11	0.18	0.13	0.17	0.12	0.22	0.10
Myd88	Adapter protein involved in the TLR and IL-1 receptor signaling pathway in the innate immune response, acts via irak1, irak2 and traf6, leading to NF-κB activation, cytokine secretion and the inflammatory response	X51397	0.14	0.15	0.10	0.33	0.22	0.41	0.18	0.31	0.21
Proteoglycan, secretory granule	May neutralize hydrolytic enzymes, mainly expressed in myeloid cells	M34603	0.03	0.13	0.07	0.24	0.05	0.23	0.05	0.18	0.09
Galectin-9	Eosinophil chemoattractant, involved in apoptosis	U55060	0.64	0.85	0.61	0.75	0.66	1.17	0.64	1.03	0.67
Cyclophilin C-associated protein	Widely expressed secreted glycoprotein that modulates the host response to LPS, member of the scavenger-receptor cysteine-rich domain superfamily	X67809	0.37	0.38	0.40	0.36	0.35	1.08	0.52	1.41	0.46
Lipocortin 1	Calcium/phospholipid-binding protein that regulates phospholipase A2 activity, antiinflammatory	M69260	0.06	0.09	0.06	0.20	0.08	0.32	0.10	0.15	0.10
Tissue inhibitor of metalloproteinase 1	Complexes with metalloproteinases (such as collagenases) and irreversibly inactivates them	V00755	1.29	1.25	1.42	1.86	1.69	2.50	1.30	1.54	1.05
p22 phox	Critical component of the membrane-bound NADPH oxidase of phagocytes that generates superoxide	M31775	0.19	0.25	0.20	0.33	0.18	0.71	0.24	0.87	0.20
gp91phox	Critical component of the membrane-bound NADPH oxidase of phagocytes that generates superoxide	U43384	0.16	0.16	0.24	0.23	0.17	0.30	0.19	0.31	0.21
p67phox	Subunit of the NADPH oxidase of phagocytes	AB002664	0.03	0.05	0.02	0.07	0.05	0.12	0.05	0.26	0.09
Iba1	Calcium-binding protein that is specifically expressed in microglia in the brain, may be associated with micoglial activation	D86382	0.05	0.09	0.08	0.06	0.07	0.24	0.11	0.70	0.13
Interleukin–4 receptor alpha	Receptor for IL-4	M27960	0.17	0.33	0.21	0.54	0.28	0.37	0.26	0.32	0.22
Tgf beta 1*	Multifunctional peptide that controls proliferation, differentiation, and other functions in many cell types	AJ009862	0.03	0.05	0.04	0.06	0.04	0.04	0.04	0.37	0.05
Caspase-1*	Cleaves the inactive proforms of IL-1b and IL-18 into active proteins	L28095	0.12	0.15	0.12	0.10	0.09	0.20	0.11	0.16	0.06
Granulin	Granulins have possible cytokine-like activity, they may play a role in inflammation, wound repair, and tissue remodeling	D16195	1.65	1.81	1.62	1.79	1.60	2.36	1.81	5.35	1.63
Cox-1	Key enzyme in prostaglandin biosynthesis	M34141	0.10	0.13	0.11	0.10	0.11	0.10	0.09	0.18	0.08
Semaphorin K1	May play an important role in the nervous system and in modulating immune function	AB017532	0.56	0.58	0.55	0.47	0.60	0.47	0.66	0.31	0.53
Genes from EST clusters
LPS-induced TNF	Plays an important role in the regulation of TNF-α gene transcription	AI852632	0.34	0.57	0.47	0.74	0.41	0.65	0.34	0.83	0.38
TNF intracellular domain-interacting protein	Unknown	AW061307	0.28	0.34	0.28	0.54	0.19	0.76	0.31	0.70	0.42
IL-6 signal transducer, gp130	Signal transducer shared by many cytokines, including IL-6, CNTF, LIF, and OSM, functions as a part of the cytokine receptor complex	AI843709	0.99	0.97	0.95	1.18	0.91	1.32	0.93	0.86	0.97
Caveolin-1, caveolae protein	Functions as a suppressor of cytokine signaling in the mammary gland, similar to members of the SOCS family of proteins	AI747654	0.83	0.91	0.80	1.57	1.03	1.95	0.71	1.44	0.69
GLI pathogenesis-related 2, GAPR-1	High expression in monocytes, leukocytes, lung, spleen, and embryonic tissue, interacts with caveolin-1, probably involved in the immune system	AA983101	0.16	0.16	0.16	0.47	0.16	0.52	0.16	0.46	0.14
Viral hemorrhagic speticemia virus (VHSV) induced gene 1	May be involved in the nonspecific virus-induced synthesis of enzymatic cofactors of the nitric oxide pathway	AA204579	0.06	0.12	0.10	0.22	0.09	0.67	0.07	0.32	0.15

For a detailed explanation, see the legend for Table 1.

