Sage Journals: Discover world-class research

Abstract

BACKGROUND:

Micro(mi)RNAs are a series of 20–24 nt non-coding small-molecule single-stranded RNAs that are believed to be closely related to tumor occurrence, development and other biological processes. MicroRNA-125a modulates radiochemotherapy sensitivity. However, the mechanism by which miRNA-125a regulates radiation resistance by lung cancer cells is yet to be elucidated.

OBJECTIVE:

The present study was designed to explore the biological role of miR-125a in regulating radioresistance in non-small cell lung carcinoma (NSCLC).

METHODS AND RESULTS:

The expression of miR-125a was assessed by quantitative real-time PCR in the human lung cancer cell lines, A549 and LTEP-a2. Notably, we found that miRNA-125a-5p regulated lung cancer radiosensitivity. We found that miRNA-125a-5p was more highly expressed in LTEP-a2 cells, which showed radiosensitivity compared to A549 cells with lower expression of miRNA-125a-5p. In addition, we up-regulated or down-regulated miR-125a-5p expression using an miR-125a-5p mimic or inhibitor, respectively, to reverse radioresistance. Flow cytometry revealed that the mimic increased the apoptotic rate as well as the expression of the apoptosis-related protein, cleaved poly ADP-ribose polymerase (PARP). Gene detection by luciferase reporter showed that sirtuin (SIRT)7 is a direct target of miR-125a-5p. Inhibiting SIRT7 using a small interfering RNA (siSIRT) abrogated resistance to radiation. In addition, the overexpression of SIRT7 decreased radiation-induced cell apoptosis.

CONCLUSION:

Our results indicated that the miR-125a level varies in NSCLC cell lines with different radiosensitivities. We demonstrated that miR-125a-5p upregulated SIRT7 and further upregulated apoptosis in lung cancer cells to increase their radiosensitivity. Our findings provide new directions for improving radiosensitivity in malignant lung tumors.

Keywords

NSCLC microRNA-125a-5p radiosensitivity SIRT7 apoptosis

1. Introduction

Lung cancer is one of the most common cancers and leading causes of cancer death in the world. Non-small cell lung cancer (NSCLC) accounts for about 80% of all cases of lung cancer. Because the opportunity for surgery is lost for most patients by the time of diagnosis, this makes radiotherapy one of the important treatments for lung cancer. The overall 5-year survival rate is still only 15% in spite of the development of radiotherapy. To improve the radiosensitivity of cancer cells thus becomes a challenging problem.

MicroRNAs are a series of non-coding small-mole-cule single-stranded RNAs that are widely involved in the regulation of gene expression: studies on miRNA expression, before and after radiation, and differences in miRNA expression in tumors with distinct radiosensitivity profiles have gradually became hot topics of investigation [1, 2, 3, 4]. Numerous studies have shown that miRNAs can regulate the radiosensitivity of tumor cells and improve the potential of radiotherapy [5, 6, 7, 8, 9, 10]. Wagner–Ecker [11] showed that radiotherapy can change the expression of miRNAs in human vascular endothelial cells; interestingly, the expression of miR-125a, -127, -189, and let-7g can significantly influence the radiosensitivity of human vascular endothelial cells. Later, Moskwa et al. [12] suggested that the expression of miR-125a is associated with a suppressive effect in radiotherapy for malignant glioma. However, the specific mechanism of miR-125a in regulating radiosensitivity is still unknown. The sirtuin family of proteins (the SIRT family) is a set of highly conserved nicotinamide adenine dinucleotide (NAD $+$ )-dependent deacetylases. SIRT7 has a deacetylase for a specific substrate that is involved in the regulation of gene transcription, protein synthesis, cellular oxidative stress, and chromosome remodeling through multiple pathways. Previous studies have found that 5-fluorouracil combined with radiotherapy can effectively degrade Sirt7, leading to an increase in the radiosensitization of colorectal cancer cells. However, the mechanisms involving SIRT7 in the modulation of the radiosensitivity of NSCLC are still unknown.

