Increased expression of lncRNA SNHG12 predicts a poor prognosis of nasopharyngeal carcinoma and regulates cell proliferation and metastasis by modulating Notch signal pathway

Abstract

BACKGROUND:

Small nucleolar RNA host gene 12 (SNHG12) has been shown to be a long noncoding RNA (lncRNA) that facilitates the progression of a number of malignancies. However, the expression pattern and biological function of SNHG12 in nasopharyngeal carcinoma (NPC) have not been investigated.

OBJECTIVE:

The aim of our study is to investigate the expression, clinical significance and function of SNHG12 in NPC.

METHODS:

RT-PCR was used to detect the expression of SNHG12 in NPC cell lines and primary tumor tissues. The correlation of SNHG12 with clinicopathological features and patient prognosis was analyzed. The biologic functions of SNHG12 in NPC were explored by MTT assay, colony formation assay, wound healing assays, transwell assay and flow cytometric analysis in vitro. The expression of EMT markers and Notch signal pathway markers were determined by western blotting.

RESULTS:

The expression levels of SNHG12 were up-regulated in both NPC tissues and cell lines. High SNHG12 expression was significantly associated with clinical stage, grade and poor prognosis. Multivariate analysis demonstrated that high lncRNA SNHG12 expression was an independent poor prognostic factor for NPC patients. Functionally, knockdown of SNHG12 suppressed NPC cells proliferation, migration and invasion. Mechanistic investigations showed that knockdown of SNHG12 suppressed the activation of EMT and Notch-1 signal pathway.

CONCLUSIONS:

Our data suggest that SNHG12 promotes the progression of NPC and is a potential therapeutic target for NPC intervention.

Keywords

LncRNA SNHG12 nasopharyngeal carcinoma prognosis Notch-1 signal pathway metastasis

1. Introduction

Nasopharyngeal carcinoma (NPC) is a is a type of head and neck cancer that is common in Southeastern China and South East Asia [1, 2]. Epstein-Barr virus infection, genetic alterations, and environmental factors frequently synergize during the progression of NPC [3]. Although current therapeutic strategies have improved over the past decades, the outcome of patients with NPC, especially with locoregionally advanced stage, remains very poor due to the recurrence and/or distant metastasis [4, 5]. Thus, it is urgently needed to understand the molecular mechanisms underlying the initiation and development of NPC, therefore developing efficient biomarkers and novel therapeutic reagents to improve prognosis and prolong survivals in NPC patients.

Long non-coding RNAs (lncRNAs), with length $>$ 200 nucleotides, are once considered as junk DNA and transcriptional noise [6]. However, with the development of molecular biology, growing evidence indicate that lncRNAs play crucial roles in the regulation of gene expression, splicing, epigenetic control, chromatin structure, and nuclear transport, indicating that lncRNAs may be involved in the regulation of disease [7, 8]. Indeed, it has been confirmed that the deregulated lncRNA play a critical role in the pathogenesis of various diseases, including various cancer [9, 10]. For instance, Song et al. reported that lncRNA XIST was highly expressed in NPC and its knockdown of suppressed NPC cells proliferation by targeting miR-34a-5p [11]. Zhuang et al. found that lncRNA HNF1A-AS expression was up-regulated in NPC and its knockdown suppressed NPC cell proliferation and migration abilities [12]. However, up to now, the characteristics and functions of lncRNA in tumorigenesis have remained largely elusive. Looking for new biomarkers and therapeutic targets has been a major research focus.

Small nucleolar RNA host gene 12 (SNHG12) is a tumor-related lncRNA located at chromosome 1p35.3. Recently, dysregulation of SNHG12 has been reported in several tumors and its carcinogenic role has been well-studied in several tumors, such as glioma, papillary thyroid carcinoma and gastric cancer [13, 14, 15]. However, to our best knowledge, the expression pattern and biological function of SNHG12, as well as its potential mechanism in NPC have not been investigated. In this study, we firstly provided evidence that SNHG12 expression was up-regulated in NPC and associated with poor prognosis of NPC patients, and knockdown of SNHG12 could suppressed NPC cells proliferation, migration and invasion by modulating Notch-1 Signaling Pathway.

2. Materials and methods

2.1 NPC tissue samples

Human NPC tissue samples and non-cancerous normal tissues were collected from the Huai’an First People’s Hospital from 20111 to 2013. Ethical approval was obtained from the Ethics Committee of the Huai’an First People’s Hospital, and written informed consent was obtained from all patients. No patient had received any antitumor treatments before biopsy. The tissue specimens were immediately snap frozen in liquid nitrogen and stored at $-$ 80 ${}^{\circ}$ C until use. The clinicopathological features of these patients with NPC were summarized in Table 2.

