Sage Journals: Discover world-class research

Abstract

Early graft loss in islet transplantation means that a large amount of donor islets is required. Endothelial cells and endothelial colony-forming cells (ECFCs) have been reported to improve instant blood-mediated inflammatory reaction (IBMIR) in vitro. In this study, we examined if ECFC-coated porcine islets would prevent early graft loss in vivo. Human ECFCs were prepared from cord blood and cocultured with islets to make composite grafts. Diabetic nude mice underwent intraportal transplantation. Blood glucose levels were monitored, and morphological examination of the grafts along with analysis of the components of IBMIR and inflammatory reaction were performed with the liver tissues. The ECFC-coated islets significantly decreased blood glucose levels immediately after transplantation compared to the uncoated islets. Composite ECFC islet grafts were observed in the liver sections, associated with a more insulin⁺ area compared to that of the uncoated group within 48 h after transplantation. Deposition of CD41a, C5b-9, and CD11b⁺ cells was also decreased in the ECFC-coated group. Expression of porcine HMGB1 and mouse TNF-α was increased in the transplantated groups compared to the sham operation group, with a trend of a decreasing trend across the uncoated group, the ECFC-coated group, and the sham group. We demonstrated that the composite ECFC porcine islets transplanted into the portal vein of nude mice improved early graft loss and IBMIR in vivo.

Keywords

Islet transplantation (ITx)Instant blood-mediated inflammatory reaction (IBMIR)Endothelial colony-forming cells (ECFCs)Endothelial progenitor cell Early graft loss High-mobility group box 1 (HMGB1)

Introduction

Since the Edmonton group suggested islet transplantation (ITx) as a promising strategy for patients with type 1 diabetes (34,47), many approaches to improve the success rate of ITx have been tried, such as pancreas preservation methods (39), islet preparation methods (30,40,51), and novel immunosuppressive regimens (44,50). However, some hurdles still remain to establish the procedure as a widespread application. One of these hurdles is the shortage of islet source compared to candidate recipients. According to the Edmonton protocol, at least 12,000 islet equivalents (IEQs) per recipient body weight in kilograms were required (47), and this meant that multiple donors were necessary for one patient. Furthermore, according to the Immune Tolerance Network multicenter trial, less than half of the pancreas yielded an islet product suitable for transplantation (48). Although a protocol for single donor ITx has been suggested (18), clinical application of single donor ITx has not been established. Therefore, considering the limited number of deceased donors for pancreas, only a small number of patients with type 1 diabetes would have an opportunity of ITx.

The liver is the only site for ITx that has showed success in large animal models and is being used for clinical ITx. However, shortly after islet cells are transplanted into the liver via the portal vein, early graft loss occurs irrespective of immune recognition, which contributes to graft failure within a few weeks (17). Sufficient islet grafts are therefore required to compensate for the early graft loss, so it profoundly aggravates the shortage of islets. The instant blood-mediated inflammatory reaction (IBMIR) has been suggested as a main mechanism of early islet graft loss. IBMIR involves activation of the coagulation system and subsequent inflammation and is triggered by tissue factors expressed by islets (36,41). Recently, high-mobility group box 1 (HMGB1)-mediated interferon (IFN)-β production by granulocyte receptor 1-positive, cluster of differentiation 11b-positive (Gr-1⁺CD11b⁺) cells was demonstrated to be involved in the initial events of early graft loss (35). HMGB1 protein has been suggested as a prototype of the emerging damage-associated molecular pattern molecule (32,46). It is abundant in mouse islets (35), but the role of HMGB1 in islets remains to be clear.

A current strategy to overcome early graft loss in clinical ITx is the systemic use of heparin, but this has the potential risk of bleeding so enough doses cannot be applied. Therefore, some specific molecules or local modalities for IBMIR have been tried (4,13,35). One approach was composite islet–endothelial cell grafts, because endothelial cells readily tolerate contact with blood. Both in allo- and xeno-models, coating islets with human endothelial cells effectively inhibited IBMIR in vitro (21,25). In addition, endothelial cells were reported to have potent effects on angiogenesis in islets (31), which might enhance graft revascularization and survival. However, enough endothelial cells for coating the whole islets are difficult to obtain in the clinical setting, as mature endothelial cells located on the vessel walls are not easy to isolate. In addition, ex vivo expansion of endothelial cells is limited due to their maturity. Therefore, we have suggested endothelial colony-forming cells (ECFCs) instead of mature endothelial cells for the prevention of IBMIR (27).

Endothelial progenitor cells are present in the blood stream and bone marrow. Late outgrowth endothelial progenitor cells or ECFCs are thought to be the real progenitors of endothelial cells because they can generate perfusing vessels in vivo (27,42,53). Endothelial progenitor cells have been reported to be recruited to the pancreas in response to islet injury, suggesting that they are involved in pancreas neovascularization in physiological states (33). Furthermore, peripheral mobilization of endothelial progenitor cells has been shown to have a role in islet revascularization and engraftment after intraportal transplantation (8). In terms of IBMIR, there are several studies suggesting that endothelial progenitor cells might have better characteristics against coagulation and inflammation cascades compared to the mature endothelial cells (2,10,16,49). Therefore, we have examined if human ECFCs could prevent IBMIR in a xenogeneic model with porcine islets in vitro (27). In that study, porcine islets were cocultured with human ECFCs to obtain ECFC-coated islets, and then IBMIR by the islets was examained with tubing loop assay using human blood. The degree of IBMIR was assessed by platelet consumption and activation of C3a and thrombin–antithrombin complex and was compared to that of uncoated islets. The ECFC-coated islets showed a lower profile of IBMIR than uncoated islets. In addition, there was very little macroscopic or microscopic clotting in the ECFC-coated pig islets. In conclusion, the coating of pig islets with human ECFCs effectively prevented all components of xenogeneic IBMIR.

The current study is an extension of this previous in vitro report (27), investigating whether ECFC-coated pig islets can survive better against intraportal transplantation in vivo.