Based on the above, we hypothesized that miR-125a-5p regulates tumor cell apoptosis via SIRT7 expression. In the present study, we found that miR-125a-5p, was highly expressed in LTEP-a2 cells that showed radiosensitivity compared with A549 cells. In addition, we up-regulated miR-125a-5p expression using a mimic in A549 cells so that radioresistance was reversed. Further, we determined the apoptotic rate and expression of the apoptosis-related protein, cleaved poly ADP-ribose polymerase (PARP). Finally, luciferase reporter gene expression showed that SIRT7 is a direct target of miR-125a-5p. Targeting SIRT7 abrogated the resistance to radiation after SIRT7 inhibition by siSIRT7. The overexpression of SIRT7 decreased radiation-induced cell apoptosis and further decreased the radiosensitivity of cells.

2. Materials and methods

2.1 Cell lines

The human lung cancer cell lines, A549 and LTEP-a2, were purchased from the Chinese Academy of Sciences Cell Bank and cultured in RPMI-1640 medium. All cell lines were maintained with 100 U/mL of penicillin and 100 mg/mL of streptomycin, 10% fetal bovine serum, and incubated at 37 ${}^{\circ}$ C in a 5% CO ${}_{2}$ atmosphere.

2.2 Quantitative real-time PCR

Quantitative real-time polymerase chain reaction (qRT–PCR) was used to detect the expression of miR-125a-5p in A549 and LTEP-a2 lung cancer cell lines. Total RNA was extracted with an RNeasy Minireagent Kit (Axygen Biosciences, Union City, CA, USA) and cDNA was then synthesized using miScript II RT Kit (Qiagen, Hilden, Germany) according to the manufacturers’ instructions. AceQ qPCR SYBR Green Master Mix (Qiagen) was used to measure miRNA expression levels and DNA expression using an ABI Prism 7500 Detection System (Applied Biosystems, Inc, Waltham, MA, USA). U6 was used an internal reference. Relative miRNA expression was calculated by the 2 ${}^{-\Delta\Delta{\rm Ct}}$ method [21].

After transfection of an miR-125a-5p mimic or inhibitor in A549 and LTEP-a2 lung cancer lines for 24 h, qRT–PCR was used to detect the expression of miR-125a-5p. With the same method, SIRT7 expression was tested in the same group, while $\beta$ -actin was used as an internal reference.

2.3 Colony formation assays

Pre-treated cells that underwent different treatments were cultured on 6-well plates at 1000–2000 cells/mL. The cells were irradiated using a linear accelerator (Unique System; Varian, Palo Alto, CA, USA) with a dose rate of 300 cGy/min and doses of 0, 2, 4, 6 and 8 Gy. The cells were cultured for 10–14 days to form colonies of more than 50 cells. The data were analyzed with a classic multitarget single hit model: $SF=1-(1-e-D/D{0})N$ to generate a dose-survival curve. The mean lethal dose (D0), quasi-threshold dose (Dq), survival fraction at 2 Gy (SF2), and sensitivity enhancement ratio (SER) (SER $=$ D0 control group/D0 combination group) were calculated.

2.4 Transfection of miRNA mimic and inhibitor

An miR-125a-5p mimic and inhibitor were purchased from RiboBio (Guangzhou, China) and assessed according to the manufacturer’s instructions. The negative controls (RiboBio) used for miR-125a-5p transfection experiments were not homologous to any human miRNA sequences. The transfection was performed using 5 $\mu$ L Lipofectamine2000 (Invitrogen) for each well of a 6-well plate according to the manufacturer’s instructions. MicroR-125a-5p expression was detected by qRT-PCR. At the same time, two siRNAs targeting SIRT7 (target sequence: 5 ${}^{\prime}$ -GGCCGAAGCTTTACATCGT-3 ${}^{\prime}$ and 5 ${}^{\prime}$ -ACGGGAACATGTACATTGA-3 ${}^{\prime}$ ) and a negative control siRNA were synthesized by RiboBio Co., Ltd., and and used as above to transfect A549 cells. Further, a SIRT7 plasmid (CMV-F CGCAAATGGGCGGTAGGCGTG, BGH TAGAAGGCACAGTCGAGG) and a negative control plasmid, which were constructed by OBiO Technology (Shanghai, China) and used to transfect A549 cells using the same methods.

