Abstract
SRY (sex determining region Y)-box 2 (SOX2) plays an important role in tumor cell metastasis and apoptosis. Laryngeal squamous cell carcinoma (LSCC), responsible for 1.5% of all cancers, is one of the most common head and neck malignancies. Accumulating evidence shows that SOX2 is overexpressed in several human tumors, including lung cancer, esophageal carcinoma, pancreatic carcinoma, breast cancer, ovarian carcinoma and glioma. Our study aimed to investigate the silencing effects of SOX2 expression using RNA interference (RNAi) on various biological processes in laryngeal cancer TU212 cells, including proliferation, apoptosis, invasion and metastasis. We also studied the involvement of the MAPK/JNK signaling pathway in the biological effects of SOX2 siRNA in TU212 cells. We found that silencing SOX2 decreased the proliferation, migration, and invasion of TU212 cells, and induced apoptosis. This effect of silencing SOX2 could be reversed by silencing MAP4K4. Therefore, we consider SOX2 as a key regulator of the upstream MAP4K4/JNK signaling pathways that could be a potential therapeutic target in the treatment of patients with or prevention of laryngeal cancer.
Keywords
Introduction
Laryngeal cancer is a common malignancy in otolaryngology and accounts for 2.4% of new malignancies every year (Lin and Bhattacharyya 2008). It is the 11th most common form of cancer in men worldwide, particularly in middle-aged men, and is the third-most common type of head and neck carcinoma (Marioni et al. 2006). Despite modern diagnostic advances in surgical techniques, radiotherapy, and chemotherapy, the five-year survival rate still remains low owing to tumor invasion and metastasis (Almadori et al. 2005; Higgins and Wang 2008). Therefore, it is essential to find reliable biological markers associated with tumorigenesis and tumor progression for developing novel strategies in the prevention and treatment of patients with laryngeal cancer.
The SOX (SRY-related high mobility group box) gene family encodes a group of transcription factors that are characterized by a highly conserved high-mobility group (HMG) domain (Bowles et al. 2000; Wilson and Koopman 2002). SOX2, a member of the SOX family, is a key transcription factor involved in stem cell biology, organogenesis and animal development (Kamachi et al. 2000). It has been reported that SOX2 plays an important role in maintaining the pluripotency of embryonic stem cell in self-renewal and differentiation and even in determining stem cell fate (Ellis et al. 2004). Accumulated evidence shows that SOX2 is overexpressed in several human tumors, including lung cancer, esophageal carcinoma, pancreatic carcinoma, breast cancer, ovarian carcinoma, and glioma (Bass et al. 2009; Rodriguez-Pinilla et al. 2007; Sanada et al. 2006; Schmitz et al. 2007; Wilbertz et al. 2011; Yang et al. 2014b; Ye et al. 2011). Tang et al. (2013) reported that SOX2 may contribute to the malignant progression of laryngeal squamous cell carcinoma (LSCC), and present as a useful prognostic marker and a potential therapeutic target for LSCC patients. Although our previous studies have demonstrated that SOX2 correlates with laryngeal tumorigenesis and development through signal pathways, such as Phosphoinositide 3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) and Wnt/β-catenin pathways (Yang et al. 2014a, 2014b), the precise pathomechanism of SOX2 in laryngeal carcinoma is still unclear.
Recently, it has been reported that SOX2 regulates apoptosis through the MAPK kinase kinase kinase isoform 4 (MAP4K4)-Survivin signaling pathway in human lung cancer cells (Chen et al. 2014). MAP4K4, a germinal center protein kinase belonging to the mammalian STE20/MAP4K family, is implicated in the activation of the c-jun N-terminal kinase (JNK) pathway (Machida et al. 2004). In this study, we investigated the involvement of the MAPK/JNK signaling pathways in the biological effects of SOX2 using small interfering RNA (siRNA)-mediated silencing of SOX2 in TU212 cells. We found that silencing SOX2 decreased cellular proliferation, migration and invasion, and induced apoptosis through the MAPK/JNK signaling pathway. Together, our data highlight an important role for SOX2 in controlling LSCC progression through the MAP4K4/JNK signaling pathway.