Table 1
The primer sequences included in this study

Name	Primer sequences (5’–3’)
SNHG12: forward	TCTGGTGATCGAGGACTTCC
SNHG12: reverse	ACCTCCTCAGTATCACACACT
$\beta$ -actin: forward	CATGTACGTTGCTATCCAGGC
$\beta$ -actin: forward	CTCCTTAATGTCACGCACGAT

Table 2

Association of SNHG12 expression with the clinicopathological features of NPC cases

Variable	No. of patients	SNHG12 expression		$p$ value
	( $n$ )	High	Low
Gender				0.452
Male	58	30	28
Female	71	32	39
Age				0.745
$<$ 60	56	26	30
$\geqslant$ 60	73	36	37
T stage				0.212
T1–T2	82	36	46
T3–T4	47	26	21
N stage				0.212
N0–N1	90	40	50
N2–N3	39	22	17
M stage				0.201
M0	98	44	54
M1	31	18	13
EBV infection				0.072
Y	48	28	20
N	81	34	47
Clinical stage				0.001
I–II	84	31	53
III–IV	45	31	14
Grade				0.011
G1–G2	83	33	50
G3	46	29	17

2.2 Cell lines and cell culture

The human NPC cell lines (SUNE1, CNE1, CNE2 and HNE-1) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China), and maintained in RPMI-1640 (BasalMedia Technologies, Shanghai, China) supplemented with 10% fetal bovine serum (FBS; Hyclone, Shanghai, China) and antibiotics (100 U/mL streptomycin and 100 U/mL penicillin). The human immortalized nasopharyngeal epithelial cell line NP69 was maintained in keratinocyte/ serum-free medium (Invitrogen, Carlsbad, CA, USA) with streptomycin (100 U/mL) and penicillin (100 U/ mL). All cells were cultured in a humidified atmosphere chamber (Thermo Fisher Scientific Inc, Waltham, MA, USA) containing 5% CO ${}_{2}$ at 37 ${}^{\circ}$ C.

2.3 Cell transfection and regents

SNHG12 small interfering RNAs (siRNAs), which were applied to specifically suppress the expression of SNHG12 in CNE1 and SUNE1 cells, were purchased from Genepharma Co., Ltd. (Shanghai, China). The siRNA sequences for targeting SNHG12 (SNHG12 siRNA1 and SNHG12 siRNA2) or negative control siRNAs (Control siRNA) were listed in Table 1. Transfection reagent Lipofectamine 2000 (Invitrogen Co., Carlsbad, CA, USA) was employed for cell transfection in accordance with the manufacturer’s instructions. In Brief, CNE1 or SUNE1 cells (2 $\times$ 10 ${}^{5}$ cells per well) were grown in 6-well plates (Corning Incorporated, NY, USA) prior to transfection, to about 60–70% confluency with medium containing 10% fetal bovine serum (FBS; Hyclone, Shanghai, China) and antibiotics (100 U/mL streptomycin and 100 U/mL penicillin). Then, 16 $\mu$ l of Lipofectamine 2000 reagent was mixed with 400 $\mu$ l of Opti-MEM (Invitrogen Co., Carlsbad, CA, USA) for 10 min at room temperature. Thereafter, the mixtures were incubated with 12 $\mu$ l siRNAs (20 $\mu$ M) in 400 $\mu$ l of Opti-MEM (Invitrogen Co., Carlsbad, CA, USA) for 15–20 min at room temperature. After the complexes of Lipofectamine 2000 and siRNAs were formed, the mixtures were added into CNE1 or SUNE1 cells in each well. After culturing for 5 h, the medium was discarded and changed with fresh medium containing 10% of FBS and antibiotics. The cells were collected for the following experiments after transfection of 24 h.

2.4 Reverse transcription-quantitative polymerase chain reaction (qRT-PCR)

Quantitative real-time PCR (qRT-PCR) assay was utilized to detect the mRNA expression levels. Total RNA was extracted from the tissue samples and cells by GenElute Total RNA Purification Kit (Sigma Aldrich, Shanghai, China) according to the manufacture’s manuals. Afterwards, cDNA was reverse transcribed from the total RNAs using FastKing-RT Super Mix Kit (TIANGEN, Beijing, China). Then, RT-PCR was conducted using FastKing One Step RT-PCR Master Mix Kit (TIANGEN, Beijing, China) on an ABI7500 real-time PCR instrument (ABI Co., Oyster Bay, NY, USA) following the manufacturer’s manuals. The expression level of $\beta$ -actin was used as a control. The relative expression was analyzed using 2 ${}^{-\Delta\Delta\text{CT}}$ method. All primers were synthesized by Sangon Biotech Co., Ltd (Shanghai, China) and listed in Table 1. All experiments were performed in triplicate.