2.5 Flow cytometry

Pre-treated cells were cultured on 6-well plates. Cells were divided into four treatment groups: control, miR-125a-5p mimic or miR-125a-5p inhibitor, irradiation (IR), and irradiation combined with mimic or inhibitor (IR $+$ mimic, IR $+$ inhibitor). The dose of irradiation was determined using a colony forming assay. The A549 cell line was irradiated by 4 Gy while the LTEP-a2 cell line was irradiated by 2 Gy at a dose rate of 300 cGy/min. Experiments were performed according to the protocol supplied with the Annexin–PI Apoptosis Cell Detection Reagent Kit (KeyGen Biotech, Nanjing, China). The percentage of apoptotic cells was determined using a FACScan flow cytometer (FACSCalibur BD; BD Biosciences, Franklin Lakes, NJ, USA).

Figure 1.

Relative expression of miR-125a-5p and radiosensitivity in cell lines. A: Relative expression of miR-125a-5p in A549 cell line and LTEP-a2. B: Radiosensitivity of A549 and LTEP-a2 cell lines. C: Relative expression of miR-125a-5p in A549 with mimic. D: Relative expression of miR-125a-5p in LTEP-a2 with inhibitor. E: Radiosensitivity of A549 with mimic. F: Radiosensitivity of LTEP-a2 with inhibitor ( $p<$ 0.01).

Figure 2.

A. Apoptosis rate in the A549 cell line. B. Apoptosis rate in the LTEP-a2 cell line. C. Cleaved-PARP expression in the A549. D. Cleaved-PARP expression in the LTEP-a2 cell line ( $p<$ 0.05).

2.6 Western blot analysis

Cells were harvested and lysed using radioimmunoprecipitation buffer (Beyotime, Beijing, China). The total protein concentration was measured by a Bradford assay kit (Beyotime). Equal amounts of protein in samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis, and transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk followed by incubation with primary antibodies overnight at 4 ${}^{\circ}$ C. Then, the corresponding secondary antibody was further incubated and chemiluminescence was detected via an enhanced BeyoECL Plus kit (Beyotime). Primary antibodies against cleaved-PARP and SIRT7 were purchased from Cell Signaling Technology (Danvers, MA, USA).

2.7 Dual luciferase assay

A luciferase reporter gene system was used to validate whether SIRT7 was the target gene of miR-125a-5p. We constructed a wild-type (WT) and mutation-type (MT) of the SIRT7 luciferase reporter plasmid, SIRT7 WT or SIRT7 MT, respectively. A miR-125a-5p mimic or negative control were transfected into A549 cells. After 24 h of transfection, cells were collected. A dual-luciferase reporter gene system (Promega, Madison, WI, USA) was used in this experiment. Renilla luciferase was used as the reference to detect firefly luciferase activity. Finally, a ratio of the firefly/Renilla was used as the relative expression value. Quantitative real-time (qRT)-PCR analysis was used to determine the effect of miR-125a-5p on the expression of SIRT7. After 24 h of A549 cell transfection with an miR-125a-5p mimic or negative control, and LTEP-a2 cell transfection with an miR-125a-5p inhibitor or negative control, the cells of each group were collected and assayed by qRT-PCR.