TNF, tumor necrosis factor; NF, nuclear factor; IL, interleukin; TLR, toll-like receptor.

Interferon-regulated genes

The response of cells to interferon-γ is dominated by the induction of two families of GTPases, the 47-kd family and the guanylate-binding proteins (GBPs) (Boehm et al., 1998). Members of both of these families were found to be upregulated after HI. Interferon-γ-induced GTPase, which seems to have a role in cell survival (Zhang et al., 2003), was induced 8 hours after HI, and LRG-47, which is involved in the defense against protozoan and bacterial infections (Collazo et al., 2001; MacMicking et al., 2003), was also induced. GBP 2 and 3 were upregulated 8 hours after HI, and their expression levels remained increased until 72 hours after the insult. GBPs are induced by lipopolysaccharide or interferon-γ in macrophages and microglia (Han, 1999; Vestal et al., 1996). The function of GBPs in microglia and macrophages remains obscure, but GBP-2 promotes growth in fibroblasts (Gorbacheva et al., 2002). In addition, the induction of GBP-3 by interferon-γ and lipopolysaccharide in macrophages seems to be mediated through different signal-transduction pathways (Han, 1999), suggesting a role for GBP 2 and 3 in microglial activation and proliferation after HI. Several interferon-α-inducible genes, such as interferon-induced protein with tetratricopeptide repeats (Ifit) 1, 2, and 3, were also induced by HI, but their function remains to be elucidated.

T- and B-cells

CD72, a transmembrane glycoprotein expressed by B-cells and involved in B-cell proliferation (Subbarao and Mosier, 1983), was induced 8 hours after HI and further upregulated at 24 and 72 hours. Bruton agammaglobulinemia tyrosine kinase (btk), which is important for normal B-cell development (Desiderio, 1997) and the genes lyn and CD22, which have been implicated in both positive and negative signaling pathways in B-lymphocytes, were also induced (Tsubata, 1999). CD48, a member of the immunoglobulin family that is expressed in almost all B- and T-cells and participates in T-cell activation (Blazar et al., 1998; Kato et al., 1992), vav-1 and NF-AT, factors involved in B- and T-cell activation/signaling (Deckert et al., 1996; Katzav, 2004), Ly-9, a T- and B-lymphocyte–specific cell surface receptor (de la Fuente et al., 2001), and cytotoxic T-lymphocyte–associated protein 2 alpha and beta were all induced, indicating that B-and T-cells are involved in the inflammatory process after HI.

Chemokines

In this study, we found that a number of chemokines (MCP-1, MIP-1 alpha, MIP-1 beta, GRO) and their receptors (CCR2, CCR5) are upregulated after HI, which confirms previous findings (Bona et al., 1999; Cowell et al., 2002; Ivacko et al., 1997). In addition, multiple beta-chemokines (MCP-3, MCP-5, MIP-1 gamma, IP-10, eotaxin) and the fractalkine receptor (CX3CR1) were induced in the immature brain, which has not previously been demonstrated. Chemokines seem to play a critical role in ischemic brain injury for example a broad-spectrum antagonist of chemokine receptors attenuates brain injury (Minami and Satoh, 2003). The mRNA for MCP-3 (CCL7) increased 12 times at 8 hours and MCP-5 (CCL12) increased eight times at 8 to 72 hours of recovery. MCP-5 binds preferentially to CCR2 (which was also upregulated) and is considered homologous to human MCP-1 (Sarafi et al., 1997), whereas MCP-3 binds to CCR1, CCR2, and CCR3 receptors (Tran and Miller, 2003). The mRNA expression of MIP-1 gamma (CCL9) increased 25-fold at 8 hours of recovery and remained elevated for at least 3 days after HI. Its significance in the immature brain remains uncertain, but it activates CCR1 just as MIP-1 alpha, and the latter contributes to ischemic injury in the adult brain (Takami et al., 2001). In summary, these beta-chemokines are emerging as key players in attracting and activating microglia/macrophages in the CNS, and the discovery that new members are induced may be important.

Complement

Transcripts of several previously undetected components of the classical and alternative pathways were induced after HI. This may indicate that the complement system is involved in HI; recently, Cowell et al. (2003) indeed found signs of complement activation after HI, and reported that a complement-depleting agent reduced the lesion size.

TABLE 9.

