Sage Journals: Discover world-class research

Abstract

The Ras association domain family 1 (RASSF1) gene is a Ras effector that plays an important role in carcinogenesis. We have previously shown that silencing of RASSF1C decreases and over-expression of RASSF1C increases cell proliferation, migration, and attenuates apoptosis of breast cancer cells in vitro. To further confirm our working hypothesis that RASSF1C may play a role as a growth promoter, we have tested the growth of human breast cancer cells stably over-expressing RASSF1A or RASSF1C in nude mice. Our studies show that breast cancer cells over-expressing HA-RASSF1A developed significantly smaller tumors and cells over-expressing HA-RASSF1C developed significantly larger tumors compared to control cells expressing the vector back bone. We have confirmed the expression of HA-RASSF1A and HA-RASSF1C in tumor tissue using RT-PCR, western blotting and immunohistochemical analyses using HA-antibody. Together, our previous in vitro and current in vivo findings further support our hypothesis that RASSF1C, unlike RASSF1A, is not a tumor suppressor and rather it appears to function as tumor growth promoter in breast cancer cells.

Keywords

RASSF1A RASSF1C gene expression breast cancer tumor growth tumor suppressor ERK1/2

Introduction

The RASSF1 gene encodes seven isoforms (A-G) derived by different promoter usage and alternative mRNA splicing.^1,2 RASSF1A and RASSF1C are the two major isoforms encoded by the RASSF1 gene. RASSFIA is a protein of 340 amino acids and RASSF1C is a protein of 270 amino acids with identical C-termini, but with different N-termini.^1,2

RASSF1A is well studied and unequivocally functions as a tumor suppressor. RASSF1A mRNA expression is epigenetically inactivated by cytidine methylation in many types of human solid tumors including breast, lung, liver, and prostate,^1–10 while RASSF1C is typically fully expressed in tumors. Furthermore, restoring RASSF1A expression decreases colony formation, reduces tumor growth in nude mice, and induces cell cycle arrest by blocking cyclin D accumulation.^2,8,11,12 In addition, RASSF1A –/– and RASSF1A +/– mice exhibit enhanced tumor multiplicity and tumor size compared to wild type animals upon exposure to the chemical carcinogens benzo(a) pyrene and urethane.¹³ Re-expression of RASSF1A in cancer cell lines decreased cell proliferation, arrested cell cycle, and induced cell apoptosis and senescence in part through the modulation of MST2, MEK/ERK, and PI3K/Akt activities.^14–16

In contrast to RASSF1A, RASSF1C is expressed in almost all human solid tumors including breast cancer. The majority of published literature indicates that RASSF1C has no tumor-suppressor activity.^2,9,11,12,17 However, some reports suggest that RASSF1C may function as a tumor suppressor in ovarian, prostate, renal cancer cells.^18–20 We have previously shown that silencing of RASSF1C decreases, and over-expression of RASSF1C increases, cell proliferation in breast, lung, and osteosarcoma cancer cells in vitro suggesting a growth promoting role for RASSF1C.^21–23 We have also shown that RASSF1C increases cell migration, and attenuates apoptosis of breast cancer cells in vitro.²³ Therefore, the purpose of this study is to further confirm our in vitro data that RASSF1C, unlike RASSF1A, acts as tumor growth promoter in breast cancer cells in vivo. In this paper we report on our in vivo studies involving human breast cancer cells stably over-expressing RASSF1A or RASSF1C in nude mice.

Materials and Methods

Cell culture

The human breast cancer cell line T47D stably over-expressing HA-RASSF1A or HA-RASSF1C was developed as previously described.²⁰ The vector is a Murine Leukemia Virus (MLV) based retroviral vector that was developed in house as previously described.²³ T47D cells over-expressing HA-RASSF1A (T47D-1A), HA-RASSF1C (T47D-1C), or the MLV back bone (T47D-BB) were grown in RPMI-1640 medium supplemented with 10% calf bovine serum and 0.2 units/mL insulin.

Experimental animal model

Five-week old athymic female nude (Crl: CD-1Fox-n1nu, Charles River) mice were used, and 3x10⁶ cells at 70% confluence (cells in 200 ul of RPMI serum free medium) were injected subcutaneously into the flank, one injection per animal. Four mice were injected with T47D-BB, four mice were injected with T47D-1C, and four mice were injected with T47D-1A cells. Mice were monitored and tumors were measured twice weekly using a caliper for 6–8 weeks. After 8 weeks, tumors were harvested and tumor tissue was fixed in 4% paraformaldehyde and used for mRNA isolation and protein lysate preparation. Tumor volume for each group (n = 4) was calculated using the formula: 1/2(length × width²)^21,22 and all animals injected grew tumors that varied in size.