2.5 Western blot analysis

After washed with PBS for three times, the cells were lysed in cell lysis buffer (Beyotime, Shanghai, China) containing protease inhibitor cocktail (Apexbio, Shanghai, China). The protein concentration was evaluated by Bicinchoninic Acid (BCA) protein assay kit (YEASEN, Shanghai, China). Protein samples were then separated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), transferred to a polyvinylidene difluoride (PVDF) membranes (Millipore, Shanghai, China), blocked with 5% BSA in TBST, and incubated with primary antibodies against E-Cadherin (sc-71008, Santa Cruz Biotechnology, Santa Cruz, CA, USA), vimentin (10366-1-AP, Protein Tech, Wuhan, China), N-Cadherin (66219-1-Ig, ProteinTech, Wuhan, China), Notch1 (3608, Cell Signaling Technology, Danvers, MA, USA), P21 (2947, Cell Signaling Technology, Danvers, MA, USA), Hes1 (AF3317, R&D Systems, Shanghai, China), GAPDH (sc-47724, Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4 ${}^{\circ}$ C. After the membranes were washed for three times, secondary antibodies were used to incubate the PVDF membranes for 1 h at room temperature. The proteins were visualized using ECL reagents (Meilun, Dalian, China). Finally, the blots were imaged by a BioSpectrum Gel Imaging System (Bio-Rad, Hercules, CA, USA), and densitometric analysis was performed on the scanned images using ImageJ software (version 1.46; NIH, Bethesda, MD, USA).

2.6 MTT assay

Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit (Sigma Aldrich, Shanghai, China) according to the manufacturer’s protocols. In brief, CNE1 or SUNE1 cells were seeded in 96-well plates (Corning Incorporated, NY, USA) at approximately 2000 cells/ well in triplicates. Subsequently, we added 20 $\mu$ l MTT solution (0.5 mg/ml) into each well at the indicated time-points. After incubating the plates for 4 h at 37 ${}^{\circ}$ C, the culture medium was removed and 100 $\mu$ l dimethyl sulfoxide (DMSO; Sigma Aldrich, Shanghai, China) were added into each well, followed by a 10 min incubation at 37 ${}^{\circ}$ C. Then, a microplate reader (BioTek Instruments, VT, USA) was applied to detect the absorbance at a wavelength of 450 nm.

2.7 Colony formation assay

CNE1 or SUNE1 cells were seeded at 500 cells using 6-well plates (Corning Incorporated, NY, USA) and incubated for two weeks at 37 ${}^{\circ}$ C in a 5% CO ${}_{2}$ atmosphere (Thermo Fisher Scientific Inc, Waltham, MA, USA). After two weeks, cells were washed for three times using PBS buffer. Then, the cells were fixed with 4% paraformaldehyde (Qianchen Biotechnology, Shanghai, China) and stained in 0.05% crystal violet (Aladdin, Shanghai, China) at room temperature for 15 min. The cell colonies (more than 50 cells) were counted by Image J software (version 1.46; NIH, Bethesda, MD, USA).

2.8 Cell apoptosis assay

Cell apoptosis were analyzed by flow cytometry using Annexin V/propidium iodide (PI) apoptosis detection kit (Beyotime, Shanghai, China) in accordance with the manufacturer’s instructions. In short, CNE1 or SUNE1 cells transfected with siRNAs (Control siRNA, SNHG12 siRNA1 and SNHG12 siRNA2) were collected, and stained with Annexin V-fluorescein isothiocyanate (FITC) and PI. Afterwards, the cells were kept in the dark at room temperature for 15–20 min. Data were then acquired on a FACSCalibur HG flow cytometer (BD, Franklin Lakes, NJ, USA) and FlowJo 10 software (Tree Star Software, San Carlos, CA, USA) was used for flow cytometry analysis.

2.9 Wound healing assays

For wound healing assays, an equal number of control and SNHG12 silenced CNE1 or SUNE1 cells (70 $\mu$ l, 5 $\times$ 10 ${}^{5}$ cells/ml) were added into a 35 mm $\mu$ -Dish with culture insert (Ibidi, Martinsried, Germany) consisting of two reservoirs. After cell attachment for 24 h, the culture inserts were removed which created a cell-free gap of 500 $\mu$ m, and fresh culture medium was added to start the migration process. Cells were washed twice with PBS before photographs of the wounded area. The photographs of wounded areas were taken at 0 h and 16 h using an inverted microscope (IX71, Olympus, Tokyo, Japan). The wounded area was measured with Adobe Photoshop CS4 software (Adobe Systems Inc., San Jose, CA, USA).