Materials and Methods

Isolation of Islets and Culture

Porcine islets of Langerhans were isolated as previously described (26,28). In brief, the pancreases of 20 female, 1-year-old adult farm pigs (slaughterhouse in Seoul, Korea) were harvested, administered with University of Wisconsin (UW) solution [prepared in-house from lactobionic acid (Biosesang, Kyunggi-do, South Korea), potassium monophosphate, magnesium sulfate, raffinose (Biosesang), allopurinol, glutathione, adenosine and pentastarch (Jeil Pharmaceutical, Seoul, South Korea); all from Sigma unless specified otherwise] and ice cold perfluorocarbon (PFC; FluoroMed, L.P., Round Rock, TX, USA). Liberase DL (Roche Biochemicals, Basel, Switzerland) in UW solution was infused into the main pancreatic duct and the tissue digested in a modified Ricordi chamber (Biorep Technologies, Miami, FL, USA). The islets were then purified using a density gradient in the COBE 2991 cell processor (Gambro BCT Inc., Lakewood, CO, USA). The islet-containing fractions were determined using dithizone (Sigma-Aldrich, St. Louis, MO, USA) staining. The isolated islet cells were cultured overnight in M199 medium (Gibco BRL, Grand Island, NY, USA) with 10% porcine serum (Gibco) at 37°C in 5% CO₂ humidified air.

Preparation of ECFCs and Culture

Human ECFCs were isolated and expanded according to the previous reports with minor modification (19,24,27). Umbilical cord blood (a total of four samples from males and females) was harvested from normal delivery of healthy women, and mononuclear cells were purified using density gradient (Optiprep; Fresenius Kabi Norge AS FOR Axis-Shield Poc AS, Oslo, Norway). The mono-nuclear cells were cultured on 2% gelatin-coated plates (gelatin: Sigma-Aldrich; 100-mm dish: Thermo Fisher Scientific, Roskilde, Denmark) with EGM-2 BulletKit medium (endothelial basal medium-2 supplemented with endothelial cell growth medium-2 SingleQuots; Lonza Inc., Walkersville, MD, USA). Unbound cells were washed out during 2–3 weeks of cultivation by replacement of the medium every 3 days. When the typical cobblestone-like ECFC colonies appeared, they were trypsinized (Gibco) and serially passaged for expansion. ECFCs at passage 3 were characterized as positive for endothelial markers and negative for leukocyte markers (19,42) by fluorescence-activated cell sorting with BD FACSCalibur machine (BD-Pharmingen, San Diego, CA, USA). ECFCs at passages 8–10 were used for islet coating. The Institutional Review Board (IRB) of Seoul National University Hospital approved this study protocol (IRB number H-0903-082-276), and informed consent was obtained from all subjects who provided cord blood.

Islet Coating with ECFCs

On the next day after islet isolation, islets were cocultured with ECFCs as previously described with minor modification (27). ECFCs were suspended as 6 × 10⁶ cells/1.5 ml EGM-2 BulletKit medium (Lonza Inc., Walkersville, MD, USA). Islet cells were prepared as 10,000 IEQs in 1.5 ml of M199 medium. Equal volume of each preparation was mixed and incubated at 37°C for 2 h with gentle tapping every 15 min. And then the islets and ECFCs were transferred to 150-mm petri dishes (SPL Lifesciences, Gyeonggi-do, Korea) and cultured overnight. The culture medium for coculturing was made up of M199, EGM-2 BulletKit, and 5% fetal bovine serum (FBS; Gibco). The untreated, control islets underwent the same procedure without ECFCs. The extent of ECFC coverage of the islet surface was evaluated by fluorescent microscopy (IX71, OLYMPUS, Tokyo, Japan) after staining the ECFCs using the green fluorescent cell linker dye PKH-67 (MINI67 membrane label, Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer's instructions.

In Vitro Effects of ECFC Coating of Islets

The ECFC-coated islets were compared to the uncoated islets in function and viability in vitro. Islet function before and after ECFC coating was evaluated using a static stimulation test, the glucose-stimulated insulin secretion (GSIS) test, where the islets were incubated in Krebs–Ringer bicarbonate 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES) buffer (Gibco) with low (3 mM), high (20 mM), and relowered (3 mM) glucose (Sigma) serially for 60 min at each concentration. The soup from each incubation period was collected, and insulin levels were determined with an immunoradiometric assay kit (TFB, Tokyo, Japan). We calculated stimulation index by the ratio of insulin release in the high to that in the low or relowered glucose. Islet viability was estimated by the ratio of islet volume (IEQ) before and after ECFC coating. The sizes of all islets in a given volume were determined by light microscopy (IX71, OLYMPUS, Tokyo, Japan) after staining with diphenylthiocarbazone (Sigma), and we converted them into IEQs, which is the volume of a spherical islet with a diameter of 150 μm (an algorithm to calculate the 150-μm diameter islet as 1 IEQ).

Islet Transplantation Through Portal Vein of Nude Mouse

The experiment protocols were approved by the Institutional Animal Care and Use Committee of the Institute of Laboratory Animal Resources, Seoul National University. Seventy male athymic BALB/c nude mice (Oriental Co. Ltd., Seoul, Korea) were used as recipients. Diabetes was induced by intraperitoneal streptozotocin (STZ; Sigma) injection (200 mg/kg body weight in citrate buffer; Sigma) at the age of 8 weeks. After 1 week later, mice with nonfasting glucose levels over 350 mg/dl (ONETOUCH Ultra Blood Glucose Monitoring System; LifeScan, Inc., Milpitas, CA, USA) for two consecutive days were selected as recipients. They were anesthetized with an intramuscular injection of a mixture of xylazine (10 mg/kg; Bayer Korea Ltd., Seoul, Korea) and zoletil (25 mg/kg; VIRBAC Laboratories, Carros, France). Ten thousand IEQs of porcine islets with or without an ECFC coating were transplanted into the liver via the portal vein with a 27-gauge needle (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) according to the previously described method (29). For a control group, we injected M199 media into the portal vein instead of islets (sham operation group).

Graft Function

Daily fed blood glucose levels were monitored from tail veins of recipients. If blood glucose levels were less than 350 mg/dl consecutively, the grafts were considered to have worked.