Frozen tumor tissue was grounded to a powder using a mortar and pestle and ground tissue was used for isolating mRNA using absolutely RNA Microprep Kit (Stratagene, La Jolla, CA) and for making cell lysates using RIPA buffer supplement with protease inhibitors. The animal study protocols were approved by the Loma Linda VA Medical Center IACUC.

qRT-PCR analysis

Expression of RASSF1A and RASSF1C in tumor tissue derived from cell lines was assessed by qRT-PCR using RASSF1A and RASSF1C specific primers. The PCR reactions were run using the following protocol: (1) incubate at 95 °C for 10 min, (2) incubate at 95 °C for 15 sec, (3) incubate for 30 sec, (4) go to line 2 for 39 more cycles, (5) melting curve from 60 °C to 95 °C, read every 1.0 °C, (6) incubate at 10 °C forever. qRT-PCR reactions were carried out in triplicate and the fold change was calculated using the 2^–δδC_T method.²⁶ RASSF1A forward primer is 5′GGCGTCGTGCGCAAAGGCC and RASFF1C-forward primer: is 5′CTGCAGCCAAGAGGACTCGG 3′, and the reverse primer for both RASSF1A and 1C is 5′GGGTGGCTTCTTGCTGGAGGG3′. Cyclophillin (housekeeping gene) forward primer 5′GCATACAGGTCCTGGCATCT3′ and Cyclophillin reverse primer 5′TCTTGCTGGTCTTGCCATTC3′.

Western blot analysis

HA-RASSF1A and HA-RASSF1C expression in tumor tissue was assessed by Western blot analysis using the following anti-bodies, mouse Mono anti-HA (Mon HA.11(16B12) Covance, Berkeley, CA), Mouse monoclonal p-ERK (E-4) (sc-7383, Santa Cruz, Biotechnology, CA), Mouse anti-panERK (Cat. 610123, BD Transduction Laboratory), and Goat anti-Mouse and Donkey anti-Rabbit fluorescently labeled secondary antibodies (IRDye^@680926-32220, LI-COR Biosciences) were used. Blots were incubated with appropriate primary antibody at a 1:1000 dilution in LI-COR blocking buffer (LI-COR Biosciences) overnight at 4 °C on a rotary shaker. After primary antibody incubation, blots were washed three times with 1XPBS with 0.1% Tween 20 (1XTPBS) for five minutes before adding the secondary antibody at 1:1000 dilution for one hour incubation at room temperature. After secondary antibody incubation, blots were washed with 1XTPBS) three time for five minutes and blot were scanned using Odyesey scanner. Western blots were repeated three times.

Histology and immunohistochemistry

Immunohistochemical staining of T47D xenograft sections for HA-RASSF1A and HA-RASSF1C fusion proteins was carried out with the diaminobenzidene (DAB) method. Five μm sections cut from paraffin-embedded blocks were deparaffinized, and 3% H₂O₂ was applied for 30 min at room temperature. Sections were then washed three times with H₂O and blocked with 20% normal horse serum (Vector Laboratories) for 30 min at 37 °C. Horse serum was removed and 1:1000 mouse anti-HA antibody (Covence) was applied for 1 h at room temperature. Sections were washed three times for 5 min each with PBS/Tween, and 1:1000 biotinylated anti-mouse IgG was applied for 30 min and sections were washed three times with PBS/Tween. Horeseradish peroxidase strepavidin (Vector Laboratories) was then applied for 20 min at room temperature at 1:200 dilutions. Sections were washed three times with PBS/Tween and DAB chromogen (Biocare Betazoid DAB Chromogen) for 5 min at room temperature and sections were washed three times with H₂O and counterstained with Hematoxylin (Harris Hematoxylin, Fisher Scientific).

Statistical analysis

Tumor volumes of xenografts from animals injected with T47D-HA-RASSF1A (T47D-1A), T47D-vector backbone (T47D-BB), and T47D-HA-RASSF1C (T47D-1C) human breast cancer cells were analyzed using the t-test.