2.8 Tunel assay

Apoptosis of A549 cells was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) using an In Situ Cell Death Detection kit (Roche, Mannheim, Germany) following the manufacturer’s instructions. The cells were plated on a 12-well plate and divided into groups: negative control, siSIRT7, radiation, siSIRT7 combined with radiation, expression, and expression combined with radiation. Slides with the cells were washed with PBS solution. The cells were then fixed with 4% paraformaldehyde for 15 min. After that, cells were perforated with 100 $\mu$ L 0.1% Triton X-100 and incubated at room temperature for 10 min. The 0.1% Triton X-100 was discarded and cells washed with PBS. The slides were incubated with TUNEL reaction solution sitting on the cell surface side of each slide in the dark for 30 min. The cells were washed with PBS solution, then stained with 4 ${}^{\prime}$ , 6-diamidino-2-phenylindole (DAPI), and incubated at 37 ${}^{\circ}$ C for 10 min in the dark. After an anti-fluorescence quencher was added dropwise in the dark, the cells were counted under a fluorescence microscope and photographed with an excitation wavelength in the range of 570–620 nm.

2.9 Statistical analysis

Data are presented as mean $\pm$ standard deviation (SD) from three independent experiments; each was performed in triplicate. Data were analyzed using a two-tailed unpaired $t$ test with SPSS software. Differences were considered as significant at $p<$ 0.05.

3. Results

3.1 MiR-125a-5p expression in lung cancer cells

Quantitative RT-PCR analysis revealed significant differences in the expression level of miR-125a-5p in cells. The expression level of miR-125a-5p in LTEP-a2 cells was significantly higher than that in A549 cells ( $p<$ 0.05; Fig. 1A).

Figure 3.

A. Schematic representation of SIRT7 3 ${}^{\prime}$ -UTR showing putative miR-125a-5p target site. B. Statistical results of relative activity of luciferase in the A549 cell line. C,D SIRT7 expression was regulated by miR-125a-5p ( $p<$ 0.01).

3.2 MiR-125a-5p regulates the radiosensitivity of lung cancer cells

The radiosensitivity of the two cell lines was tested by colony formation assay. We found that the survival fraction of LTEP-a2 cells was significantly lower than that of A549 cells after irradiation with the same dose, with a radiation sensitization ratio of 1.57. This result suggested that LTEP-a2 was sensitive to radiation compared with A549 cells. Taken together, we found that cells in which miR-125a-5p was highly expressed were more sensitive to radiation than those in which MiR-125a-5p was expressed at a low level (Fig. 1B). To further investigate the association of the expression of miR-125a-5p with radiosensitivity, we transfected an miR-125a-5p inhibitor into LTEP-a2 cells that normally showed a high expression of miR-125a-5p. An miR-125a-5p mimic was transfected into A549 cells, which normally showed a low level of miR-125a-5p expression, to upregulate its expression level while a negative control sequence was transfected into the control group. The results suggested that the expression of miR-125a-5p in the two cell lines was significantly reversed after a mimic or inhibitor of miR-125a-5p was transfected; the difference is statistically significant ( $p<$ 0.05, Fig. 1C and D). Cloning experiments were also performed to verify that the two groups of cells were inversely transfected for miR-125a-5p expression and were sensitive to radiation. Cloning experiments suggested that the normally radiation sensitive cell line, LTEP-a2, showed radioresistance after down-regulation of the expression of miR-125a-5p, with a radiation sensitization ratio of 0.8. The previously radiation resistant cell line, A549, showed increased radiosensitivity after the up-regulated expression of miR-125a-5p, with a radiation sensitization ratio of 1.14. The experiment further confirmed that the expression of miR-125a-5p differed between cell lines and that the up-regulated expression of miR-125a-5p enhanced radiosensitivity in lung cancer cells (Fig. 1E and F).

Figure 4.

A. Relative expression of SIRT7 in A549 cells with siSIRT7 1(si1) and siSIRT7 2(si2). B. Radiosensitivity of A549 cells with si1. C. Radiosensitivity of A549 cells with si2 ( $p<$ 0.01).