Genes related to adhesion

Gene name	Function summary	Acc. no.	PND 9	2hI	2hC	8hI	8hC	24hI	24hC	72hI	72hC
CD44 antigen	Main cell surface receptor for hyaluronate, involved in leukocyte recruitment, cell–matrix interactions, and regulation of leukocyte function	X66084	0.08	0.07	0.05	0.25	0.08	0.30	0.11	0.26	0.08
ICAM-1	Expressed on endothelial cells and cells of the immune system, binds to integrins of type CD11a/CD18 or CD11b/CD18	M90551	0.05	0.12	0.08	0.41	0.08	0.17	0.06	0.15	0.05
VCAM-1	Member of the immunoglobulin superfamily, interacts with the beta-1 integrin vla4 on leukocytes, mediates adhesion and signal transduction	U12884	0.11	0.17	0.13	0.25	0.13	0.15	0.09	0.16	0.08
Tgf b induced, 68 kd*	May play an important role in cell–collagen interactions, binds to type I, II, and IV collagens	L19932	0.12	0.14	0.12	0.25	0.14	0.49	0.13	0.27	0.14
Catenin alpha 1	Associates with the cytoplasmic domain of a variety of cadherins	X59990	0.70	0.83	0.70	1.00	0.72	1.23	0.78	1.24	0.70
Cell adhesion kinase	A receptor tyrosine kinase, widely expressed in normal and transformed epithelial cells, is activated by various types of collagen, involved in cell–cell interactions and recognition	L57509	1.92	1.90	1.81	2.32	1.73	2.90	1.93	3.43	1.91
c-Cbl–associated protein CAP	May mediate signals for the formation of stress fibers and focal adhesion	U58883	1.49	1.58	1.53	1.89	1.70	2.89	1.83	2.53	1.55
Decorin	Component of connective tissue, binds to type I collagen fibrils and plays a role in matrix assembly	X53929	1.00	1.72	1.27	1.44	1.15	1.64	0.91	1.94	1.29
Thrombo-spondin 1	Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions	M62470	0.26	0.74	0.27	0.53	0.22	0.35	0.20	0.26	0.16
Integrin beta2, CD18	Integrins are cell-surface proteins composed of an alpha chain and a beta chain, participates in cell adhesion as well as cell-surface–mediated signaling	M31039	0.05	0.07	0.08	0.10	0.09	0.16	0.08	0.29	0.09
Integrin beta 5	Integrin-mediated signaling pathway, cell–matrix adhesion, cell adhesion	AF022110	1.35	1.37	1.48	1.34	1.43	1.59	1.32	2.68	1.49
Integrin alpha 6	Integrin-mediated signaling pathway, cell–matrix adhesion, cell adhesion	X69902	0.23	0.24	0.21	0.25	0.26	0.28	0.20	0.53	0.20
CD9 antigen	Modulates cell adhesion and migration and can also trigger platelet activation and aggregation, expressed by a variety of hematopoietic and epithelial cells	L08115	2.06	1.74	1.88	2.43	1.94	3.26	1.95	4.10	1.92
GLYCAM-1	Sialomucin, ligand for L-selectin, involved in mediating leukocyte adhesion and rolling	M93428	0.15	0.12	0.12	0.15	0.10	0.34	0.19	0.75	0.11
Carboxyl-peptidaseX1	Cell adhesion	AF077738	0.25	0.20	0.22	0.28	0.27	0.29	0.25	0.39	0.26
Procollagen type V alpha 2	Type V collagen is a member of group I collagen (fibrillar-forming collagen), binds to DNA, heparan sulfate, thrombospondin, heparin, and insulin	L02918	0.34	0.59	0.33	0.39	0.25	0.41	0.28	0.59	0.27
Procollagen, type XVIII, alpha 1	Cell adhesion and angiogenesis, the proteolytically produced C-terminal fragment of type XVIII collagen is endostatin, a potent antiangiogenic protein	L22545	0.07	0.16	0.06	0.19	0.04	0.20	0.06	0.21	0.10
Procollagen, type IV, alpha 1	Encodes one of the six subunits of type IV collagen, major structural component of basement membranes	M15832	2.01	2.87	2.47	3.43	2.47	3.24	2.05	2.64	2.31
Procollagen, type VI, alpha 2	Cell adhesion	Z18272	0.64	0.78	0.68	0.87	0.75	1.38	0.60	0.91	0.68
Procollagen, type IV, alpha 5	Encodes one of the six subunits of type IV collagen, major structural component of basement membranes	Z35168	0.14	0.17	0.17	0.17	0.10	0.26	0.14	0.37	0.19
Telencephalin/ICAM-5	Adhesion molecule that binds to leukocyte adhesion lfa-1 protein	U06483	1.31	1.55	1.68	1.07	1.37	1.18	1.51	1.23	2.46
Cadherin-related neural recepter 6	Potential calcium-dependent cell-adhesion protein	AB008181	1.18	1.17	1.22	1.14	1.33	0.89	1.29	0.88	1.41

For a detailed explanation, see the legend for Table 1.