Results

RASSF1C enhances breast cancer tumor growth

T47D cells over-expressing HA-RASSF1A (T47D-1A), HA-RASSF1C (T47D-1C) or the MLV back bone (T47D-BB) were injected subcutaneously in athymic nude mice to form tumors. Tumors were measured for 59 days after injection (Fig. 1A). Figure 1A shows that breast cancer cells over-expressing RASSF1A (T47D-1A) and control cells (T47D-BB) developed significantly smaller tumors compared to cells over-expressing RASSF1C (T47D-1C). Figure 1B shows representative mice growing T47D-1A, T47D-BB, and T47D-1C xenografts. Our findings are consistent with our hypothesis and clearly suggest that RASSF1C appears to function as a growth promoter in breast cancer cells.

Figure 1

(A) Tumor volume of xenografts from animals injected with T47D-HA-RASSF1A (T47D-1A), T47D-vector backbone (T47D-BB), and T47D-HA-RASSF1C (T47D-1C) human breast cancer cells were analyzed using the t-test. Human cancer cells over-expressing RASSF1C (T47D-1C) developed significantly larger tumors compared to cells over-expressing HA-RASSF1A (T47D-1A) or vector backbone (T47D-BB), P value < 0.05. (B) Representative mice growing tumors over-expressing T47D-HA-RASSF1A (T47D-1A), T47D-vector backbone (T47D-BB), and T47D-HA-RASSF1C (T47D-1C).

RASSF1A and RASSF1C are stably expressed in xenograft tissue

In order to determine if HA-RASSF1A and HA-RASSF1C were stably over-expressed in the appropriate xenograft tissue over the course of the experiment, we performed qRT-PCR which showed that RASSF1A and RASSF1C were expressed ≫ 15 fold higher compared to control. We also performed Western blot (Fig. 2) and immunohistochmistry(Fig. 3). Each of these methods clearly showed that both HA-RASSF1A and HA-RASSF1C were stably over-expressed in the appropriate tumors.

Figure 2

Western blot analysis of protein lyastes from xenografts derived from tumors of T47D-BB, T47D-1A, and T47D-1C.

Figure 3

Immunohistochemical analysis was carried out for HA-RASSF1A and HA-RASSF1C fusion proteins in T47D-derived tumors sections. The diaminobenzidene (DAB) method was used, and the HA-tag antibody was used as the primary antibody. (A) T47D-BB tumor is negative for HA-fusion protein. (B) T47D-1A tumor is positive HA-1A fusion protein (brown staining). (C) T47D-1C tumor is positive HA-1C fusion protein (brown staining).

RASSF1C over-expression increases ERK1/2 phosphorylation in vivo

Because previous in vitro work suggested that RASSF1C may function via activation of the MEK/ERK pathway,¹⁸ we measured activated ERK1/2 levels in tumors over-expressing T47D-BB and T47D-1C. Total cell lysates from subcutaneous tumors were subjected to Western blot analysis using antibodies specific for phosphorylated ERK1 and ERK2 (Fig. 4). The level of phosphorylated ERK1/2 in T47D-1C tumor tissue is much higher compared to that in T47D-BB tumor tissue. It should be noted that RASSF1A over-expression did not affect ERK1/2 phosphoryaltion(data not shown).

Figure 4

ERK1/2 activation was assessed in T47D-BB and T47D-1C derived tumor tissues.

Discussion

In previous studies we have shown that RASSF1C over-expression increases, and silencing of RASSF1C expression decreases, cell proliferation of breast and lung cancer cells in vitro.^22,23 We have also demonstrated that over-expression of RASSF1C enhances breast cancer cell migration and attenuates apoptosis, suggesting a growth promoting function(s) for RASSF1C.²³ Our previous in vitro findings suggest that RASSF1C and RASSF1A appear to have antagonistic functions in breast, lung, and bone cancer cells.^22,23 To further confirm the impact of RASSF1C on cancer cell growth, we have carried out animal studies using breast cancer cells stably over-expressing RASSF1C.

Our in vivo studies show that breast cancer cells stably over-expressing RASSF1C developed significantly larger tumors compared to cells over-expressing the vector back bone or over-expressing RASSF1A (Fig. 1). Our in vivo findings are consistent with our previously published in vitro work suggesting a growth promoting function for RASSF1C, and our findings are the first to demonstrate that over-expression of RASSF1A and RASSF1C have opposite effects on breast tumor growth in vivo. We confirmed the expression of HA-RASSF1A and HA-RASSF1C at protein levels (Figs. 3 and 4) in T47D-1A and -1C derived tumor tissues to demonstrate that both proteins were stably expressed. Our previous in vitro work and current in vivo work underscores a growth promoting function for RASSF1C which is opposite to that reported for ovarian, prostate, renal cancer cells.^21–23 As to why RASSF1C may exert stimulatory function in some human cancers such as osteosarcoma, breast cancer, and lung cancer cells,^21–23 and may exert inhibitory functions in prostate, kidney, and ovarian cancer cells^18–20 is still to be determined. One potential explanation for such opposite effects of RASSF1C in different types of human cancers may reflect tissue-specific actions of RASSF1C.