Materials & Methods
Cell Culture
The larynx carcinoma cell line TU212 cells were obtained from BioHermes Co. (Wuxi, China) and cultured in RPMI 1640 medium (Gibco; Grand Island, NY) with 10% fetal bovine serum (FBS; Hyclone, Logan, UT), 100 U penicillin and 100 mg/ml streptomycin (Gibco), hereafter referred to as standard media. The cells were kept at 37°C in a humidified atmosphere containing 5% CO2.
Cell Transfection
For siRNA(-) and siRNA(SOX2)-1/-2 cell lines, cells were harvested for transfection. Lipofectamine-2000 Transfection Reagent and plasmid DNA (Invitrogen, Grand Island, NY) were diluted in Opti-MEM. The diluted SOX2-siRNA-1 plasmid and SOX2-siRNA-2 plasmid were combined with Lipofectamine-2000 (1:1 ratio) and incubated for 20 min at room temperature. Plated cells were then incubated with this DNA-lipid complex for 4 hr at 37°C. The transfected cells were then cultured in RPMI-1640 medium containing Geneticin (G418; Gibco) for 1–2 weeks for the selection of stable clones. The transfection efficiency was assessed by fluorescence microscopy.
RNA Interference
To generate siRNA(SOX2)+siRNA(-) and siRNA(SOX2)+siRNA(MAP4K4) cell lines, the stable clones siRNA(SOX2) cells were harvested. MAP4K4 and a control siRNA were purchased from Invitrogen. siRNA(SOX2) cells were then transfected with MAP4K4 siRNA or control plasmid using Lipofectamine-2000 (1:1 ratio) and incubated for 20 min at room temperature. Plated cells in 6-well plates were then switched to standard media for 48 hr at 37°C. For the siRNA(SOX2)+SP600125 group, cells were treated with 10 μM SP600125 (JNK inhibitor) for a further 1 hr. The cells were harvested and used for flow cytometry, western blotting and other assays.
RT-PCR Analysis
Cells were harvested and extracted using RNA Simple Total RNA Kit (DP419; Tiangen Co, Beijing, China) according to the manufacturer’s protocol. Briefly, 1 μg total RNA was reverse transcribed in a volume of 20 μl for cDNA synthesis using 2×Power Taq PCR MasterMix (PR1702; BioTeke Co., Beijing, China). The conditions for the RT reactions were 25°C for 10 min, 42°C for 50 min, and 95°C for 5 min. The products were then amplified for PCR. Primers used in PCR were as follows: SOX2, CATCACCCACAGCAAATGAC (sense) and CAAAGCTCCTACCGTACCACT (antisense); MAP4K4, AGCCCAAAGCCCACTACGA (sense) and GCTCCAATACTCTGCCTGTCTG (antisense); β-actin, CTTAGTTGCGTTACACCCTTTCTTG (sense) and CTGTCACCTTCACCGTTCCAGTTT (antisense). For each PCR reaction, a mix was prepared including SYBR GREEN Master Mix (Solarbio Co.; Beijing, China), sense and antisense primers, and 10 ng template cDNA. The PCR amplification conditions were 95°C for 10 min, 40 cycles of 95°C for 10 sec, 60°C for 20 sec, and 72°C for 30 sec, and then 4°C for 5 min. The PCR results were verified by varying the number of PCR cycles for each cDNA and set of primers. PCR was performed using an ExicyclerTM 96 RT-PCR machine (Bioneer; Daejeon, Korea) with β-actin as a control. RT-PCR was performed at least in triplicate.
Western Blot Analysis
Cells were harvested and lysed in ice-cold radioimmunoprecipitation (RIPA) buffer (Beyotime Co., Shanghai, China) plus PMSF (Beyotime Co.), and total protein concentrations in the supernatant were determined using the Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime Co.) following manufacturer’s instructions.