Figure 5.

A: Apoptosis with siSIRT7 in A549 cell line. B: Apoptosis with si1 or si2 combined radiation in A549 cell line. C: Apoptosis with SIRT7 overexpression or SIRT7 overexpression combined radiation in A549 cell line.

Figure 6.

A. Expression of SIRT7 and cleaved-PARP in si1 or si2 group and si1 or si2 combined radiation group in A549 cell line. B. Expression of SIRT7 and cleaved-PARP in SIRT7 overexpression or SIRT7 overexpression combined radiation group in A549 cell line ( $p<$ 0.05).

3.3 Up-regulation of the expression of mi-125a-5p induced cell apoptosis

In accordance with the results of the cloning assays, we selected an ID50 irradiation dose to give the two cell lines: A549 was given a single irradiation of 4 Gy to induce apoptosis, and LTEP-a2 was given 2 Gy. We found that the apoptotic rate of the mi-125a-5p mimic combined with radiation group was increased in the A549 cell line compared with that of the simple irradiation group. In LTEP-a2, the apoptotic rate for the mi-125a-5p inhibitor combined with radiation group was lower than that of the simple irradiation group. This result clarified that miR-125a-5p increased radiosensitivity-induced apoptosis (Fig. 2A and B). To further investigate the regulation of cell apoptosis by miR-125a-5p, western blotting was used to estimate the expression of the apoptosis-related protein, cleaved-PARP. In the A549 cell line, the expression of cleaved-PARP was significantly increased in the mi-125a-5p mimic combined with radiation group compared with the simple irradiation group. While in LTEP-a2, the expression of cleaved-PARP was significantly decreased in the mi-125a-5p inhibitor combined with radiation group compared with the simple irradiation group; the difference was statistically significant ( $p<$ 0.05, Fig. 2C and D). Thus, miR-125a-5p increased radiosensitivity-induced apoptosis as well as the cleaved-PARP level.

3.4 SIRT7 is a direct target of miR-125a-5p

In accordance with bioinformatics analysis, SIRT7 was identified as a possible target of miR-125a-5p by three prediction algorithms (miRDB, miRWalk and TargetScan) (Fig. 3A). To confirm whether SIRT7 was a direct target of miR-125a-5p, a luciferase reporter vector containing the 3 ${}^{\prime}$ -UTR fragment of the SIRT7 gene was co-transfected with a miR-125a-5p mimic or negative controls into cancer cells. Co-transfection of a miR-125a-5p mimic in the wild type reduced luciferase activities, but did not have an effect when paired with SIRT7 3 ${}^{\prime}$ -UTR containing mutant binding sites (Fig. 3B). These results suggest that SIRT7 is a direct downstream target of miR-125a-5p. We further detected SIRT7 expression in mi-125a-5p mimic and inhibitor groups. In the mimic group, SIRT7 expression was lower than that in the control group while it was higher in the inhibitor group. These results suggested that the overexpression of miR-125a-5p inhibited SIRT7 expression ( $p<$ 0.05, Fig. 3C and D).

3.5 Targeting SIRT7 knockdown abrogated resistance to radiation in A549 cells

To elucidate the role of SIRT7 in the regulation of radiosensitivity in A549 cells, SIRT7 was silenced in A549 cells by siRNA transfection. A qRT-PCR assay showed that siSIRT7 downregulated the expression of SIRT7; the difference between siSIRT7 treated cells and control was statistically different ( $p<$ 0.05; Fig. 4A). A colony survival assay showed that silencing SIRT7 with siSIRT7 increased the radiosensitivity of A549 cells, with a radiation sensitization ratio of 1.21 and 1.06 (Fig. 4B and C). These results suggested that silencing SIRT7 abrogates resistance to radiation in A549 cells.