It will now be important to elucidate the mechanism(s)/pathway(s) through which RASSF1C exerts its growth promoting effects on breast cancer cells. Previously we have found that cancer cells over-expressing RASSF1C exhibited increased phosphorylation of ERK1/2.²² In the current study, we measured the levels of phosphorylated ERK1/2 in tumors over-expressing RASSF1C. We found that tumors derived from cells over-expressing RASSF1C showed increased levels of phosphorylated ERK1/2 compared to control (Fig. 4), suggesting that RASSF1C may exert its functions in part through the activation of the MEK/ERK1/2 pathway in vivo.

Obviously, more work is required to prove if there is indeed a link between RASSF1C activities and the activation of the MEK/ERK pathway, and we have studies in progress that are designed to address this question. In conclusion, although our previous and current findings provide evidence that RASSF1C is not a tumor suppressor, more insightful mechanistic work is required to demonstrate that RASSF1C, unlike RASSF1A, has growth promoting activities in breast cancer cells.

Author Contributions

MR participated in the design of the study, contributed to data analysis, and drafting of the manuscript. RA performed animal injections and tumor measurements and analysis. MA carried tissue culture work, RNA work, RT-PCR, western blot analysis. SB carried tissue culture and gene cloning work. SC prepared and viral vectors and viral cell transduction. NL performed histology and immunohistochemistry work. SM participated in drafting the manuscript. YA designed and supervised the study, carried out the gene silencing and over-expression work, and contributed to data analysis and drafting of the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by a grant from the Department of Surgery, Loma Linda University School of Medicine.

Competing Interests

Author(s) disclose no potential conflicts of interest.

Disclosures and Ethics

As a requirement of publication author(s) have provided to the publisher signed confirmation of compliance with legal and ethical obligations including but not limited to the following: authorship and contributorship, conflicts of interest, privacy and confidentiality and (where applicable) protection of human and animal research subjects. The authors have read and confirmed their agreement with the ICMJE authorship and conflict of interest criteria. The authors have also confirmed that this article is unique and not under consideration or published in any other publication, and that they have permission from rights holders to reproduce any copyrighted material. Any disclosures are made in this section. The external blind peer reviewers report no conflicts of interest.

Footnotes

Acknowledgment

The work was carried out at the Loma Linda VA Medical Center.

References

Dammann

, Li

, Yoon

J.H.

, Chin

P.L.

, Bates

, Pfeifer

G.P.

Epigenetic inactivation of a RAS association domain family protein from the lung tumor suppressor locus 3p21.3. Nat Genet. 2000; 25: 315–9.

Burbee

D.G.

, Forgacs

, Zochbauer-Muller

. Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst. 2001; 93: 691–9.

Agathanggelou

, Honorio

, Macartney

D.P.

. Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast, and ovarian tumors. Oncogene. 2001; 20: 1509–18.

Dammann

, Takahashi

, Pfeifer

The CpG island of the novel tumor suppressor gene RASSF1A is intensely methylated in primary small cell lung carcinoma. Oncogene. 2001; 20: 3563–7.

Dammann

, Yang

, Pfeifer

G.P.

Hypermethylation of the CpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21.3 locus, occurs in a large percentage of human breast cancers. Cancer Res. 2001; 61: 3105–9.

K.W.

, Kwong

, Hui

A.B.Y.

. High Frequency of Promoter Hypermethylation of RASSF1A in Nasopharyngeal Carcinoma. Cancer Res. 2001; 61: 3877–81.

, Ni

, Xu

. Methylation profiling of twenty promoter-CpG islands of genes which may contribute to hepatocellular carcinogenesis. Bio Med Central Cancer. 2002; 2: 1–14.

Dreijerink

, Braga

, Kuzmin

. The candidate tumor suppressor gene, RASS1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis. Proc Natl Acad Sci USA. 2001; 98: 7504–9.

Liu

, Yoon

J.H.

, Dammann

, Pfeifer

G.P.

Frequent hypermethylation of the RASSF1A gene in prostate cancer. Oncogene. 2000; 21: 6835–40.

10.

Kuzmin

, Gillespie

J.W.

, Protopopov

. The RASSF1A tumor suppressor gene is inactivated in prostate tumors and suppresses growth of prostate carcinoma cells. Cancer Res. 2002; 62: 3498–502.