Western blot analysis was performed using a standard protocol. The primary antibodies used in this study were as follows: rabbit anti-SOX2 and β-actin (1:1000; Santa Cruz Biotechnology, Dallas, Texas) and rabbit anti-Bcl-2, Bax, caspase-8, caspase-3, MAP4K4, JNK and p-JNK (1:1000; Cell Signaling Technology, Beverly, MA). The secondary antibodies were goat anti-rabbit IgG horseradish peroxidase (HRP) (Beyotime Co.). Briefly, equal amounts of total proteins were fractionated on sodium dodecyl sulfate polyacrylamide gels and transferred electrophoretically to polyvinylidene fluoride membranes (Millipore; Bedford, MA). The membranes were blocked with 5% (w/v) skim milk in TBS-T buffer (10 mM Tris-HCl, 150 mM NaCl, and 1% Tween-20) for 30 min and then incubated with the appropriate primary antibodies overnight at 4°C. Subsequently, the membranes were washed and then incubated with secondary antibodies at room temperature for 1 hr. Protein bands were developed with an enhanced chemiluminescence (ECL) detection kit (7 Sea Biotech; Shanghai, China) according to the manufacturer’s instructions. Quantitative analysis for western blotting was performed using Gel-Pro-Analyzer software.
Colony Forming Cell Assay
Cells were seeded into 35-mm cell culture dishes (Corning Inc; Corning, NY) and cultured in standard media, with media replaced every 3 days. After 14 days, the cells were fixed with paraformaldehyde for 5–8 min and then stained with Wright-Giemsa (Jiancheng; Nanjing, China). The stained cells were observed and photographed under a stereomicroscope. Aggregates of >50 cells were scored as a colony, and the experiment was repeated at least three times.
MTT Assay
Cells were seeded into 96-well plates at a density of 3×103 cells/well and incubated in standard media for 24, 48, 72 or 96 hr and then analyzed for cell growth. Five duplicate wells were set up for each group. At each time point, 0.2 mg/ml MTT (Sigma-Aldrich; St. Louis, MO) was added to each well and incubated for 4 hr, and then combined with 200 μl DMSO (Sigma-Aldrich). After complete solubilization of the dye, the absorbance of the wells was measured using a microplate spectrophotometer (Biotek; Winooski, VT) at 490 nm. The inhibition rate was calculated as (1 -Aexperiment/Avehicle control) × 100%.
Wound Healing Assay
Cells were seeded into 6-well plates and cultured in standard media until confluence (80% to 90%). The media was discarded and a wound was simulated by creating scratches across the plate using a 200-µl pipette tip. The plates were washed twice with serum-free media and the cells observed and photographed using microscopy to ensure that there were sufficient cells t the leading edge of the wound. The cells were then grown in serum-free medium for 12 or 24 hr before final images were acquired. Migration rates were calculated by measuring the distance traveled toward the center of the wound.
Transwell Assay
Transwell chambers with polycarbonate filters were purchased from Corning Inc. The lower chamber was filled with RPMI 1640 containing 10% FBS. Cells were seeded into each upper chamber at the density of 5×104 cells/ml in 200 μl serum-free medium (1×104 cells per well). An additional 800 μl of medium containing 20% FBS was added into the lower chamber. Three duplicate wells were set up for each group. The cells were removed from the upper chamber by a cotton swab after 24 hr. The cells that had penetrated into the lower chamber and attached to the bottom of the filter were fixed with 4% formaldehyde for 20 min and then stained with 0.1% crystal violet for 5 min. The cells were then imaged using phase-contrast microscopy and a ×20 objective (Motic China Group Co.; Xiamen, China). The number of cells in the lower chamber was counted using a high-power lens (×200) in five random fields. Statistical results of cell numbers per image field were obtained from the mean of five image fields over three independent experiments.