3.6 SIRT7 induced apoptosis and increased the radiosensitivity of A549 cells

To investigate the mechanism underlying the regulation of radiosensitivity of cells by SIRT7, cell apoptosis was measured by TUNEL assay. Compared with the negative control group, apoptosis in the siSIRT7 group was higher (Fig. 5A). In the siSIRT7 combined with radiation group, cell apoptosis was higher than that in the radiation group (Fig. 5B), which further suggested that the inhibition of SIRT7 increased radiation-induced apoptosis. In addition, in SIRT7 overexpression group, apoptosis was lower than in the negative control group. Apoptosis was lower in the SIRT7 overxepression combined with radiation group than in the radiation group (Fig. 5C). This suggested that upregulating the expression of SIRT7 decreased cell apoptosis. In a western blot, we detected cleaved-PARP and SIRT7 protein expression in the groups. As shown in Fig. 6A, the expression of the apoptotic protein, cleaved-PARP, was higher in the siSIRT7 combined radiation group, which suggested the effect of radiation after SIRT7 silencing was more marked than that induced by simple radiation ( $p<$ 0.05; Fig. 6A). Further, when SIRT7 was overexpressed, western blot results suggested that in the overexpression combined radiation group, SIRT7 expression was higher than in the radiation group; the expression of cleaved-PARP was lower ( $p<$ 0.01; Fig. 6B). Overall, the present study demonstrated that SIRT7 decreased radiosensitivity by downregulating cell apoptosis and the expression of cleaved-PARP.

4. Discussion

Lung cancer is one of the most malignant tumors according to the China Cancer Registration Annual Report [13]. NSCLC represents almost 85% of lung cancer cases [14]. As is well known, radiotherapy is one of the important treatment modalities for lung cancer. Unfortunately, the prognosis of most patients is weak mainly due to tumor radioresistance. The radiosensitivity of a tumor is affected by multiple factors such as the size of the tumor, the condition of the tumor bed, the proportion of the tumor cell population and the degree of differentiation of tumor cells; however, such factors are far from being adequately explained.

Evidence suggests that miRNA expression is associated with cancers, such as in lung, colon and breast [15, 16, 17, 18]. Therefore, further exploring the biological functions of miRNAs in cancer is important. MicroRNA may have several targets that regulate gene expression. This regulation mainly depends on the characteristics of their 3 ${}^{\prime}$ -UTR target sites [19, 20]. Studies have shown that miR-125a-5p was regulated in many cancers, but the mechanism of lung cancer radioresistance was unclear. In our study, we found that different tumor cell lines showed significantly different expression of miR-125a-5p and that the LTEP-a2 cell line was more sensitive to radiation. Notably, the upregulation of miR-125a-5p successfully increased the radiosensitivity of A549 cells. What is more, miR-125a-5p inhibition induced radioresistance in LTEP-a2 cells. Our results revealed that miR-125a-5p takes part in the regulation of radiosensitivity in lung cancer.

Radiotherapy can induce cell apoptosis, which is the main route of cell death. It can enhance the apoptotic rate, leading to an increase in the radiosensitivity of cancer cells as shown in our previous study of oropharyngeal carcinoma [21]. Increasing the apoptotic rate in tumors leads to killing a large number of tumor cells which improves the efficacy of radiation and decreases the possibility of tumor relapse. According to recent studies, apoptosis is a key pathway for cell death. Remarkably, in our study, we found that up-regulating the expression of miR-125a-5p enhanced the radiosensitivity of cancer cells and the apoptotic rate, while down-regulating the expression of miR-125a-5p reduced the radiation-induced apoptotic rate.