Morphologic Examination of Islet Grafts

For morphological examination of liver tissues, the recipients' liver tissues were harvested 6 h and 2 days after transplantation. The tissues were divided into three pieces, fixed in formaldehyde, embedded in paraffin blocks, and subsequently stained with mouse anti-porcine insulin, tetramethylrhodamine isothiocyanate Bandeiraea simplicifolia lectin (TRITC-BS1-lectin), fluorescein isothiocyanate Ulex europaeus agglutinin I-lectin (FITC-UEA1-lectin; all products from Sigma, St. Louis, MO, USA) and rabbit antimouse cluster of differentiation 11b (CD11b), complement component 5b-9 (C5b-9), and rat anti-mouse CD41a (all from Abcam, Cambridge, UK). Terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) (Roche Applied Science, Indianapolis, IN, USA) combined with insulin immunohistochemical (IHC) staining was conducted to identify apoptotic β-cells. Hematoxylin and eosin (Sigma-Aldrich) was used as a counterstain. The stained samples were observed using light and confocal microscope (BX51, OLYMPUS, Tokyo, Japan; LSM710, Carl Zeiss, Jena, Germany, respectively). Relative insulin⁺ volume was estimated by point counting with three different pieces from each mouse (22,23,38): using a 56-point grid, number of points covered by insulin⁺ area and number of points covered by total liver tissue were counted, and the former was divided by the latter. An average of 78,000 points/mouse was counted. Deposits of CD41 and C5b-9 and infiltration of CD11b⁺ leukocytes on the islet grafts were divided semiquantitatively into four categories: 0 = no observed deposits, 1 = a few deposits, 2 = moderate deposits, 3 = massive deposits. More than 15 sections from the each experimental group were evaluated for each marker (9,37).

Quantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis of the Liver Tissues

For quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis, liver tissues 6 h after transplantation were harvested. mRNA was extracted from the tissues using an RNeasy mini kit (QIAGEN, Gaithersburg, MD, USA). cDNA was synthesized with 1 mg of RNA and applied to PCR with a 7500 Real-Time PCR System (Applied Biosystem, Foster City, CA, USA). The reaction mixture for each qRT-PCR was performed using 10 μl of SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan), 1 μl (5 pmol) of each primer and 2 μl cDNA, and in a total reaction volume of 20 μl. The PCR conditions were 50°C (2 min), 95°C (10 min), and 40 cycles of 95°C (15 s), 60°C (1 min). Sequences of the primers are presented in Table 1. Triplicate reactions for each experimental sample were conducted in 96-well plates (Thermo Fisher Scientific), and the levels of gene expression were calculated based on the threshold cycle value.

Table 1.

Primer Sequences for PCR

Gene	Forward	Reverse
Porcine HMGB1	TTGAAGACATGGCAAAGGCG	CCTCTTCGTCCTCCTCCTCC
Mouse IL-1β	ACACCCACCCTGCAGCTGGA	TGAGCGACCTGTCTTGGCCG
Mouse TNF-α	CCTCCTGGCCAACGGCATGG	TAGACCTGCCCGGACTCCGC
Mouse IL-12	CACACTGGACCAAAGGGACT	TGATGAAGAAGCTGGTGCTG
Mouse IFN-γ	GGCCATCAGCAACAACATAA	TGAGCTCATTGAATGCTTGG

HMGB1, high-mobility group box 1; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon.

Statistical Analysis

All values are expressed as mean ± standard error of the mean even with nonparametric data for uniformity. Daily blood glucose levels were compared using repeated measures analysis of variance (ANOVA). Comparisons of morphological characteristics were performed by the Mann–Whitney U test. A nonparametric test for trend across the groups with qRT-PCR results was applied by using Cuzick's test (Stata command: nptrend). Statistical analyses were conducted by SPSS 17.0 (SPSS Inc., Chicago, IL, USA) and Stata 11.2 (Statacorp, College Station, TX, USA). Values of p < 0.05 were considered statistically significant.

Results

ECFC Coating and Islet Quality

In the present study, 20 isolations of adult pig islets were used. The average yield on the day of isolation was 239,086 ± 43,170 IEQs. On the next day, the GSIS test was performed before the islets were coated with ECFCs, and the average stimulation index was 1.91 ± 0.45. After overnight incubation of the islets with ECFCs, about 10% of the islets were entirely covered by ECFCs, but most of the islets were only partially covered by ECFCs (Fig. 1A). On average 35% coverage of the islets was observed. Overnight coculture with ECFCs did not affect the islet function and volume (Fig. 1B and C).

Figure 1.

Coverage, function, and viability of ECFC-coated islets in vitro. To examine coverage of endothelial colony-forming cell (ECFC) coating, ECFCs were labeled with green fluorescent dye PKH-67 before coculture. After overnight coculture with porcine islets (6 × 10⁶ ECFCs per 10,000 IEQs) as described in Materials and Methods, diphenylthiocarbazone staining was performed to observe the islet cells (red). We observed the coated islets with a fluorescence microscope (left panel) and with a light microscope (middle). Right panel indicates a merged picture. An average coverage of 35% was observed. (B) Glucose-stimulated insulin secretion (GSIS) was evaluated using stimulation index, which was calculated by the ratio of insulin release in the high (20 mM glucose) to that in the low or re-lowered (3 mM glucose) glucose in the medium. (C) Islet viability was estimated by the ratio of islet volume (IEQ) before and after ECFC coating. Insulin-releasing function and cell viability of ECFC-coated islets were not different from those of uncoated islets. Four independent experiments were performed, and the Mann–Whitney U test was applied for the comparisons. NS, no significant difference.

Porcine Islet Function After Transplantation to Athymic Diabetic Mice Through Portal Vein

We selected STZ-athymic mice whose random blood glucose levels were over 350 mg/dl consecutively. Before ITx, there was no difference in blood glucose levels between the two groups, which averaged 488 ± 14 mg/dl. Among the 10 mice in the uncoated islet group, graft function was observed only in two mice during the first week after ITx, while graft function was observed in four of nine mice of the ECFC-coated group (Table 2). Although the mice in the ECFC-coated islet group could not maintain normoglycemia, the blood glucose levels after ITx were significantly reduced, and this led to a statistically significant difference in the glucose levels between the uncoated islet group and the ECFC-coated islet group during the first week after ITx (repeated measures ANOVA, F = 5.55, p < 0.05) (Fig. 2A).