Hoechst Staining Assay
First, cells were seeded into 12-well plates at a density of 1×105 cells/well and incubated in medium containing 10% FBS for 24 hr. At 80% confluence, the cells were fixed with stain fixative (Beyotime) for 20 min. Fixed cells were washed in cold PBS twice each for 3 min and then stained using Hoechst (Beyotime) for 5 min. Morphological changes to the cytoskeleton were observed by fluorescence microscopy (Olympus; Tokyo, Japan).
Apoptosis Assay
Apoptotic cells were quantified by flow cytometry using an Annexin V-FITC/PI Apoptosis Detection Kit (KeyGEN BioTECH; Nanjing, China) according to the manufacturer’s recommended protocol. Briefly, cells were harvested, washed twice with ice-cold PBS and incubated with 500 μl of the Annexin V binding buffer. Five µl of Annexin V-FITC and PI were added to the cell suspension and incubated at room temperature for 15 min in the dark before flow cytometry analysis using a FACSCalibur (Becton Dickinson; San Jose, CA).
Statistical Analysis
Data are presented as the mean ± standard deviation (SD) of at least three experiments. Statistical comparisons were analyzed by Bonferroni’s multiple comparison tests or analysis of variance. A p<0.05 was considered statistically significant.
Results
Silencing SOX2 in TU212 Cells and the Establishment of Stable Sub-clone Cell Lines with siRNA(SOX2)
To investigate the role of SOX2 in laryngeal carcinoma, we compared changes in the cellular activity of various stable sub-clone cell lines: siRNA(SOX2)-1/-2 TU212 cells, TU212 cells transfected with SOX silence vectors, and siRNA(-) TU212 cells (TU212 cells transfected with an empty vector). Stable transfection efficiency was confirmed using RT-PCR was used to test the mRNA level of SOX2 in TU212, siRNA(-), siRNA(SOX2)-1 and siRNA(SOX2)-2 cells. The mRNA level of SOX2 was 4-fold lower in the siRNA(SOX2)-1/-2 cells (0.27 ± 0.03 or 0.26 ± 0.04) than in the siRNA(-) (0.94 ± 0.10) cells (Fig. 1A; p<0.01). Western blot further confirmed the reduction in SOX2 in siRNA(SOX2)-1/-2 cells (Fig. 1B). There was no obvious difference between siRNA(-) and TU212 cells (Fig. 1B, p<0.01). These data suggest that we have generated stable subclones of TU212 cells with SOX2 silenced (siRNA(SOX2)-1/-2 cells) and appropriate negative control cells (siRNA(-) cells).

Silencing SOX2 in TU212 cells and the establishment of stable sub-clone cell lines with siRNA(SOX2). (A) Relative mRNA level of SOX2 in TU212, siRNA(-), siRNA(SOX2)-1 and siRNA(SOX2)-2 cells, as tested by RT-PCR. (B) The expression of SOX2 protein in TU212, siRNA(-), siRNA(SOX2)-1 and siRNA(SOX2)-2 cells compared using western blotting when the cells were in their logarithmic growth phase. **p<0.01 versus siRNA(-) group. Abbreviations: TU212, TU212 cells without RNA interference; siRNA(-), TU212 cells transfected with an empty vector; siRNA(SOX2)-1/-2, TU212 cells transfected with SOX2-silence plasmid -1/-2.
Silencing SOX2 Attenuates Cell Proliferation in TU212 Cells
To study the effect of SOX2 silencing on cell proliferation in TU212 cells, we first used colony forming assays to test changes in proliferation in siRNA(SOX2) cells as compared with siRNA(-) and TU212 control cells. As shown in Fig. 2A, after 14 days incubation, siRNA(-) had no effect on the growth of TU212 cells, whereas we observed much fewer aggregates in siRNA(SOX2)-1/-2 cells (Fig. 2A). The colony forming assay revealed that the efficiency of siRNA(SOX2) cells was 50% slower than that of siRNA(-) cells, with fewest aggregates seen for siRNA(SOX2)-2 cells among the four groups (29.08% ± 3.19% for siRNA(SOX-2)-2 vs. 72.25% ± 7.76% for TU212, p<0.01; Fig. 2B).