SIRT7 is a member of the sirtuin family of proteins that contains seven sirtuins (SIRT1-7). They are widely expressed in mammals and exert NAD $+$ -dependent protein deacylase or ADP ribosyltransferase activities [22, 23]. Previous studies found that SIRT7 affects the malignancy of glioma cells through ERK and STAT3 [24, 25]. Previous study found that silencing SITR7 sensitived human non-small cell lung cancer cells to gemcitabine therapy through auto-phagy [26]. Futher,study found that suppression of SIRT7 inhibited the growth of non-small cell lung cancer cells [27]. Our study investigated the expression of SIRT7 protein. As expected, miR-125a-5p activation decreased the expression of SIRT7, while miR-125a-5p inhibition increased its expression. Silencing SIRT7 expression increased the radiosensitivity of A549 cells, which means targeting SIRT7 would abrogate resistance to radiation. Overexpression of SIRT7 decreased the radiation-induced apoptosis, which increased the radioresistance in cells. Therefore, miR-125a-5p activation upregulates radiosensitivity, at least in part, through the regulation of SIRT7.

The present study showed that miR-125a-5p plays an important role in increasing the radiosensitivity of lung tumor cells via SIRT7, which can result in a diversity of cellular sensitivities to radiation. Taken together, our results strongly suggest that miR-125a-5p may become a target for the further development of radiation therapy for lung cancer.

Footnotes

Acknowledgments

This study was supported by Science and Technolo- gy Plan Project of Liaoning Province (No. 201602452, No. 20180540129 No. 20180530095), Personnel Trai- ning Project of Liaoning Cancer Hospital & Insititute (201703), Key Laborotary of Tumor Radiosensitization and Normal Tissue Radioprotection, Liaoning Province, China (2018225102).

References

Shin

Cha

H.J.

Lee

E.M.

, et al., Alteration of miRNA profiles by ionizing radiation in A549 human non-small cell lung cancer cells, Int J. Oncol 35 (2009), 81–86.

Girardi

, De Pitta

Casara

, et al., Analysis of miRNA and mRNA expression profiles highlights alterations in ionizing radiation response of human lymphocytes under modeled microgravity, PLoS One 7 (2012), e31293.

Niemoeller

O.M.

Niyazi

Corradini

, et al., MicroRNA expression profiles in human cancer cells after ionizing radiation, Radiat Oncol 6 (2011), 29.

Cha

H.J.

Shin

Yoo

, et al., Identification of ionizing radiation-responsive microRNAs in the IM9 human B lymphoblastic cell line, Int J. Oncol 34 (2009), 1661–1668.

Jeong

S.H.

H.G.

and Park

W.Y.

, LIN28B confers radio-resistance through the posttranscriptional control of KRAS, Exp Mol Med 41 (2009), 912–918.

J.S.

Kim

J.J.

Byun

J.Y.

and Kim

I.A.

, Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-Ras, Int J Radiat Oncol Biol Phys 76 (2010), 5–8.

Arora

Qureshi

Jin

, et al., miR-9 and let-7g enhance the sensitivity to ionizing radiation by suppression of NFkappaB1, Exp Mol Med 43 (2011), 298–304.

Lee

K.M.

Choi

E.J.

and Kim

I.A.

, microRNA-7 increases radiosensitivity of human cancer cells with activated EGFR-associated signaling, Radiother Oncol 101 (2011), 171–176.

Chen

Wang

W.L.

, et al., Radiosensitizing effects of ectopic miR-101 on non-small-cell lung cancer cells depend on the endogenous miR-101 level, Int J Radiat Oncol Biol Phys 81 (2011), 1524–1529.

10.

Babar

I.A.

Czochor

Steinmetz

et al., Inhibition of hypoxia-induced miR-155 radiosensitizes hypoxic lung cancer cells, Cancer Biol Ther, (2011), 908–914.

11.

Ecker

Wagner-M.

Schwager

Wirkner

et al., MicroRNA expression after ionizing radiation in human endothelial cells, Radiation Oncology 5 (2010), 25.

12.

Moskwa

Zinn

P.O.

Eun Choi

et al., A functional screen identifies miRs that induce radioresistance in glioblastomas, Mol Cancer Res 12(12) (2014), 1767–1778.

13.

Chen

Zheng

Baade

P.D.