2.10 Transwell assays

The invasive abilities of CNE1 or SUNE1 cells were evaluated by transwell filters with 8.0 $\mu$ m pore polycarbonate membrane insert purchased from BD Biosciences (Franklin Lakes, NJ, USA). Briefly, cells were placed in serum-free RPMI-1640 medium (BasalMedia Technologies, Shanghai, China) in the upper chambers with 50 $\mu$ L of Matrigel matrix (BD Bioscience, MD, USA) coating. Thereafter, the lower compartment was supplied with 500 $\mu$ l of RPMI-1640 medium containing 10% FBS (Hyclone, Shanghai, China) as a nutritional attractant. After 24 h of incubation, cells on the upper side of the membrane were removed using a cotton swab and the cells on the lower surface of the chamber were fixed with methanol for 1 min. Subsequently, the cells were further stained using 0.1% crystal violet (Aladdin, Shanghai, China). The number of CNE1 or SUNE1 cells that invaded through the membranes were counted using an inverted microscope (IX71, Olympus, Tokyo, Japan).

2.11 Statistical analysis

Statistical analyses were performed with the SPSS 17.0 statistics software (SPSS, Inc., Chicago, IL, USA). Data were expressed as mean $\pm$ the standard error of the mean (SEM). Kaplan-Meier method was utilized to generate overall survival curves, and the differences were compared using the log-rank test. Univariate and multivariate analyses were conducted to explore the independent risk factors for NPC using the Cox proportional hazard model. Multivariate analysis was used to assess the parameters that significantly correlated with survival in the univariate analysis. The differences between groups were determined by Student’s t test or one-way ANOVA test. A value of $P<$ 0.05 was considered significant.

Figure 1.

Analysis of SNHG12 expression in NPC tissues and clinical parameters. (A) Heat map analysis of the LncRNAs expression of groups was created using a method of hierarchical clustering by GeneSpring GX, version 7.3. (B) SNHG12 was detected in 129 pairs of NPC tissues by qRT-PCR and normalized to $\beta$ -actin expression. The levels of SNHG12 in NPC tissues are significantly higher than those in non-tumorous tissues. (C) Analysis of SNHG12 expression levels in NPC cell lines (CNE-2, SUNE-1, CNE-1 and HNE-1) compared with NP69 by qRT-PCR. (D) Kaplan-Meier overall survival curves according to SNHG12 expression levels. * $P<$ 0.05, ** $P<$ 0.01.

3. Results

3.1 SNHG12 is highly expressed in NPC and is associated with poor prognoses in patients with NPC

In order to screen differently lncRNA, we downloaded another NPC gene expression data from the Affymetrix Human Genome U133 Plus 2.0 platform-based studies in the study by Yang and Deng [16]. Hierarchical clustering showed systematic variations in the expression of lncRNAs between NPC and paired non-tumour samples; we found that SNHG12 expression was significantly up-regulated in NPC tissues. Then, in order to demonstrate the results of the microarray analysis, we performed RT-PCR to detect the expression of SNHG12 in NPC samples and matched normal samples, finding that SNHG12 expression was significantly up-regulated in NPC tissues compared with matched normal tissues (Fig. 1B). Furthermore, In NPC cells (SUNE1, CNE1, CNE2 and HNE-1), SNHG12 expression level was over-expressed compared with nasopharyngeal epithelial cell line NP69 (Fig. 1C). Taken together, our results indicated that SNHG12 expression was highly expressed in NPC and involved in progression of NPC.

Table 3
Univariate and multivariate analysis of overall survival in NPC patients

Variables	Univariate analysis			Multivariate analysis
	HR	95% CI	$p$ value	HR	95% CI	$p$ value
Gender	1.332	0.628–1.889	0.237	–	–	–
Age	1.554	0.783–2.223	0.188	–	–	–
T stage	1.783	0.893–2.441	0.113	–	–	–
N stage	1.655	0.714–2.897	0.134	–	–	–
M stage	1.325	0.561–1.955	0.093	–	–	–
EBV infection	1.416	0.674–2.315	0.116	–	–	–
Clinical stage	3.567	1.352–5.478	0.001	2.895	1.117–4.362	0.005
Grade	2.978	1.428–4.273	0.008	2.649	1.173–3.998	0.018
SNHG12 expression	3.554	1.564–5.173	0.003	3.018	1.176–4.562	0.008