Silencing SOX2 expression attenuates cell proliferation in TU212 cells. (A) Colony forming was decreased by silencing SOX2 in siRNA(SOX2) TU212 cells as compared with TU212 and siRNA(-) cells. (B) Colony forming efficiency in (A) was calculated and compared. (C) Suppression of cell proliferation by SOX2 siRNA in TU212 cells, as measured by an MTT assay. The proliferation of TU212 cells was significantly inhibited from 24 hr to 96 hr after SOX2 silencing. **p<0.01 versus siRNA(-) group.
Additionally, the MTT assay showed that the proliferation of siRNA(SOX2) cells was attenuated in a time-dependent manner, as compared with siRNA(-) cells (Fig. 2C). Therefore, we show that knockdown of SOX2 by siRNA can attenuate the growth of TU212 cells.
Suppression of Cell Invasion and Migration Is Induced by SOX2 siRNA
To study whether SOX2 was necessary for cell migration and invasion in TU212, a wound healing assay was used to test TU212 cell migration after silencing SOX2. Cells treated with SOX2 siRNA showed decreased migration after 12 hr and 24 hr (Fig. 3A). In particular, the migration distance was sharply decreased in siRNA(SOX2)-1/-2 cells with siRNA(SOX2)-2 cell migration slowest among the four groups. With no obvious differences between TU212 and siRNA(-) cells, the migration rate of siRNA(SOX2)-2 vs. siRNA(-) was 24.24% ± 3.63% vs. 48.23% ± 5.10%, respectively, for 12 hr and 43.74% ± 5.21% vs. 73.31% ± 7.58%, respectively, for 24 hr (p<0.01; Fig. 3A).

Suppression of cell invasion and migration was induced by SOX2 siRNA. (A, B) Wound healing assay after silencing SOX2 expression. Migration was significantly inhibited in siRNA(SOX2)-1/-2 cells (A), as calculated in (B). Scale, 100 μm. (C and D) Transwell assay after silencing SOX2 expression comparing the proportions of invading cells in TU212, siRNA(-), siRNA(SOX2)-1 and siRNA(SOX2)-2 cells. Scale, 200 μm. **p<0.01 versus shRNA(-) group.
A transwell assay was used to investigate the role of SOX2 in invasion. As compared with the siRNA(-) group, siRNA (SOX2) cells showed impaired invasion (Fig. 3B). Moreover, the number of cells that had adhered to the lower membranes in the bottom chamber of the transwell was lower in the siRNA(SOX2) group as compared with cells in the siRNA(-) group (59.40 ± 6.69 vs. 127.00 ± 14.23, respectively; p<0.01, Fig. 3B). These results suggest that SOX2 siRNA can suppress the invasion and migration of laryngeal cancer cells.
Silencing SOX2 Expression Induces Apoptosis in TU212 Cells
Apoptosis was quantified using the Annexin V-FITC Apoptosis Detection Kit and flow cytometry to evaluate the correlations between SOX2 siRNA and apoptosis in TU212 cells, (Fig. 4A). The apoptotic index was 22.58% ± 2.43% in siRNA(SOX2)-2 cells, which is significantly higher than siRNA(-) cells (3.97% ± 0.67%, p<0.01, Fig. 4A). We also assessed the cells using morphological observation of Hoechst-stained cells, observed by fluorescence microscopy. The results indicated that apoptosis occurred in siRNA(SOX2) cells after 24 hr (Fig. 4B). The data indicates that SOX2 siRNA induces apoptosis in TU212 cells.