Activation of the TIR/nuclear factor-κB pathway

Interleukins 1 and 18 were produced (Hagberg et al., 1996; Hedtjarn et al., 2002), IkB (inhibitor of nuclear factor-κB) was induced (data not shown), and the expression of several of the molecular components of the TOLL-like receptor (TLR) complex (MD-1, RP105, MYD88) was increased after HI. These data suggest that the common cytoplasmic portion of TOLL-like and interleukin-1 receptors (called the TIR domain) is activated after HI, leading to the induction of nuclear factor-κB (Nguyen et al., 2002). Interleukins 1 and 18 seem to play important roles in HI in that genetic deficiency of caspase-1 or interleukin-18 and the administration of interleukin-1 R antagonist confer resistance in the immature brain (Hagberg et al., 1996; Hedtjarn et al., 2002; Liu et al., 1999). In addition, activation of TLRs (with lipopolysaccharide) before HI seems to enhance CNS vulnerability (Eklind et al., 2001) and it has been suggested that TLRs on microglia are responsible for this effect (Lehnardt et al., 2003). Besides bacterial products, TLRs can be activated by molecules released from injured cells (e.g., CG dinucleotide motif–rich DNA can induce neuronal injury through activation of TLRs on microglia; Iliev et al., 2003). DAP12, a tyrosine protein kinase binding protein originally described in NK cells (Lanier et al., 1998) but later also found in neutrophils, macrophages, and microglia (Bakker et al., 2000; Lucas et al., 2002), was upregulated at 24 hours (threefold) and 72 hours (sevenfold) after HI. Overexpression of DAP12 seems to initiate inflammatory reactions in the absence of microbial challenge (Lucas et al., 2002), and DAP12 signaling may augment the lipopolysaccharide response through the TLR4/Myd88 pathway (Nathan and Ding, 2001), suggesting that the increase of DAP12 after HI leads to enhanced inflammation and injury. Another example of activation of the TIR domain/nuclear factor-κB is the induction of pentaxin related gene (PTX3), a soluble pattern recognition receptor belonging to the lectin family (Kilpatrick, 2002). PTX3 is induced by nuclear factor-κB, preferentially in dendritic cells, during the early phase of inflammation by interleukin-1β, TNF-α, and by TLR activation (Doni et al., 2003). Besides amplification of innate immunity in the recognition of microbes, PTX3 has other functions, such as clearing self-components (prevention of autoimmunity) and decreasing dendritic cell recognition of apoptotic cells (Mantovani et al., 2003). Cysteine-rich intestinal protein (CRIP) is a double-zinc finger LIM protein, expressed among others in peritoneal macrophages and peripheral blood mononuclear cells (Hallquist et al., 1996), that was increased sixfold at 8 hours after HI. The expression of CRIP can be induced by lipopolysaccharide and interferon-γ, but lipopolysaccharide-stimulated induction of CRIP is eliminated in metallothionein-deficient mice (Cousins and Lanningham-Foster, 2000; Hallquist et al., 1996). Mice overexpressing CRIP show increased susceptibility to lipopolysaccharide and exhibit an altered cytokine production pattern in response to lipopolysaccharide, with a shift to an increase in interleukins 6 and 10 and a decrease in interferon-γ and interleukin-2 (Lanningham-Foster et al., 2002), suggesting an anti-inflammatory role for CRIP after HI.

The expression of CD53, which is a member of the tetraspanin membrane protein family, was also induced at 8 hours after HI and a further increase was detected at 72 hours. CD53 is mainly expressed by cells of the lymphoid-myeloid lineage, and ligation of CD53 can induce homotypic adhesion (Lagaudriere-Gesbert et al., 1997), the activation of N-terminal Jun kinase (JNK) (Yunta et al., 2002), and protection against apoptosis (Yunta and Lazo, 2003). This suggests that CD53 inhibits apoptosis in immune cells after HI, leading to sustained inflammation.

NADPH oxidase

NADPH-oxidase is composed of cytosolic (p40phox, p47phox, p67phox, and Rac2) and membrane-bound (gp91phox and p22phox) components. Upon activation, the cytosolic proteins are translocated to the membrane and fuse with the membrane bound proteins, leading to the formation of superoxide (Babior, 1999). Several substances induce activation of NADPH-oxidase, including galactins, chemokines, and proinflammatory cytokines (Karlsson and Dahlgren, 2002). We presently found induction of genes for both the membrane and cytosolic components of NADPH-oxidase, as well as an increase of chemokines (above) and a marked (20-fold) increase of galectin-3 (Mac-2 antigen), suggesting that NADPH-oxidase in phagocytes (polymorphonuclear leukocytes and/or microglia/macrophages) is activated after HI and that its importance in the immature brain injury has to be further explored.