In order to explore clinical significance of SNHG12 in NPC patients, NPC samples were classified into low SNHG12 expression group ( $n=$ 67) and the high SNHG12 expression group ( $n=$ 62) according to the median SNHG12 expression level of all NPC samples. As shown in Table 2, we found that a high level of SNHG12 expression was correlated with clinical stage ( $P=$ 0.001) and grade ( $P=$ 0.011). However, no significant difference was observed between SNHG12 expression and patients’ age, gender, T stage, N stage, M stage and EBV infection ( $P>$ 0.05). Then, we further performed Kaplan-Meier survival analysis to explore the prognostic value of SNHG12 in NPC patients, finding that the patients with a high SNHG12 expression had shorter overall survival times than those with a high SNHG12 expression ( $P=$ 0.0075). The overall survival rate over 5 years for the high SNHG12 group was 68.7% versus 54.9% for the low SNHG12 group, with median survival times of 41.5 and 58 months, respectively. Importantly, according to the univariate analysis, clinical stage, grade and high SNHG12 expression was correlated with overall survival (all $P<$ 0.05, Table 3). Finally, using a multivariate Cox regression analysis, we confirmed that SNHG12 expression (HR $=$ 3.018, 95% CI: 1.176–4.562, $P=$ 0.008), in addition to clinical stage, grade, was an independent predictor of overall survival (Table 3).

Figure 2.

The effects of SNHG12 on the proliferation and apoptosis of CNE1 and SUNE1 cells. (A) Relative expression levels of SNHG12 in CNE1 and SUNE1 cells transfected with SNHG12 siRNAs (SNHG12 siRNA1 and SNHG12 siRNA2) or negative control siRNAs (control siRNA). (B and C) Knockdown of SNHG12 inhibited the proliferation of CNE1 and SUNE1 cells detected by MTT assays. (D) SNHG12 knockdown reduced colony formation abilities of CNE1 and SUNE1 cells. (E) Cells apoptosis analysis of CNE1 and SUNE1 cells transfected with SNHG12 siRNAs detected by flow cytometry. * $P<$ 0.05, ** $P<$ 0.01.

Figure 3.

Knockdown of SNHG12 affected the migration and invasion of CNE1 and SUNE1 cells. (A and B) The migratory capacities of CNE1 and SUNE1 cells were reduced after transfecting with SNHG12 siRNAs using wound healing assays. (C and D) Transwell assays were applied to evaluate the invasive abilities of CNE1 and SUNE1 cells. (E and F) Western blot assays were applied to detect the protein levels of N-cadherin, vimentin and E-cadherin in CNE1 and SUNE1 cells. * $P<$ 0.05, ** $P<$ 0.01.

Figure 4.

SNHG12 modulated the activation of Notch signaling in CNE1 and SUNE1 cells. (A) The protein levels and optical density analysis of Notch1, P21 and Hes1 in CNE1 cells determined by western blot assay. (B) Western blot assays were employed to determine the protein levels of Notch1, P21 and Hes1 in SUNE1 cells. * $P<$ 0.05, ** $P<$ 0.01.

3.2 Silence of SNHG12 suppressed NPC cells proliferation and induced cells apoptosis

To evaluate whether SNHG12 played an essential role in NPC development, we first employed specific siRNAs against SNHG12 (SNHG12 siRNA1 and SNHG12 siRNA2) to silence the expression of SNHG12 in CNE1 and SUNE1 cells. Quantification real-time PCR assays revealed that the expression levels of SNHG12 were significantly reduced in CNE1 and SUNE1 cells after transfecting with SNHG12 siRNAs (Fig. 2A). Subsequently, the viability abilities of CNE1 and SUNE1 cells were determined using MTT assays. The results confirmed that both the tested NPC cells lines (CNE1 and SUNE1) transfected with the SNHG12 siRNAs markedly depressed the cells proliferation compared to cells in the control group (Fig. 2B and C). In addition, colony formation assays were also conducted to assess cell proliferative abilities in NPC cells. As shown in Fig. 2D, the downregulated expression of SNHG12 visibly attenuated colony formation in CNE1 and SUNE1 cells, which was consistent with the results of MTT assays. Furthermore, we also detected the apoptotic rates of CNE1 and SUNE1 cells transfected SNHG12 siRNAs using flow cytometry analysis. The results suggested that knockdown of SNHG12 notably accelerated the apoptosis of CNE1 and SUNE1 (Fig. 2E). Collectively, our data indicated that suppressing the expression of SNHG12 inhibited cell proliferation and induced cell apoptosis, implying that SNHG12 played critical roles in the development of NPC.