Silencing SOX2 expression induces apoptosis in TU212 cells. (A) The levels of apoptotic cells was determined by flow cytometry of Annexin V-FITC-stained cells. The number of apoptotic cells was higher in siRNA(SOX2)-1/-2 cells than in TU212 and siRNA(-) cells (A, above). (B) Expression of apoptosis-related proteins—Bcl-2, Bax, caspase-8 and caspase-3—were compared in TU212, siRNA(-), siRNA(SOX2)-1 and siRNA(SOX2)-2 cells using western blotting **p<0.01 versus siRNA (-) group. (C) Apoptosis, as induced by SOX2 siRNA, was observed by Hoechst staining in siRNA(SOX2) cells after 24 hr. Scale, 20 μm.
We next assessed the mechanism of apoptosis by detecting changes in apoptosis-related proteins in each of the cell lines using western blotting. Cleaved caspase-3 and caspase-8 were detected, suggesting that a caspase-mediated pathway participated in apoptosis. Apoptosis activation is primarily regulated by a balance between pro-survival Bcl-2 proteins, such as Bcl-2, and pro-apoptotic proteins, such as Bax (Renault et al. 2013). Therefore, we tested changes in the expression of these two proteins. We found a downregulation in Bcl-2 and an upregulation in Bax (Fig. 4C, above). The quantitative gray intensity values for cleaved caspase-3, cleaved caspase-8, Bcl-2 and Bax between siRNA(SOX2)-2 and siRNA(-) were 2.12 ± 0.25 vs. 1.00 ± 0.11; 3.09 ± 0.33 vs. 0.97 ± 0.10; 0.40 ± 0.04 vs. 0.95 ± 0.10; and 3.19 ± 0.33 vs. 1.03 ± 0.14, respectively (p<0.01, Fig. 4C, below). Thus, a down-regulation in Bcl-2 and an up-regulation in Bax seem to account for the activation of apoptosis as induced by SOX2 siRNA in TU212 cells.
Silencing SOX2 Alters MAPK/JNK Signaling through the Activation MAP4K4 and Down-regulation of JNK Phosphorylation
To investigate the potential mechanism of MAP4K4 activation in response to SOX2 silencing, we first examined the relative mRNA levels of MAP4K4 by RT-PCR (Fig. 5A). We show that the mRNA level of MAP4K4 was significantly increased in siRNA(SOX2)-1/-2 cells. We further confirmed these results using western blot analysis (Fig. 5 B), showing that SOX2 siRNA induced a high level of MAP4K4 (0.96 ± 0.10 in siRNA(-) cells to 2.00 ± 0.28 in siRNA(SOX2)-2 cells; Fig. 5B and C). Furthermore, we found that SOX2 silencing also suppressed the phosphorylation of JNK (1.02 ± 0.09 in siRNA(-) cells to 0.35 ± 0.04 in siRNA(SOX2)-2 cells; p<0.01, Fig 5B and C). These results show that silencing SOX2 can inhibit the phosphorylation of JNK through an up-regulation of MAP4K4.

Silencing SOX2 expression alters MAPK/JNK signaling through the activation of the MAPK signaling protein, MAP4K4, and a down-regulation in JNK phosphorylation. (A) mRNA changes in MAP4K4 in TU212 cells following SOX2 silencing, as determined by RT-PCR. (B) Phosphorylation of JNK and the expression level of MAP4K4 in TU212 cells after SOX2 silencing as tested by western blot analysis. (C) Quantitative analysis of the gray intensity values. **p<0.01 versus siRNA(-) group.