Figure 2.

Function and viability of the grafts in the liver of athymic diabetic mice. (A) Fed blood glucose levels were monitored before and immediately after islet transplantation (ITx). A significant decrease in the ECFC-coated islet group was detected compared to the uncoated islet group during the first week after ITx. Repeated-measures ANOVA was applied for the comparisons between the groups. (B–E) On the second day after ITx, the recipients' livers were harvested and stained. Hematoxylin and eosin (H&E) stain (B, C) revealed thrombi in the grafts (arrowheads) and degeneration of liver tissue around some grafts (left side of the dotted lines). Immunohistochemical (IHC) stain (D, E) demonstrated composite islet-ECFC grafts in the ECFC-coated group: anti-insulin (white), anti-human lectin [Ulex europaeus agglutinin 1 (UEA1), red] indicating ECFCs, and anti-mouse lectin [Bandeiraea simplicifolia (BS1), green]. (F) Insulin IHC stain and terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) was performed with the liver tissues. β-Cells were stained brown and apoptotic nuclei were labeled blue (arrows). Insulin⁺ area and the number of grafts on the liver sections were evaluated using point counting at 6 h (G) and at 2 days (H) after ITx. Apoptotic β-cells were calculated by the number of TUNEL⁺ nuclei over insulin⁺ area. The Mann–Whitney U test was applied for the comparisons.

Table 2.

Porcine Islet Graft Function After Intraportal Transplantation Into Athymic Diabetic Mice

Group	n	Individual Graft Function (days)	Mean Graft Function (Days)
Uncoated islet	10	0(×8), 2, 3	0.5 ± 1.1
ECFC-coated islet	9	0(×5), 2, 3, 3, 4	1.3 ± 1.7

ECFC, endothelial colony-forming cell.

Morphologic Examination of the Liver Tissues Where the Islets Were Implanted

The liver tissues of the recipients were harvested on the second day after transplantation, and the grafts were identified. Representative hematoxylin and eosin (H&E) stain of the grafts are presented (Fig. 2B and C) with corresponding confocal microscopy after immunofluorescence staining (Fig. 2D and E). According to the H&E stains, many of the grafts were associated with clots and thrombi (arrowheads in Fig. 2B and C) with infarction of adjacent liver tissue (left side of the dotted lines in Fig. 2B and C), which was more severe in the uncoated islet groups. According to the immunofluorescence staining for insulin (white), human lectin (UEA1, red) indicating ECFCs, and mouse lectin (BS1, green), we could find composite islet-ECFC grafts in the ECFC-coated islet group (Fig. 2E), which were not found in the uncoated islet group (Fig. 2D). The relative graft volume estimated from three different liver pieces of each recipient was measured after TUNEL-insulin IHC staining (Fig. 2F, brown for insulin, blue for TUNEL, arrows). Insulin⁺ area and graft numbers 6 h after ITx were not significantly different between the two groups (Fig. 2G). However, 2 days after ITx, these values were about 1.8 times more in the ECFC-coated islet group compared to the uncoated islet group (Fig. 2H). These results suggested that the better graft function in the ECFC-coated islet group during the first week after ITx came from better graft survival, and it was associated with the intact ECFC-composite islets. β-Cell apoptosis evaluated with TUNEL was comparable between the two groups, which meant that the difference in graft volume did not result from apoptotic cell death during the period.

Next, we examined if the better graft survival was related to IBMIR. Deposition of CD41a and C5b-9 and infiltration of CD11b⁺ leukocytes (polymorphonuclear neutrophils and monocytes) were found around the grafts after IHC staining. Representative pictures are shown in Figure 3. According to semiquantitative scoring from three different liver pieces of each recipient, the markers of IBMIR were decreased in the ECFC-coated islet group compared to the uncoated group as depicted on the graph in Figure 3. We could speculate that components of IBMIR—platelets, complements, and CD11b⁺ leukocytes—were downregulated when the islet grafts were coated with ECFCs.

Figure 3.

Detection of the components of IBMIR in the liver sections. The liver sections from the recipients 6 h after transplantation were double-stained for insulin (brown) and markers of instant blood-mediated inflammatory reaction (IBMIR; blue): cluster of differentiation 41a (CD41a; A), complement component 5b-9 (C5b-9; B), and CD11b (C) for observation of platelets, complement and CD11b⁺ leukocytes, respectively. Deposition of the markers was scored semiquantitatively as indicated on the graph, and they were observed to be diminished significantly in the ECFC-coated islet group compared to the uncoated group. The Mann–Whitney U test was applied for the comparisons.

Analysis of the Inflammatory Markers in the Liver Tissues with qRT-PCR

We measured the mRNA expression of porcine HMGB1, mouse IFN-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-12, and IL-1β in the liver 6 h after ITx (Fig. 4). Expression of porcine HMGB1 and mouse TNF-α was significantly decreased across the uncoated, the ECFC-coated, and the sham control groups. IFN-γ induction showed a tendency to decrease across the groups, but there was no statistical significance. Expression of IL-12 and IL-1β was not different among the groups.

Figure 4.

mRNA expression of inflammatory cytokines in the liver tissues. The liver tissues 6 h after transplantation were used for quantitative RT-PCR of porcine high-mobility group box 1 (HMGB1) and mouse inflammatory cytokines. A nonparametric test for trend (Cuzick's test) was performed across the uncoated group, the ECFC-coated group and the sham control group in order, and it revealed a decreasing trend for HMGB1 and tumor necrosis factor-α (TNF-α). IL, interleukin; IFN, interferon.