3.3 Depression of SNHG12 impaired the metastatic capabilities of NPC cells

Wound healing and transwell assays were then performed to explore the effects of SNHG12 on the migratory and invasive behaviors of NPC cells in vitro. As the data presented in Fig. 3A and B, wound healing assays confirmed that, the migratory capabilities of both CNE1 and SUNE1 cells transfected with SNHG12 siRNAs were significantly decreased compared to the scramble control cells. Besides, transwell assays demonstrated that knockdown of SNHG12 by transfecting siRNAs specific against SNHG12 resulted in decreased invasive abilities of CNE1 and SUNE1 cells when compared to the negative control group (Fig. 3C and D). Additionally, to determine whether the silence of SNHG12 could induce the alteration of epithelial-mesenchymal transition (EMT) related biomarkers, the protein expression of E-cadherin, vimentin and N-cadherin in CNE1 and SUNE1 cells were further detected by western blot analysis. The results certified that knockdown of SNHG12 enhanced the expression levels of E-cadherin, whereas inhibited the expression of vimentin and N-cadherin in CNE1 and SUNE1 cells, suggesting that silence of SNHG12 could modulate the protein levels of EMT related molecules in NPC cells (Fig. 3E and F). Taken together, these results provided evidence that SNHG12 played essential roles in regulating the migration and invasion of NPC cells through affecting the alteration of proteins involved in EMT.

3.4 Knockdown of SNHG12 inhibited the activation of Notch signaling in NPC cells

It was well known that Notch signaling pathways was closely associated with the development and progression of multiple cancer types. Therefore, to further ascertain the underlying mechanisms involved in the effects on cell proliferation, migration and invasion by SNHG12, we focused on Notch signaling pathway. The results of western blot analysis revealing that there was a marked decrease in protein expression of Notch1 and its downstream target proteins, P21 and Hes1 in CNE1 cells (Fig. 4A). Similarly, SNHG12 knockdown in SUNE1 cells could also remarkably suppressed the protein levels of Notch1, P21 and Hes1 (Fig. 4B). Overall, these results demonstrated that inhibitory effects of SNHG12 knockdown on the development and progression of NPC might be through repressing the activity of Notch signaling pathway.

4. Discussion

Globally, there are approximately 80,000 new cases of NPC per annum and circa 50,000 patients die of this neoplasm annually [17]. Up to date, NPC treatment remains a great problem in clinical practice. Sensitive Biomarkers not only help to diagnose the early stages of NPC rapidly, but also to implement effective individualized treatment and to assess the prognosis of patients [18, 19]. In this study, we screened a lncRNA SNHG12 that is significantly up-regulated in NPC tissues by analyzing microarray datasets downloaded from study by Yang and Deng [16]. In order to demonstrate the results of microarray analysis, we detect the expression levels of SNHG12 in NPC patients from our hospital and several NPC cell lines, finding that SNHG12 expression was significantly up-regulated in both NPC tissues and cell lines. In addition, clinical assay indicated that high SNHG12 expression was significantly associated with clinical stage and grade. Moreover, higher SNHG12 expression was associated with shorter overall survival of NPC patients. More importantly, SNHG12 level was identified to be an independent prognostic factor for NPC in univariate and multivariate analysis. Our results revealed that overexpression of SNHG12 may be used as a potential biomarker for predicting prognosis of NPC patients.

Recently, several studies have confirmed that SNHG12 was dysregulated in various tumors and served as a tumor promoter. For instance, Wang et al. reported that SNHG12 was highly expressed in non-small cell lung cancer and its overexpression contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer [20]. Lan et al. reported that SNHG12 expression was up-regulated in hepatocellular carcinoma and associated with advanced clinical stages and prognosis of hepatocellular carcinoma patients [21]. Another study by Dong et al. found that SNHG12 was overexpressed in cervical cancer and its inhibition could suppress cells growth and invasion by acting as a sponge for miR-424-5p [22]. Those findings highlighted the importance of SNHG12 in progression of tumors. However, the biological function of SNHG12 in NPC have not been investigated. In this study, our results demonstrated that SNHG12 knockdown could significantly inhibit the NPC proliferation and induced apoptosis, preliminarily revealing the relevance between SNHG12 and NPC growth. Moreover, we also found that knockdown of SNHG12 could suppressed the migration and invasion in NPC cells. There results were in line with the findings in clinical samples. It is known that epithelial-mesenchymal transition (EMT) is closely related to cancer cell metastasis ability, we further detected EMT markers in si-SNHG12 transfected and control NPC cells, finding that knockdown of SNHG12 can inhibit the EMT of NPC cells. Taken together, these results imply that SNHG12 might be a good metastasis suppressor in NPC.