Silencing MAP4K4 in siRNA(SOX2) cells Reverses JNK Phosphorylation Inhibition
To test whether the down-regulation of JNK phosphorylation is mediated through MAP4K4, we silence MAP4K4 in siRNA(SOX2)-2 cells, as the effects of siRNA(SOX) was more pronounced in siRNA(SOX2)-2 cells than siRNA(SOX2)-1 cells. First, we measured the mRNA levels of MAP4K4 by RT-PCR (Fig. 6A) and, as expected, found a significant downregulation of MAP4K4 in response to MAP4K4 siRNA in siRNA(SOX2) cells. Next, we tested changes in protein levels of MAP4K4 and phosphorylation of JNK using western blotting (Fig. 6B). MAP4K4 is reported to be upstream of the JNK (Su et al. 1997). As hypothesized, silencing MAP4K4 in siRNA(SOX2) cells reversed the inhibition of JNK phosphorylation, suggesting that JNK phosphorylation is mediated by MAP4K4 (1.02 ± 0.99 in siRNA(SOX2)+siRNA(-) cells to 1.94 ± 0.22 in siRNA(SOX2)+siRNA(MAP4K4) cells; p<0.01, Fig. 6B). To determine the role of JNK signaling in this study, SP600125, as a specific inhibitor of JNK, was used for 1 hr in siRNA(SOX2) cells. We show that SP600125 inhibits JNK phosphorylation, but had no effect on MAP4K4 levels in siRNA(SOX2) cells. These data show that silencing MAP4K4 can increase the phosphorylation of JNK in siRNA(SOX2) cells. The phosphorylation level of JNK was from 1.02±0.09 in siRNA(SOX2)+siRNA(-) cells to 0.48±0.07 in siRNA(SOX2)+SP600125 cells as well as the level of MAP4K4 from 1.04±0.12 in siRNA(SOX2)+ siRNA(-) cells to 1.01±0.12 in siRNA(SOX2)+SP600125 cells. Thus, we can suppose that SOX2 siRNA inhibits the proliferation and induces apoptosis in TU212 cells through a down-regulation of JNK phosphorylation mediated by MAP4K4.

Silencing MAP4K4 in siRNA(SOX2) cells reverses the down-regulation of JNK phosphorylation. (A) Relative expression levels of MAP4K4 mRNA in siRNA(SOX2) cells transfected with MAP4K4 siRNA or a negative control were tested by RT-PCR. (B) Phosphorylation of JNK and the expression level of MAP4K4 as tested by western blot analysis in siRNA(SOX2) cells transfected with MAP4K4 siRNA or a negative control. Quantitative analysis of gray intensity was calculated (below). ##p<0.01 versus siRNA(-) group; **p<0.01 versus siRNA(SOX2)+siRNA (-) group. Abbreviations: siRNA(-), TU212 cells transfected with an empty vector; siRNA(SOX2), TU212 cells stably transfected with SOX2-silence plasmid, the same plasmid with the one transfected in siRNA(SOX2)-2 cells; siRNA(SOX2)+siRNA(-), siRNA(SOX2) cells transfected with an empty vector; siRNA(SOX2)+siRNA(MAP4K4), siRNA(SOX2) cells transfected with MAP4K4-silencing plasmid; siRNA(SOX2)+SP600125, siRNA(SOX2) cells treated with 10 μM JNK inhibitor SP600125.
Silencing MAP4K4 Increases the Invasive and Migratory Potential of siRNA(SOX2) Cells
To further study the effect of MAP4K4 silencing in siRNA(SOX2) cells, we repeated the cell invasion, migration and apoptosis assays. As shown in Fig. 7A, MAP4K4 siRNA increased cell migration after 12 hr and 24 hr incubation (Fig. 7A); indeed, the migration rate was increased from 37.66% ± 6.05% to 61.56% ± 6.94% after 24 hr incubation (Fig. 7B, p<0.01). In the transwell assay, compared with siRNA(SOX2) +siRNA(-) group, the siRNA(SOX2)+siRNA(MAP4K4) cells showed increased invasion (Fig. 7D), with an increase in the numbers of cells adhering to the lower membranes of the transwell chambers in siRNA(SOX2)+siRNA(MAP4K4) group, twice that over the siRNA(SOX2)+siRNA(-) group (97.80 ± 10.08 vs. 47.00 ± 5.34, p<0.01; Fig. 7C).