Discussion

We evaluated the effects of ECFCs on the early graft loss following porcine islet infusion into the portal vein of athymic nude mice. We could observe significant difference in glucose levels between the ECFC-coated and the uncoated groups within 1 week, although we failed to maintain normoglycemia after ITx. Porcine islet grafts transplanted into portal vein have been known not to survive in the long term [e.g., studies by Goto et al. (12,13)]. They reported that the duration of porcine islet graft survival was about 4 days in nude mice transplanted through the portal vein. Survival was not different in immunocompetent recipients (3.5 days). Notably, 30% of the nude mouse recipients completely failed to reduce nonfasting glucose levels in these studies. A similar study showed a similar effect (5). These poor outcomes with porcine islets in the intraportal models could be caused in part by the fact that porcine islets do not have a fibrous capsule-like mouse or human islets, except in neonatal pigs. This might aggravate the fragility of porcine islet grafts, in addition to other mechanisms of early graft loss. In the current study, we used larger amounts of islets (10,000 IEQs) than Goto's group (5,000 IEQs), but our graft survival and glucose lowering effects were not better than those of Goto's group (12,13), an effect contributed by many factors. First, the quality of pig islets seems to be different. We have obtained consistent stimulation indices of 1.7–2.2 during our work with adult farm pigs (25–28), which are comparable to those of other studies (15,45): 1.5–2.6. The stimulation index of islets in the current experiments averaged 1.9, while that in Goto's group was 2.8–3.4. The different insulin-releasing function could have caused the different graft efficacy. Second, we used athymic BALB/c nude mice as recipients, and Goto et al. used athymic C57BL/6J nude mice. Differences in the genetic background, age, and body weight of the mice could induce differences in tolerance to the toxicity of STZ and in glucose homeostasis. Another possible factor that attenuated graft function in our experiments might be interspecies interactions: human (ECFCs), pig (donors), and mouse (recipients). We plan to examine the usefulness of human ECFCs in clinical ITx, but it is difficult to obtain human islets. Next to human islets, porcine islets are potential candidates for clinical ITx, so pigs were selected as donors in our experiments. If human islets had been available in this study model, the effects of ITx and/or ECFCs on the glucose levels may have been more obvious. Meanwhile, ECFC coverage in our experiments was 35% after overnight coculture, and such a low coverage rate might lead to a lower efficacy of ECFCs than that observed with higher coverage. However, when we extended the period of coculture to improve the coverage rate, in vitro islet viability significantly decreased. Therefore, we chose a short duration of coculture in spite of low coverage. Although blood glucose levels were not reduced sufficiently in our experiments, we speculated that the islet grafts might have a favorable function on the homeostasis of the recipients. We observed 16% mortality in the ITx groups regardless of ECFC coating, compared to 75% in the STZ-diabetic control mice without ITx (sham control group), during extended monitoring of up to 5 weeks after STZ injection.

As seen in Figure 2G and H, we evaluated relative graft volume in the recipients' liver tissues using point counting following insulin IHC staining, which has been usually applied in β-cell mass analysis in pancreas tissues (22,23,38). We found a higher graft area and number from the ECFC-coated islet group compared to those from the uncoated islet group within 48 h after ITx. We assumed that the failure of statistical significance at 6 h might result from the small number of samples (n = 5 in each group) and of points counted in this analysis (54,000 points/mouse for 6 h samples vs. 101,000 points/mouse for day 2 samples). According to TUNEL, the ratio of apoptotic β-cells among total β-cells was comparable between the ECFC-coated and uncoated groups (Fig. 2H), so the difference in graft mass is likely to arise from other mechanisms, such as IBMIR.

IBMIR has been reported not only in human transplantation (20,36) but also in mice recipients (7,9,12). We have demonstrated that ECFC coating of porcine islets reduced components of IBMIR in an in vitro loop model (27). In the current study, we demonstrated reduced deposition of platelets and C5b-9 and reduced infiltration of CD11b⁺ leukocytes around the islet grafts in the ECFC-coated group in vivo (Fig. 3). Therefore, we could speculate that ECFC coating of porcine islets inhibited the coagulation cascade in vivo and contributed to the reduction of early graft loss. Low molecular weight dextran sulfate has been effective in inhibiting IBMIR, but residual complement activation was found (13,14). Application of ECFCs in ITx would improve the effects of low molecular weight dextran sulfate or low dose heparin. In addition, there is a possibility that a combination with endothelial cells coating islets (21) would improve our outcome to overcome IBMIR, too.

We evaluated some cytokines to examine the effects of ECFCs on the inflammatory reaction (Fig. 4). First, we measured the porcine HMGB1 expression in the liver, which can be a marker for pig islet destruction and a mediator for early graft loss (11,35). It was significantly increased in the uncoated group compared to the sham control group, and there was a significant trend of decrease across the uncoated, the ECFC-coated, and the sham control groups. The difference of HMGB1-mediated IFN-γ induction was less significant, without statistical significance among the groups. Expression of mouse TNF-α was also significantly elevated in the uncoated group compared to the sham control group, with a trend for a decrease across the groups, too. However, expression of IL-12 and IL-1β in the ITx groups was comparable to that in the sham control (Fig. 4). This attenuated induction of inflammatory responses from islet infusion might result from the mouse model we used. The athymic nude mouse may have natural killer T (NKT) cell deficiency (3,43), and the induction of IL-12 and IFN-γ by HMGB1 was reported to be dependent on NKT cells (35). Yang et al. described only a twofold increase in the expression of IFN-γ and TNF-α by islet grafts implanted under the kidney capsule of severe combined immunodeficiency mice, unlike immunocompetent mouse models (52). Other studies with immunocompetent mice also reported a profound increase in inflammatory cytokine expression (7,9). As the proinflammatory cytokines were not prominently induced by ITx, the effects of ECFCs on the inflammatory response seem to be equivocal. It would be appropriate for HMGB1-mediated inflammatory pathways in early graft loss to be examined within immunocompetent recipient models (6).

In summary, we demonstrated the favorable effects of human ECFCs on the IBMIR and early graft loss in the case of porcine islets transplanted into mouse liver. Human islets have been reported to elicit IBMIR (1,20,21), and so it is an important problem to solve in clinical ITx. It is easier to obtain adequate quantities of ECFCs compared to mature endothelial cells, and ECFCs also have a potential to enhance revascularization of islet grafts (8,24,27,33). Therefore, ECFCs could be another breakthrough in human ITx, especially if ECFCs can be effectively prepared specifically to recipients

Footnotes

Acknowledgments

We thank Chang-Hoon Lee, M.D., for technical assistance in statistical analysis. This study was supported by a grant from the Innovative Research Institute for Cell Therapy (A062260) by the Ministry of Health and Welfare, Republic of Korea. The authors declare no conflicts of interest.