Anti-inflammatory cytokines or receptors

Anti-inflammatory molecules (lipocortin-1, SOCS-3, transforming growth factor-β1, tissue inhibitor of metalloproteinase 1) and receptors (interleukin-4 receptor) were induced. Lipocortin-1 possesses anti-inflammatory effects probably through inhibition of phospholipase A2, and is proposed to be an endogenous neuroprotective molecule in a number of tissues including the brain (Rothwell and Relton, 1993). An early 10-fold increase of SOCS-3 (but not SOCS-5) was found in the immature brain, which basically agrees with the response to ischemia in the adult brain (Bates et al., 2001). This suppressor of cytokine signaling is induced by interleukin-6, interleukin-10, and interferon-γ, and may exert its anti-inflammatory effect through inhibition of JAK2 kinase (Larsen and Ropke, 2002). The induction of interleukin-4 receptor is interesting in that this cytokine has been shown to kill microglial cells and may thereby contribute to the termination of the powerful microglial response and prevention of chronic inflammation (Yang et al., 2002).

In summary, this study on the global pattern of gene expression after HI emphasizes the complexity and multifaceted nature of the immunoinflammatory response. Besides the existence of various subpopulations of microglia/macrophages, our data indicate that T-cells, NK-cells, mast cells, B-cells, dendritic cells, and polymorphonuclear leukocytes may participate in the response to HI. Furthermore, novel cytokines/chemokines, complement-related genes, interferon-regulated genes, components of the TIR/nuclear factor-κB pathway, and a number of anti-inflammatory or immunomodulatory genes are likely to be involved. Several of these genes may be of pathophysiologic significance, and their roles in immature brain injury need to be revealed in future studies.

Footnotes

Acknowledgements

The authors thank Eva Cambert for technical assistance.

References

Babior

(1999) NADPH oxidase: an update. Blood 93:1464–1476

Bakker

Phillips

Lanier

(2000) NK cell activation: distinct stimulatory pathways counterbalancing inhibitory signals. Hum Immunol 61:18–27

Barone

Feuerstein

(1999) Inflammatory mediators and stroke: new opportunities for novel therapeutics. J Cereb Blood Flow Metab 19:819–834

Bates

Read

Harrison

Topp

Morrow

Gale

Murdock

Barone

Parsons

Gloger

(2001) Characterisation of gene expression changes following permanent MCAO in the rat using subtractive hybridisation. Brain Res Mol Brain Res 93:70–80

Blazar

Taylor

Panoskaltsis-Mortari

Yagita

Bromberg

Vallera

(1998) A critical role for CD48 antigen in regulating alloengraftment and lymphohematopoietic recovery after bone marrow transplantation. Blood 92:4453–4463

Boehm

Guethlein

Klamp

Ozbek

Schaub

Futterer

Pfeffer

Howard

(1998) Two families of GTPases dominate the complex cellular response to IFN-gamma. J Immunol 161:6715–6723

Bona

Andersson

Blomgren

Gilland

Puka-Sundvall

Gustafson

Hagberg

(1999) Chemokine and inflammatory cell response to hypoxia-ischemia in immature rats. Pediatr Res 45:500–509

Brott

Bogousslavsky

(2000) Treatment of acute ischemic stroke. N Engl J Med 343:710–722

Choi

Cha

Park

Chung

Chun

Lee

(2004) Transient expression of osteopontin mRNA and protein in amoeboid microglia in developing rat brain. Exp Brain Res 154:275–280

10.

Collazo

Yap

Sempowski

Lusby

Tessarollo

Woude

Sher

Taylor

(2001) Inactivation of LRG-47 and IRG-47 reveals a family of interferon gamma-inducible genes with essential, pathogen-specific roles in resistance to infection. J Exp Med 194:181–188

11.

Connolly

Jr Winfree

Prestigiacomo

Kim

Choudhri

Hoh

Naka

Solomon

Pinsky

(1997) Exacerbation of cerebral injury in mice that express the P-selectin gene: identification of P-selectin blockade as a new target for the treatment of stroke. Circ Res 81:304–310

12.

Connolly

Jr Winfree

Springer

Naka

Liao

Yan

Stern

Solomon

Gutierrez-Ramos

Pinsky

(1996) Cerebral protection in homozygous null ICAM-1 mice after middle cerebral artery occlusion. Role of neutrophil adhesion in the pathogenesis of stroke. J Clin Invest 97:209–216

13.

Cousins

Lanningham-Foster

(2000) Regulation of cysteine-rich intestinal protein, a zinc finger protein, by mediators of the immune response. J Infect Dis 182(suppl 1):S81–S84

14.

Cowell

Plane

Silverstein

(2003) Complement activation contributes to hypoxic-ischemic brain injury in neonatal rats. J Neurosci 23:9459–9468

15.

Cowell

Galasso

Silverstein

(2002) Hypoxic-ischemic injury induces macrophage inflammatory protein-1alpha expression in immature rat brain. Stroke 33:795–801

16.

Cramer

Breton-Gorius

(1987) Ultrastructural localization of lysozyme in human neutrophils by immunogold. J Leukoc Biol 41:242–247

17.

de la Fuente

Tovar

Villamor

Zapater

Pizcueta

Campo

Bosch

Engel

(2001) Molecular characterization and expression of a novel human leukocyte cell-surface marker homologous to mouse Ly-9. Blood 97:3513–3520

18.