Dysregulated Notch signaling along with genetic mutations in Notch signaling-associated factors impact the tumorigenicity and proliferation of cells in various cancers [23, 24]. Notch-1 is a multifunctional transmembrane receptor that regulates cellular differentiation, development, proliferation, and survival in a variety of contexts [25, 26]. Recently, growing studies indicates that the activation of Notch-1 signaling is implicated in tumorigenesis [27, 28]. Thus, a potential therapeutic target could be manipulation of this cellular signaling pathway. Recently, several studies reported that lncRNAs may exert tumor promoting role in the development and progression of various tumors through modulation of Notch signal pathway [29, 30]. Thus, in this study, in order to explore the potential mechanism by which SNHG12 exhibited its role in progression of NPC, we performed Western blot to detect the expression levels of related markers of Notch-1 signaling: we found that knockdown of SNHG12 obviously reduced the protein expression of Notch-1, P21 and Hes-1. Our findings revealed that SNHG12 might facilitate NPC progression via modulating the Notch signal pathway.

To be honestly, there were several limitations in this study. Firstly, because of the small number of patients analyzed in this study, further studies on a great number of patients are required to confirm our results. Secondly, in vivo experiments were not conducted in this study; further in vivo assay should be performed to confirm the function of SNHG12 in NPC. Thirdly, the potential mechanism by which SNHG12 modulated Notch signal pathway needed to be further studied.

In summary, we firstly provided evidence that SNHG12 expression is upregulated in NPC and its overexpression may be a potential biomarker for diagnosis and prognosis for patients with NPC. Functionally, SNHG12 promoted NPC cells proliferation, migration, invasion and EMT. In mechanism, SNHG12 promotes CRC tumorigenesis partly by modulating Notch-1 signaling pathway. Taken together, we provide novel insights into the functions and mechanisms of SNHG12 in the progression of NPC and highlight its potential as a therapeutic target for NPC intervention.

Footnotes

Conflict of interest

The authors declare no conflict of interest.

References

Lee

A.W.

B.B.

W.T.

and Chan

A.T.

, Management of nasopharyngeal carcinoma: Current practice and future perspective, J Clin Oncol 33 (2015), 3356–64.

C.C.

Fang

C.Y.

Hsu

H.Y.

Chuang

H.Y.

Cheng

Y.J.

Chen

Y.J.

Chou

S.P.

Huang

S.Y.

Lin

S.F.

Chang

Tsai

C.H.

and Chen

J.Y.

, EBV reactivation as a target of luteolin to repress NPC tumorigenesis, Oncotarget 7 (2016), 18999–9017.

Kamran

S.C.

Riaz

and Lee

, Nasopharyngeal carcinoma, Surg Oncol Clin N Am 24 (2015), 547–61.

Strazzulla

Barreca

G.S.

Giancotti

Pisani

Costa

Zicca

La Boria

Roveda

Liberto

M.C.

Tucci

Donato

Foca

and Torti

, Nasopharyngeal carcinoma: Review of the literature with a focus on therapeutical implications, Infez Med 23 (2015), 224–9.

Tsang

C.M.

and Tsao

S.W.

, The role of Epstein-Barr virus infection in the pathogenesis of nasopharyngeal carcinoma, Virol Sin 30 (2015), 107–21.

Flynn

R.A.

and Chang

H.Y.

, Long noncoding RNAs in cell-fate programming and reprogramming, Cell Stem Cell 14 (2014), 752–61.

G.C.

Pan

H.F.

Leng

R.X.

Wang

D.G.

X.P.

X.M.

and Ye

D.Q.

, Emerging role of long noncoding RNAs in autoimmune diseases, Autoimmun Rev 14 (2015), 798–805.

Cheetham

S.W.

Gruhl

Mattick

J.S.

and Dinger

M.E.

, Long noncoding RNAs and the genetics of cancer, Br J Cancer 108 (2013), 2419–25.

Maruyama

and Suzuki

, Long noncoding RNA involvement in cancer, BMB Rep 45 (2012), 604–11.

10.

Ning

Wei

Chen

and Yang

, LncRNA, NEAT1 is a prognosis biomarker and regulates cancer progression via epithelial-mesenchymal transition in clear cell renal cell carcinoma, Cancer Biomark 19 (2017), 75–83.

11.

Song

L.F.

Zhang

Peng

and Zhou

X.H.

, Long non-coding RNA XIST exerts oncogenic functions in human nasopharyngeal carcinoma by targeting miR-34a-5p, Gene 592 (2016), 8–14.

12.

Zhuang

Jin

C.S.

Yuan

H.J.

and Cheng

J.Z.

, Long non-coding RNA HNF1A-AS is upregulated and promotes cell proliferation and metastasis in nasopharyngeal carcinoma, Cancer Biomark 16 (2016), 291–300.

13.

Liu

Zheng

Xue

Chen

Wang

Zhang

and Liu

, Inhibition of TDP43-mediated SNHG12-miR-195-SOX5 feedback loop impeded malignant biological behaviors of glioma cells, Mol Ther Nucleic Acids 10 (2018), 142–158.

14.