References

Akima

; Hawthorne

W. J.

; Favaloro

; Patel

; Blyth

; Mudaliar

; Chapman

J. R.

; O'Connell

P. J.

Tirofiban and activated protein C synergistically inhibit the instant blood mediated inflammatory reaction (IBMIR) from allogeneic islet cells exposure to human blood. Am. J. Transplant. 9(7): 1533–1540; 2009.

Basire

; Sabatier

; Ravet

; Lamy

; Mialhe

; Zabouo

; Paul

; Gurewich

; Sampol

; Dignat-George

High urokinase expression contributes to the angiogenic properties of endothelial cells derived from circulating progenitors. Thromb. Haemost. 95(4): 678–688; 2006.

Bendelac

; Rivera

M. N.

; Park

S. H.

; Roark

J. H.

Mouse CD1-specific NK1 T cells: Development, specificity, and function. Annu. Rev. Immunol. 15: 535–562; 1997.

Berman

D. M.

; Cabrera

; Kenyon

N. M.

; Miller

; Tam

S. H.

; Khandekar

V. S.

; Picha

K. M.

; Soderman

A. R.

; Jordan

R. E.

; Bugelski

P. J.

; Horninger

; Lark

; Davis

J. E.

; Alejandro

; Berggren

P. O.

; Zimmerman

; O'Neil

J. J.

; Ricordi

; Kenyon

N. S.

Interference with tissue factor prolongs intrahepatic islet allograft survival in a nonhuman primate marginal mass model. Transplantation 84(3): 308–315; 2007.

Brandhorst

; Brandhorst

; Zwolinski

; Nahidi

; Bretzel

R. G.

Prevention of early islet graft failure by selective inducible nitric oxide synthase inhibitors after pig to nude rat intraportal islet transplantation. Transplantation 71(2): 179–184; 2001.

Chen

; Kuehn

; Bretzel

R. G.

; Linn

Anti-inflammatory thalidomide improves islet grafts survival and functions in a xenogenic environment. PLoS One 4(7): e6312; 2009.

Contreras

J. L.

; Eckstein

; Smyth

C. A.

; Bilbao

; Vilatoba

; Ringland

S. E.

; Young

; Thompson

J. A.

; Fernandez

J. A.

; Griffin

J. H.

; Eckhoff

D. E.

Activated protein C preserves functional islet mass after intraportal transplantation: A novel link between endothelial cell activation, thrombosis, inflammation, and islet cell death. Diabetes 53(11): 2804–2814; 2004.

Contreras

J. L.

; Smyth

C. A.

; Eckstein

; Bilbao

; Thompson

J. A.

; Young

C. J.

; Eckhoff

D. E.

Peripheral mobilization of recipient bone marrow-derived endothelial progenitor cells enhances pancreatic islet revascularization and engraftment after intraportal transplantation. Surgery 134(2): 390–398; 2003.

Cui

; Wilson

J. T.

; Wen

; Angsana

; Qu

; Haller

C. A.

; Chaikof

E. L.

Thrombomodulin improves early outcomes after intraportal islet transplantation. Am. J. Transplant. 9(6): 1308–1316; 2009.

10.

Daculsi

; Remy-Zolghadri

; Grellier

; Conrad

; Fernandez

; Bareille

; Bordenave

Signal transduction and procoagulant state of human cord blood—progenitor-derived endothelial cells after interleukin-1alpha stimulation. Endothelium 14(3): 163–171; 2007.

11.

Gao

; Ma

L. L.

; Gao

; Yan

; Williams

; Yin

D. P.

TLR4 mediates early graft failure after intraportal islet transplantation. Am. J. Transplant. 10(7): 1588–1596; 2010.

12.

Goto

; Groth

C. G.

; Nilsson

; Korsgren

Intraportal pig islet xenotransplantation into athymic mice as an in vivo model for the study of the instant blood-mediated inflammatory reaction. Xenotransplantation 11(2): 195–202; 2004.

13.

Goto

; Johansson

; Maeda

; Elgue

; Korsgren

; Nilsson

Low molecular weight dextran sulfate prevents the instant blood-mediated inflammatory reaction induced by adult porcine islets. Transplantation 77(5): 741–747; 2004.

14.

Goto

; Tjernberg

; Dufrane

; Elgue

; Brandhorst

; Ekdahl

K. N.

; Brandhorst

; Wennberg

; Kurokawa

; Satomi

; Lambris

J. D.

; Gianello

; Korsgren

; Nilsson

Dissecting the instant blood-mediated inflammatory reaction in islet xenotransplantation. Xenotransplantation 15(4): 225–234; 2008.

15.

Graham

M. L.

; Bellin

M. D.

; Papas

K. K.

; Hering

B. J.

; Schuurman

H. J.

Species incompatibilities in the pig-to-macaque islet xenotransplant model affect transplant outcome: A comparison with allotransplantation. Xenotransplantation 18(6): 328–342; 2011.

16.

; Peterson

T. E.

; Holmuhamedov

E. L.

; Terzic

; Caplice

N. M.

; Oberley

L. W.

; Katusic

Z. S.

Human endothelial progenitor cells tolerate oxidative stress due to intrinsically high expression of manganese superoxide dismutase. Arterioscler. Thromb. Vasc. Biol. 24(11): 2021–2027; 2004.

17.

Hering

B. J.

; Geier

; Schultz

A. O.

; Bretzel

R. G.

; Federlin

International Islet Transplant Registry 5: 1; 1995.

18.

Hering

B. J.

; Kandaswamy

; Ansite

J. D.

; Eckman

P. M.

; Nakano

; Sawada

; Matsumoto

; Ihm

S. H.

; Zhang

H. J.

; Parkey

; Hunter

D. W.

; Sutherland

D. E.

Single-donor, marginal-dose islet transplantation in patients with type 1 diabetes. JAMA 293(7): 830–835; 2005.

19.

Hur

; Yoon

C. H.

; Kim

H. S.

; Choi

J. H.

; Kang

H. J.

; Hwang

K. K.

; Oh

B. H.

; Lee

M. M.

; Park

Y. B.

Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis. Arterioscler. Thromb. Vasc. Biol. 24(2): 288–293; 2004.