Deckert

Tartare-Deckert

Couture

Mustelin

Altman

(1996) Functional and physical interactions of Syk family kinases with the Vav proto-oncogene product. Immunity 5:591–604

19.

Desiderio

(1997) Role of Btk in B cell development and signaling. Curr Opin Immunol 9:534–540

20.

Doni

Peri

Chieppa

Allavena

Pasqualini

Vago

Romani

Garlanda

Mantovani

(2003) Production of the soluble pattern recognition receptor PTX3 by myeloid, but not plasmacytoid, dendritic cells. Eur J Immunol 33:2886–2893

21.

Eklind

Mallard

Leverin

Gilland

Blomgren

Mattsby-Baltzer

Hagberg

(2001) Bacterial endotoxin sensitizes the immature brain to hypoxic–ischemic injury. Eur J Neurosci 13:1101–1106.

22.

Ellison

Velier

Spera

Jonak

Wang

Barone

Feuerstein

(1998) Osteopontin and its integrin receptor alpha(v) beta3 are upregulated during formation of the glial scar after focal stroke. Stroke 29:1698–1707

23.

Forster

Clark

Ross

Iadecola

(1999) Inducible nitric oxide synthase expression in human cerebral infarcts. Acta Neuropathol (Berl) 97:215–220

24.

Frijns

Kappelle

(2002) Inflammatory cell adhesion molecules in ischemic cerebrovascular disease. Stroke 33:2115–2122

25.

Ganz

Gabayan

Liao

Liu

Oren

Graf

Cole

(2003) Increased inflammation in lysozyme M-deficient mice in response to Micrococcus luteus and its peptidoglycan. Blood 101:2388–2392

26.

Gorbacheva

Lindner

Sen

Vestal

(2002) The interferon (IFN)-induced GTPase, mGBP-2. Role in IFN-gamma-induced murine fibroblast proliferation. J Biol Chem 277:6080–6087

27.

Gordon

Todd

Cohn

(1974) In vitro synthesis and secretion of lysozyme by mononuclear phagocytes. J Exp Med 139:1228–1248

28.

Hagberg

Gilland

Bona

Hanson

Hahin-Zoric

Blennow

Holst

McRae

Soder

(1996) Enhanced expression of interleukin (IL)-1 and IL-6 messenger RNA and bioactive protein after hypoxia-ischemia in neonatal rats. Pediatr Res 40:603–609

29.

Hallquist

Khoo

Cousins

(1996) Lipopolysaccharide regulates cysteine-rich intestinal protein, a zinc-finger protein, in immune cells and plasma. J Leukoc Biol 59:172–177

30.

Han

(1999) Interferon-gamma and lipopolysaccharide induce mouse guanylate-binding protein 3 (mGBP3) expression in the murine macrophage cell line RAW264.7. Arch Pharm Res 22:130–136

31.

Hedtjarn

Leverin

Eriksson

Blomgren

Mallard

Hagberg

(2002) Interleukin-18 involvement in hypoxic-ischemic brain injury. J Neurosci 22:5910–5919

32.

Heinel

Rubin

Rosenwasser

Vasthare

Tuma

(1994) Leukocyte involvement in cerebral infarct generation after ischemia and reperfusion. Brain Res Bull 34:137–141

33.

Ibrahim

Matsuzaki

Aoki

(2001) Genetic evidence that antibacterial activity of lysozyme is independent of its catalytic function. FEBS Lett 506:27–32

34.

Iliev

Stringaris

Nau

Neumann

(2003) Neuronal injury mediated via stimulation of microglial toll-like receptor-9 (TLR9). FASEB J 19:19

35.

Ivacko

Szaflarski

Malinak

Flory

Warren

Silverstein

(1997) Hypoxic-ischemic injury induces monocyte chemoattractant protein-1 expression in neonatal rat brain. J Cereb Blood Flow Metab 17:759–770

36.

Karlsson

Dahlgren

(2002) Assembly and activation of the neutrophil NADPH oxidase in granule membranes. Antioxid Redox Signal 4:49–60.

37.

Kato

Koyanagi

Okada

Takanashi

Wong

Williams

Okumura

Yagita

(1992) CD48 is a counter-receptor for mouse CD2 and is involved in T cell activation. J Exp Med 176:1241–1249

38.

Katz

(2002) Inhibition of anaphylactic inflammation by the gp49B1 receptor on mast cells. Mol Immunol 38:1301–1305

39.

Katzav

(2004) Vav1: an oncogene that regulates specific transcriptional activation of T cells. Blood 103:2443–2451

40.

Kilpatrick

(2002) Animal lectins: a historical introduction and overview. Biochim Biophys Acta 1572:187–197

41.

Kim

Sohn

Kang

Soh

(2002) DNA array reveals altered gene expression in response to focal cerebral ischemia. Brain Res Bull 58:491–498

42.