Ding

Jiao

Zhang

and Dang

, LncRNA SNHG12 promotes the proliferation and metastasis of papillary thyroid carcinoma cells through regulating wnt/beta-catenin signaling pathway, Cancer Biomark 22 (2018), 217–226.

15.

Zhang

and Lu

, LncRNA SNHG12 regulates gastric cancer progression by acting as a molecular sponge of miR320, Mol Med Rep 17 (2018), 2743–2749.

16.

Yang

Q.Q.

and Deng

Y.F.

, Genome-wide analysis of long non-coding RNA in primary nasopharyngeal carcinoma by microarray, Histopathology 66 (2015), 1022–30.

17.

Miller

K.D.

Siegel

R.L.

Lin

C.C.

Mariotto

A.B.

Kramer

J.L.

Rowland

J.H.

Stein

K.D.

Alteri

and Jemal

, Cancer treatment and survivorship statistics, 2016, CA Cancer J Clin 66 (2016), 271–89.

18.

Hughes

Alusi

and Wang

, Gene therapy and nasopharyngeal carcinoma, Rhinology 50 (2012), 115–21.

19.

Zhang

Chen

Q.Y.

Liu

Tang

L.Q.

and Mai

H.Q.

, Emerging treatment options for nasopharyngeal carcinoma, Drug Des Devel Ther 7 (2013), 37–52.

20.

Wang

Chen

and Li

, LncRNA SNHG12 contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer, Oncotarget 8 (2017), 84086–84101.

21.

Lan

Hong

Chen

and Yuan

, Long non-coding RNA small nucleolar RNA host gene 12 (SNHG12) promotes tumorigenesis and metastasis by targeting miR-199a/b-5p in hepatocellular carcinoma, J Exp Clin Cancer Res 36 (2017), 11.

22.

Dong

Wang

and Xiao-Jin

, Upregulation of long non-coding RNA small nucleolar RNA host gene 12 contributes to cell growth and invasion in cervical cancer by acting as a sponge for miR-424-5p, Cell Physiol Biochem 45 (2018), 2086–2094.

23.

Geisler

and Strazzabosco

, Emerging roles of Notch signaling in liver disease, Hepatology 61 (2015), 382–92.

24.

Wang

Zang

Liu

X.S.

and Aster

J.C.

, The role of Notch receptors in transcriptional regulation, J Cell Physiol 230 (2015), 982–8.

25.

Espinoza

and Miele

, Notch inhibitors for cancer treatment, Pharmacol Ther 139 (2013), 95–110.

26.

Takeuchi

and Haltiwanger

R.S.

, Significance of glycosylation in Notch signaling, Biochem Biophys Res Commun 453 (2014), 235–42.

27.

Masiero

and Banham

A.H.

, Notch signaling: Its roles and therapeutic potential in hematological malignancies, Oncotarget 7 (2016), 29804–23.

28.

Liu

Wang

and Yu

, Trichosanthin down-regulates Notch signaling and inhibits proliferation of the nasopharyngeal carcinoma cell line CNE2 in vitro , Fitoterapia 83 (2012), 838–42.

29.

Yang

Duan

and Zhou

, Long non-coding RNA FOXD2-AS1 functions as a tumor promoter in colorectal cancer by regulating EMT and Notch signaling pathway, Eur Rev Med Pharmacol Sci 21 (2017), 3586–3591.

30.

Wang

Yan

Zhang

Wei

Pang

and Bian

, Upregulation of lncRNA PlncRNA-1 indicates the poor prognosis and promotes glioma progression by activation of Notch signal pathway, Biomed Pharmacother 103 (2018), 216–221.

Increased expression of lncRNA SNHG12 predicts a poor prognosis of nasopharyngeal carcinoma and regulates cell proliferation and metastasis by modulating Notch signal pathway

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

1. Introduction

2. Materials and methods

2.1 NPC tissue samples

Table 1 The primer sequences included in this study

2.3 Cell transfection and regents

2.4 Reverse transcription-quantitative polymerase chain reaction (qRT-PCR)

2.5 Western blot analysis

2.6 MTT assay

2.7 Colony formation assay

2.8 Cell apoptosis assay

2.9 Wound healing assays

2.10 Transwell assays

2.11 Statistical analysis

3.1 SNHG12 is highly expressed in NPC and is associated with poor prognoses in patients with NPC

Table 3 Univariate and multivariate analysis of overall survival in NPC patients

3.3 Depression of SNHG12 impaired the metastatic capabilities of NPC cells

3.4 Knockdown of SNHG12 inhibited the activation of Notch signaling in NPC cells

4. Discussion

Footnotes

Conflict of interest

References

Table 1
The primer sequences included in this study

Table 3
Univariate and multivariate analysis of overall survival in NPC patients