20.

Johansson

; Lukinius

; Moberg

; Lundgren

; Berne

; Foss

; Felldin

; Kallen

; Salmela

; Tibell

; Tufveson

; Ekdahl

K. N.

; Elgue

; Korsgren

; Nilsson

Tissue factor produced by the endocrine cells of the islets of Langerhans is associated with a negative outcome of clinical islet transplantation. Diabetes 54(6): 1755–1762; 2005.

21.

Johansson

; Elgue

; Nilsson

; Korsgren

Composite islet-endothelial cell grafts: A novel approach to counteract innate immunity in islet transplantation. Am. J. Transplant. 5(11): 2632–2639; 2005.

22.

Jung

H. S.

; Ahn

Y. R.

; Oh

S. H.

; Kim

Y. S.

; No

; Lee

M. K.

; Kim

K. W.

Enhancement of beta-cell regeneration by islet transplantation after partial pancreatectomy in mice. Transplantation 88(3): 354–359; 2009.

23.

Jung

H. S.

; Chung

K. W.

; Won Kim

; Kim

; Komatsu

; Tanaka

; Nguyen

Y. H.

; Kang

T. M.

; Yoon

K. H.

; Kim

J. W.

; Jeong

Y. T.

; Han

M. S.

; Lee

M. K.

; Kim

K. W.

; Shin

; Lee

M. S.

Loss of autophagy diminishes pancreatic beta cell mass and function with resultant hyperglycemia. Cell Metab. 8(4): 318–324; 2008.

24.

Kang

; Park

H. S.

; Jo

; Hong

S. H.

; Lee

H. N.

; Lee

Y. Y.

; Park

J. S.

; Jung

H. S.

; Chung

S. S.

; Park

K. S.

Endothelial progenitor cell cotransplantation enhances islet engraftment by rapid revascularization. Diabetes 61(4): 866–876; 2012.

25.

Kim

H. I.

; Yu

J. E.

; Lee

S. Y.

; Sul

A. Y.

; Jang

M. S.

; Rashid

M. A.

; Park

S. G.

; Kim

S. J.

; Park

C. G.

; Kim

J. H.

; Park

K. S.

The effect of composite pig islet-human endothelial cell grafts on the instant blood-mediated inflammatory reaction. Cell Transplant. 18(1): 31–37; 2009.

26.

Kim

J. H.

; Kim

H. I.

; Lee

K. W.

; Yu

J. E.

; Kim

S. H.

; Park

H. S.

; Park

C. G.

; Ihm

S. H.

; Ha

; Kim

S. J.

; Lee

H. K.

; Ahn

; Park

K. S.

Influence of strain and age differences on the yields of porcine islet isolation: Extremely high islet yields from SPF CMS miniature pigs. Xenotransplantation 14(1): 60–66; 2007.

27.

Kim

J. H.

; Oh

B. J.

; Lee

H. N.

; Park

H. S.

; Park

S. G.

; Park

K. S.

Endothelial colony-forming cell coating of pig islets prevents xenogeneic instant blood-mediated inflammatory reaction. Cell Transplant. 20(11-12): 1805–1815; 2011.

28.

Kim

J. H.

; Park

S. G.

; Lee

H. N.

; Lee

Y. Y.

; Park

H. S.

; Kim

H. I.

; Yu

J. E.

; Kim

S. H.

; Park

C. G.

; Ha

; Kim

S. J.

; Park

K. S.

ATP measurement predicts porcine islet transplantation outcome in nude mice. Transplantation 87(2): 166–169; 2009.

29.

Lacy

P. E.

; Davie

J. M.

; Finke

E.H.

Prolongation of islet xenograft survival (rat to mouse). Diabetes 30(4): 285–291; 1981.

30.

Lau

; Henriksnäs

; Svensson

; Carlsson

P. O.

Oxygenation of islets and its role in transplantation. Curr. Opin. Organ Transplant. 14(6): 688–693; 2009.

31.

Linn

; Schneider

; Hammes

H. P.

; Preissner

K. T.

; Brandhorst

; Morgenstern

; Kiefer

; Bretzel

R. G.

Angiogenic capacity of endothelial cells in islets of Langerhans. FASEB J. 17(8): 881–883; 2003.

32.

Lotze

M. T.

; Tracey

K. J.

High-mobility group box 1 protein (HMGB1): Nuclear weapon in the immune arsenal. Nat. Rev. Immunol. 5(4): 331–342; 2005.

33.

Mathews

; Hanson

P. T.

; Ford

; Fujita

; Polonsky

K. S.

; Graubert

T. A.

Recruitment of bone marrow-derived endothelial cells to sites of pancreatic beta-cell injury. Diabetes 53(1): 91–98; 2004.

34.

Matsumoto

Clinical allogeneic and autologous islet cell transplantation: Update. Diabetes Metab. J. 35(3): 199–206; 2011.

35.

Matsuoka

; Itoh

; Watarai

; Sekine-Kondo

; Nagata

; Okamoto

; Mera

; Yamamoto

; Yamada

; Maruyama

; Taniguchi

; Yasunami

High-mobility group box 1 is involved in the initial events of early loss of transplanted islets in mice. J. Clin. Invest. 120(3): 735–743; 2010.

36.

Moberg

; Johansson

; Lukinius

; Berne

; Foss

; Kallen

; Ostraat

; Salmela

; Tibell

; Tufveson

; Elgue

; Nilsson Ekdahl

; Korsgren

; Nilsson

Production of tissue factor by pancreatic islet cells as a trigger of detrimental thrombotic reactions in clinical islet transplantation. Lancet 360(9350): 2039–2045; 2002.

37.

Moberg

; Korsgren

; Nilsson

Neutrophilic granulocytes are the predominant cell type infiltrating pancreatic islets in contact with ABO-compatible blood. Clin. Exp. Immunol. 142(1): 125–131; 2005.

38.

Montana

; Bonner-Weir

; Weir

G. C.

Beta cell mass and growth after syngeneic islet cell transplantation in normal and streptozocin diabetic C57BL/6 mice. J. Clin. Invest. 91(3): 780–787; 1993.

39.