Lagaudriere-Gesbert

Le Naour

Lebel-Binay

Billard

Lemichez

Boquet

Boucheix

Conjeaud

Rubinstein

(1997) Functional analysis of four tetraspans, CD9, CD53, CD81, and CD82, suggests a common role in costimulation, cell adhesion, and migration: only CD9 upregulates HB-EGF activity. Cell Immunol 182:105–112

43.

Lanier

Corliss

Leong

Phillips

(1998) Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391:703–707

44.

Lanningham-Foster

Green

Langkamp-Henken

Davis

Nguyen

Bender

Cousins

(2002) Overexpression of CRIP in transgenic mice alters cytokine patterns and the immune response. Am J Physiol Endocrinol Metab 282:E1197–E1203

45.

Larsen

Ropke

(2002) Suppressors of cytokine signalling: SOCS. APMIS 110:833–844

46.

Lee

Ono

Inui

Yuasa

Takai

(2000) Stimulatory function of gp49A, a murine Ig-like receptor, in rat basophilic leukemia cells. J Immunol 165:4970–4977

47.

Lee

Shin

Choi

Kim

Cha

Chun

Lee

Kim

(1999) Transient upregulation of osteopontin mRNA in hippocampus and striatum following global forebrain ischemia in rats. Neurosci Lett 271:81–84

48.

Lehnardt

Massillon

Follett

Jensen

Ratan

Rosenberg

Volpe

Vartanian

(2003) Activation of innate immunity in the CNS triggers neurodegeneration through a Toll-like receptor 4-dependent pathway. Proc Natl Acad Sci U S A 100:8514–8519.

49.

Liaw

Skinner

Raines

Ross

Cheresh

Schwartz

Giachelli

(1995) The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. Role of alpha v beta 3 in smooth muscle cell migration to osteopontin in vitro. J Clin Invest 95:713–724

50.

Liu

Kwon

Schielke

Yang

Silverstein

Barks

(1999) Mice deficient in interleukin-1 converting enzyme are resistant to neonatal hypoxic-ischemic brain damage. J Cereb Blood Flow Metab 19:1099–1108

51.

Loddick

Rothwell

(1996) Neuroprotective effects of human recombinant interleukin-1 receptor antagonist in focal cerebral ischemia in the rat. J Cereb Blood Flow Metab 16:932–940

52.

Tang

Ran

Clark

Aronow

Sharp

(2003) Genomics of the periinfarction cortex after focal cerebral ischemia. J Cereb Blood Flow Metab 23:786–810

53.

Lucas

Daniel

Tomasello

Guia

Horschowski

Aoki

Figarella-Branger

Gomez

Vivier

(2002) Massive inflammatory syndrome and lymphocytic immunodeficiency in KARAP/DAP12-transgenic mice. Eur J Immunol 32:2653–2663

54.

MacMicking

Taylor

McKinney

(2003) Immune control of tuberculosis by IFN-gamma-inducible LRG-47. Science 302:654–659

55.

Mantovani

Garlanda

Bottazzi

(2003) Pentraxin 3, a non-redundant soluble pattern recognition receptor involved in innate immunity. Vaccine 21(suppl 2):S43–S47

56.

Martin

Chinookoswong

Miller

(1994) The interleukin-1 receptor antagonist (rhIL-1ra) protects against cerebral infarction in a rat model of hypoxia-ischemia. Exp Neurol 130:362–367

57.

Matsumoto

Wang

Yokoyama

Aso

(2001) Uterine macrophages express the gp49B inhibitory receptor in midgestation. J Immunol 166:781–786

58.

Minami

Satoh

(2003) Chemokines and their receptors in the brain: pathophysiological roles in ischemic brain injury. Life Sci 74:321–327

59.

Nathan

(2002) Points of control in inflammation. Nature 420:846–852

60.

Nathan

Ding

(2001) TREM-1: a new regulator of innate immunity in sepsis syndrome. Nat Med 7:530–532

61.

Nguyen

Julien

Rivest

(2002) Innate immunity: the missing link in neuroprotection and neurodegeneration? Nat Rev Neurosci 3:216–227

62.

Nogawa

Zhang

Ross

Iadecola

(1997) Cyclo-oxygenase-2 gene expression in neurons contributes to ischemic brain damage. J Neurosci 17:2746–2755

63.

Origasa

Tanaka

Suzuki

Tone

Lim

Koike

(2001) Activation of a novel microglial gene encoding a lysosomal membrane protein in response to neuronal apoptosis. Brain Res Mol Brain Res 88:1–13

64.

Relton

Rothwell

(1992) Interleukin-1 receptor antagonist inhibits ischemic and excitotoxic neuronal damage in the rat. Brain Res Bull 29:243–246

65.

Rothwell

Relton

(1993) Involvement of interleukin-1 and lipocortin-1 in ischemic brain damage. Cerebrovasc Brain Metab Rev 5:178–198

66.