Zhang

Zeng

Bray

Jemal

X.Q.

and He

, Cancer statistics in China, 2015, CA Cancer J. Clin 66 (2016), 115–132.

14.

Howlader

Noone

A.M.

Krapcho

et al., SEER cancer statistics review, Bethesda, MD: National Cancer Institute, (2017), 1975–2014.

15.

Mizuno

Mataki

Seki

et al., MicroRNAs in nonsmall cell lung cancer and idiopathic pulmonary fibrosis, J Hum Genet 62 (2017), 57–65.

16.

Jang

H.J.

Lee

H.S.

Burt

B.M.

et al., Integrated genomic analysis of recurrence-associated small non-coding RNAs in oesophageal cancer, Gut 66 (2016), 215–225.

17.

Tong

Liu

Lin

et al., MiR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother 75 (Oct 2015), 129–136.

18.

Sun

Liu

Zhang

et al., Oncogenic potential of TSTA3 in breast cancer and its regulation by the tumor suppressors miR-125a-5p and miR-125b, Tumour Biol 37(4) (Apr 2016), 4963–4972.

19.

Tei

Ui-K.

Nishi

Takahashi

et al., Thermodynamic control of small RNA-mediated gene silencing, Front Genet 3 (2012), 101.

20.

Yang

J.S.

Maurin

and Lai

E.C.

, Functional parameters of Dicer-independent microRNA biogenesis, RNA 18 (2012), 945–957.

21.

Qiao

Sun

Han

et al., Endoplasmic reticulum stress pathway PERK-eIF2a confers radioresistance in oropharyngeal carcinoma by activating NF-κB, Cancer Sci 108 (2017), 1421–1431.

22.

Michishita

, RA McCord Boxer

L.D.

, et al., Cell cycle-dependent deacetylation of telomeric histone H3 lysine K56 by human SIRT6, Cell Cycle 8(16) (2009), 2664–2666.

23.

Kumar

and Lombard

D.B.

, Functions of the sirtuin deacylase SIRT5 in normal physiology and pathobiology, Crit Rev Biochem Mol Biol 53(3) (2018), 311–334.

24.

Liu

Lin

, et al., Sirtuin 7 promotes glioma proliferation and invasion through activation of the ERK/STAT3 signaling pathway, Oncol Lett 17(2) (Feb 2019), 1445–1452.

25.

Zhu

and Qin

, SIRT7 suppresses the epithelial-to-mesenchymal transition in oral squamous cell carcinoma metastasis by promoting SMAD4 deacetylation, J Exp Clin Cancer Res 37 (2018), 148.

26.

Jiang

Han

Wang

, et al., Depletion of SIRT7 sensitizes human non-small cell lung cancer cells to gemcitabine therapy by inhibiting autophagy, Biochem Biophys Res Commun 506(1) (17 Nov 2018), 266–271.

27.

Shi

Zhang

, et al., MicroRNA-3666-induced suppression of SIRT7 inhibits the growth of non-small cell lung cancer cells, Oncol Rep 36(5) (Nov 2016), 3051–3057.

MicroRNA-125a-5p modulates radioresistance in LTEP-a2 non-small cell lung cancer cells by targeting SIRT7

Abstract

BACKGROUND:

OBJECTIVE:

METHODS AND RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 Cell lines

2.2 Quantitative real-time PCR

2.3 Colony formation assays

2.4 Transfection of miRNA mimic and inhibitor

2.5 Flow cytometry

2.7 Dual luciferase assay

2.8 Tunel assay

2.9 Statistical analysis

3. Results

3.1 MiR-125a-5p expression in lung cancer cells

3.4 SIRT7 is a direct target of miR-125a-5p

3.5 Targeting SIRT7 knockdown abrogated resistance to radiation in A549 cells

3.6 SIRT7 induced apoptosis and increased the radiosensitivity of A549 cells

4. Discussion

Footnotes

Acknowledgments

References