Niclauss

; Wojtusciszyn

; Morel

; Demuylder-Mischler

; Brault

; Parnaud

; Ris

; Bosco

; Badet

; Benhamou

P. Y.

; Berney

Comparative impact on islet isolation and transplant outcome of the preservation solutions Institut Georges Lopez-1, University of Wisconsin, and Celsior. Transplantation 93(7): 703–708; 2012.

40.

Noguchi

; Naziruddin

; Jackson

; Shimoda

; Ikemoto

; Fujita

; Chujo

; Takita

; Kobayashi

; Onaca

; Levy

M. F.

; Matsumoto

Low-temperature preservation of isolated islets is superior to conventional islet culture before islet transplantation. Transplantation 89(1): 47–54; 2010.

41.

Ozmen

; Ekdahl

K. N.

; Elgue

; Larsson

; Korsgren

; Nilsson

Inhibition of thrombin abrogates the instant blood-mediated inflammatory reaction triggered by isolated human islets: Possible application of the thrombin inhibitor melagatran in clinical islet transplantation. Diabetes 51(6): 1779–1784; 2002.

42.

Padfield

G. J.

; Newby

D. E.

; Mills

N. L.

Understanding the role of endothelial progenitor cells in percutaneous coronary intervention. J. Am. Coll. Cardiol. 55(15): 1553–1565; 2010.

43.

Pellicci

D. G.

; Hammond

K. J.

; Uldrich

A. P.

; Baxter

A. G.

; Smyth

M. J.

; Godfrey

D. I.

A natural killer T (NKT) cell developmental pathway iInvolving a thymus-dependent NK1.1(-)CD4(+) CD1d-dependent precursor stage. J. Exp. Med. 195(7): 835–844; 2002.

44.

Posselt

A. M.

; Bellin

M. D.

; Tavakol

; Szot

G. L.

; Frassetto

L. A.

; Masharani

; Kerlan

R. K.

; Fong

; Vincenti

F. G.

; Hering

B. J.

; Bluestone

J. A.

; Stock

P. G.

Islet transplantation in type 1 diabetics using an immuno-suppressive protocol based on the anti-LFA-1 antibody efalizumab. Am. J. Transplant. 10(8): 1870–1880; 2010.

45.

Rood

P. P.

; Bottino

; Balamurugan

A. N.

; Smetanka

; Ayares

; Groth

C. G.

; Murase

; Cooper

D.K.

; Trucco

Reduction of early graft loss after intraportal porcine islet transplantation in monkeys. Transplantation 83(2): 202–210; 2007.

46.

Seong

S. Y.

; Matzinger

Hydrophobicity: An ancient damage-associated molecular pattern that initiates innate immune responses. Nat. Rev. Immunol. 4(6): 469–478; 2004.

47.

Shapiro

A. M.

; Lakey

J. R.

; Ryan

E. A.

; Korbutt

G. S.

; Toth

; Warnock

G. L.

; Kneteman

N. M.

; Rajotte

R. V.

Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N. Engl. J. Med. 343(4): 230–238; 2000.

48.

Shapiro

A.M.

; Ricordi

; Hering

B. J.

; Auchincloss

; Lindblad

; Robertson

R. P.

; Secchi

; Brendel

M. D.

; Berney

; Brennan

D. C.

; Cagliero

; Alejandro

; Ryan

E. A.

; DiMercurio

; Morel

; Polonsky

K. S.

; Reems

J. A.

; Bretzel

R. G.

; Bertuzzi

; Froud

; Kandaswamy

; Sutherland

D. E.

; Eisenbarth

; Segal

; Preiksaitis

; Korbutt

G. S.

; Barton

F. B.

; Viviano

; Seyfert-Margolis

; Bluestone

; Lakey

J. R.

International trial of the Edmonton protocol for islet transplantation. N. Engl. J. Med. 355(13): 1318–1330; 2006.

49.

Smadja

D. M.

; Bieche

; Uzan

; Bompais

; Muller

; Boisson-Vidal

; Vidaud

; Aiach

; Gaussem

PAR-1 activation on human late endothelial progenitor cells enhances angiogenesis in vitro with upregulation of the SDF-1/CXCR4 system. Arterioscler. Thromb. Vasc. Biol. 25(11): 2321–2327; 2005.

50.

Wijkstrom

; Kenyon

N. S.

; Kirchhof

; Kenyon

N. M.

; Mullon

; Lake

; Cottens

; Ricordi

; Hering

B. J.

Islet allograft survival in nonhuman primates immunosuppressed with basiliximab, RAD, and FTY720. Transplantation 77(6): 827–835; 2004.

51.

; Ye

; Mahato

R. I.

Genetically modified mesenchymal stem cells for improved islet transplantation. Mol. Pharm. 8(5): 1458–1470; 2011.

52.

Yang

; Chen

; Ellett

J. D.

; Carter

J. D.

; Brayman

K. L.

; Nadler

J. L.

Inflammatory blockade improves human pancreatic islet function and viability. Am. J. Transplant. 5(3): 475–483; 2005.

53.

Yoder

M. C.

; Mead

L. E.

; Prater

; Krier

T. R.

; Mroueh

K. N.

; Li

; Krasich

; Temm

C. J.

; Prchal

J. T.

; Ingram

D. A.

Redefining endothelial progenitor cells via clonal analysis and hematopoietic stem/progenitor cell principals. Blood 109(5): 1801–1809; 2007.

The Potential of Endothelial Colony-Forming Cells to Improve Early Graft Loss after Intraportal Islet Transplantation

Abstract

Keywords

Introduction

Materials and Methods

Isolation of Islets and Culture

Preparation of ECFCs and Culture

Islet Coating with ECFCs

In Vitro Effects of ECFC Coating of Islets

Islet Transplantation Through Portal Vein of Nude Mouse

Graft Function

Morphologic Examination of Islet Grafts

Quantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis of the Liver Tissues

Statistical Analysis

Results

ECFC Coating and Islet Quality

Porcine Islet Function After Transplantation to Athymic Diabetic Mice Through Portal Vein

Morphologic Examination of the Liver Tissues Where the Islets Were Implanted

Analysis of the Inflammatory Markers in the Liver Tissues with qRT-PCR

Discussion

Footnotes

Acknowledgments

References