Sarafi

Garcia-Zepeda

MacLean

Charo

Luster

(1997) Murine monocyte chemoattractant protein (MCP)-5: a novel CC chemokine that is a structural and functional homologue of human MCP-1. J Exp Med 185:99–109

67.

Schmidt-Kastner

Zhang

Belayev

Khoutorova

Amin

Busto

Ginsberg

(2002) DNA microarray analysis of cortical gene expression during early recirculation after focal brain ischemia in rat. Brain Res Mol Brain Res 108:81–93

68.

Subbarao

Mosier

(1983) Induction of B lymphocyte proliferation by monoclonal anti-Lyb 2 antibody. J Immunol 130:2033–2037

69.

Szaflarski

Burtrum

Silverstein

(1995) Cerebral hypoxia-ischemia stimulates cytokine gene expression in perinatal rats. Stroke 26:1093–1100

70.

Takami

Minami

Nagata

Namura

Satoh

(2001) Chemokine receptor antagonist peptide, viral MIP-II, protects the brain against focal cerebral ischemia in mice. J Cereb Blood Flow Metab 21:1430–1435

71.

Tang

Aronow

Wagner

Sharp

(2002) Genomic responses of the brain to ischemic stroke, intracerebral hemorrhage, kainate seizures, hypoglycemia, and hypoxia. Eur J Neurosci 15:1937–1952

72.

Tran

Miller

(2003) Chemokine receptors: signposts to brain development and disease. Nat Rev Neurosci 4:444–455

73.

Tsubata

(1999) Co-receptors on B lymphocytes. Curr Opin Immunol 11:249–255

74.

Wang

Louden

Yue

Ellison

Barone

Solleveld

Feuerstein

(1998) Delayed expression of osteopontin after focal stroke in the rat. J Neurosci 18:2075–2083

75.

Wells

Rice

Nuttall

Edwards

Zekki

Rivest

Yong

(2003) An adverse role for matrix metalloproteinase 12 after spinal cord injury in mice. J Neurosci 23:10107–10115

76.

Vestal

Buss

Kelner

Maciejewski

Asundi

Maki

(1996) Rat p67 GBP is induced by interferon-gamma and isoprenoid-modified in macrophages. Biochem Biophys Res Commun 224:528–534

77.

Witke

Kwiatkowski

Southwick

(2001) Comparisons of CapG and gelsolin-null macrophages: demonstration of a unique role for CapG in receptor-mediated ruffling, phagocytosis, and vesicle rocketing. J Cell Biol 154:775–784

78.

Yang

Gong

Qin

Mao

Bertz

(1998) Inhibition of TNFalpha attenuates infarct volume and ICAM-1 expression in ischemic mouse brain. Neuroreport 9:2131–2134

79.

Yang

Park

Sohn

Kwon

Shin

Pyo

Jin

Choi

Jou

Joe

(2002) Interleukin-13 and −4 induce death of activated microglia. Glia 38:273–280

80.

Yunta

Lazo

(2003) Apoptosis protection and survival signal by the CD53 tetraspanin antigen. Oncogene 22:1219–1224

81.

Yunta

Oliva

Barcia

Horejsi

Angelisova

Lazo

(2002) Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types. Eur J Biochem 269:1012–1021

82.

Zhang

Yuan

Cheung

Luo

Yanagawa

Chau

Stephan-Tozy

Wong

Zhang

Wilson

McManus

Yang

(2003) Overexpression of interferon-gamma-inducible GTPase inhibits coxsackievirus B3-induced apoptosis through the activation of the phosphatidylinositol 3-kinase/Akt pathway and inhibition of viral replication. J Biol Chem 278:33011–33019

83.

Zhang

Chopp

Zaloga

Jiang

Jones

Miyasaka

Ward

(1994) Anti-ICAM-1 antibody reduces ischemic cell damage after transient middle cerebral artery occlusion in the rat. Neurology 44:1747–1751

Inflammatory Gene Profiling in the Developing Mouse Brain after Hypoxia-Ischemia

Abstract

Keywords

MATERIALS AND METHODS

Real-time polymerase chain reaction

Immunohistochemistry

RESULTS

Real-time polymerase chain reaction

Immunohistochemistry

Functional categories of differently expressed genes

Chemokines

Complement-related genes

Genes expressed by leukocytes

Macrophage-related genes

Genes related to B- and T-lymphocytes

Genes induced or regulated by interferons

Major histocompatibility complex class I– and II–related genes

Other genes involved in immune and inflammatory responses

Genes related to adhesion

DISCUSSION

Macrophages/microglia

Interferon-regulated genes

T- and B-cells

Chemokines

Complement

Activation of the TIR/nuclear factor-κB pathway

NADPH oxidase

Anti-inflammatory cytokines or receptors

Footnotes

Acknowledgements

References