11.

, Nishizaki

, Gao

. Expression of several genes in the human chromosome 3p21.3 homozygous deletion region by an adenovirus vector results in tumor suppressor activities in vitro and in vivo. Cancer Res. 2002; 62: 2715–20.

12.

Shivakumar

, Minna

, Sakamaki

, Pestell

, White

M.A.

The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D accumulation. Mol Cell Biol. 2002; 22: 4309–18.

13.

Tommasi

, Dammann

, Zhang

. Tumor susceptibility of RASSF1A knockout mice. Cancer Res. 2005; 65: 92–8.

14.

Matallanas

, Romano

, Yee

. RASSF1A elicits apoptosis through an MST2 pathway directing proapoptotic transcription by the p73 tumor suppressor protein. Mol Cell. 21, 2007; 27(6): 962–75.

15.

Thaler

, Hahnel

P.S.

, Schad

, Dammann

, Schuler

RASSF1A mediates p21Cip1/Waf1-dependent cell cycle arrest and senescence through modulation of the Raf-MEK-ERK pathway and inhibition of Akt. Cancer Res. 2009; 69(5): 1748–57.

16.

Thaler

, Schmidt

, Schad

, Sleeman

J.P.

RASSF1A inhibits estrogen receptor alpha expression and estrogen-independent signalling: implications for breast cancer development. Oncogene. 2012: 1–11.

17.

Ortiz-Vega

, Khokhlatchev

, Nedwidek

. The putative tumor suppressor RASSF1A homodimerizes and heterodimerizes with the Ras-GTP binding protein Nore1. Oncogene. 2002; 21: 1381–90.

18.

, Wang

, Protopopov

. Inactivation of RASSF1C during in vivo tumor growth identifies it as a tumor suppressor gene. Oncogene. 2004; 23: 5941–9.

19.

Vos

M.D.

, Martinez

, Elam

. A role for the RASSF1A tumor suppressor in the regulation of tubulin polymerization and genomic stability. Cancer Res. 2004; 64: 4244–50.

20.

Kitagawa

, Kajiho

, Negishi

. Release of RASSF1C from the nucleus by Daxx degradation links DNA damage and SAPK/JNK activation. EMBO J. 2006; 25: 3286–97.

21.

Amaar

Y.G.

, Baylink

D.J.

, Mohan

RAS association domain family protein, RASSF1C, is a binding partner and a potential regulator of osteoblast cell proliferation. J Bone Miner Res. 2005; 20: 1430–9.

22.

Amaar

Y.G.

, Minera

M.G.

, Hatran

L.K.

, Strong

D.D.

, Mohan

, Reeves

M.E.

Ras-association domain family 1C protein (RASSF1C) stimulates human lung cancer cell proliferation. Am J Physiol Lung Cell Mol Physiol. 2006; 291: 1185–90.

23.

Reeves

M.E.

, Baldwin

S.W.

, Baldwin

M.L.

. Ras-Association Domain Family 1C Protein Promotes Breast Cancer Cell Migration and Attenuates Apoptosis. BMC Cancer. 2010; 10: 562–76.

24.

Euhus

D.M.

, Hudd

, LaRegina

M.C.

, Johnson

F.E.

Tumor measurement in the nude mouse. J Surg Oncol. 1986; 31: 229–34.

25.

Jensen

M.M.

, Jørgensen

J.T.

, Binderup

, Kjaer

Tumor volume in subcutaneous mouse xenografts measured by microCT is more accurate and reproducible than determined by 18F-FDG-microPET or external caliper. MC Med Imaging. 16, 2008; 8: 16.

26.

Livak

K.J.

, Schmittgen

T.D.

Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods. 2001; 25: 402–8.

27.

Estrabaud

, Lassot

, Blot

. RASSF1C, an isoform of the tumor suppressor RASSF1A, promotes the accumulation of beta-catenin by interacting with betaTrCP. Cancer Res. 2007; 67: 1054–61.

Ras-Association Domain Family 1C Protein Enhances Breast Tumor Growth in Vivo

Abstract

Keywords

Introduction

Materials and Methods

Cell culture

Experimental animal model

qRT-PCR analysis

Western blot analysis

Histology and immunohistochemistry

Statistical analysis

Results

RASSF1C enhances breast cancer tumor growth

RASSF1A and RASSF1C are stably expressed in xenograft tissue

RASSF1C over-expression increases ERK1/2 phosphorylation in vivo

Discussion

Author Contributions

Funding

Competing Interests

Disclosures and Ethics

Footnotes

Acknowledgment

References