Silencing MAP4K4 increases the invasive and migratory potential of siRNA(SOX2) cells. (A) Wound healing assay after silencing MAP4K4 expression in siRNA(SOX2) cells showed a significant increase in migration. (B) Quantification of the migration rate. Scale, 100 μm. (C) Transwell assay after silencing MAP4K4 in siRNA(SOX2) cells. (D) Quantification of the invading cells. ##p<0.01 versus siRNA(-) group; **p<0.01 versus siRNA(SOX2)+siRNA (-) group. Scale, 200 μm.
Silencing MAP4K4 Inhibits Apoptosis in siRNA(SOX2) Cells
Finally, flow cytometry and western blotting were used to study the role of MAP4K4 silencing on apoptosis in siRNA(SOX2) cells. We found that silencing MAP4K4 decreased the apoptosis induced by SOX2 siRNA (Fig. 8A) from 23.87% ± 2.45% to 10.43% ± 1.16%, as determined by flow cytometry (Fig. 8B). Western blotting showed that silencing MAP4K4 blocked SOX2 siRNA-induced capase-3/-8 cleavage, the up-regulation of Bax, and down-regulation of Bcl-2 (Fig. 8C, 8D). Thus, these results suggest that MAP4K4 is a mediator of SOX2 siRNA-induced invasion and migration as well as apoptosis in laryngeal cancer cells.

Silencing MAP4K4 inhibited the apoptosis in siRNA(SOX2) cells. (A, B) Levels of apoptotic cells determined by FACS analysis after staining with Annexin V-FITC. Fewer apoptotic cells were detected after silencing MAP4K4 in siRNA(SOX2) cells. (C, D) The expression levels of apoptosis-related proteins Bcl-2, Bax, caspase-8, and caspase-3, in siRNA(SOX2), siRNA(SOX2)+siRNA(-), siRNA(SOX2)+siRNA(MAP4K4) and siRNA(SOX2)+SP600125 cells were tested and compared by western blot analysis and quantified. ##p<0.01 versus siRNA(-) group; **p<0.01 versus siRNA(SOX2)+siRNA(-) group.
Discussion
LSCC, responsible for 1.5% of all cancers, is one of the most common head and neck malignancies (Shah et al. 1997). Despite the significant advances in modern diagnostics, surgical techniques, and systemic chemotherapy treatments in clinical trials, tumor invasion and metastasis with poor prognosis is still the leading cause of death among laryngeal cancer patients (Zhao et al. 2013). Therefore, understanding the molecular mechanisms involved in LSCC metastasis and identifying the molecules contributing to the process are of great importance. It has also been reported that SOX2 promotes the proliferation, clonogenicity, and tumorigenicity of cervical cancer cells and breast cancer cells in both in vitro cell lines and in in vivo xenograft models (Leis et al. 2012; Ye et al. 2011). Recently, the overexpression of SOX2 has been reported to correlate with poor progression and metastasis of LSCC (Tang et al. 2013), which seems to suggest that SOX2 might serve as a novel candidate oncogene in carcinogenesis. In this study, we investigated the role of SOX2 in the proliferation, metastasis (migration and invasion), and apoptosis of cells using an LSCC model. We used western blotting and PCR to confirm that silencing of SOX2 in siRNA(SOX2)-1/-2 TU212 cells had a clear inhibitory effect on the proliferation, migration and invasion of TU212 cells, and caused an increase in the degree of apoptosis of these cells (Fig. 1). Western blot analysis also showed an upregulation in MAP4K4 concomitant with a decrease in p-JNK levels in siRNA(SOX2)-1/-2 TU212 cells. Silencing MAP4K4 attenuated SOX2 siRNA-induced apoptosis and restored the inhibited invasion and migration. Our data overall suggest that the regulatory effect of SOX2 on apoptosis and metastasis was, at least in part, mediated through the MAP4K4/JNK signaling pathway.
SOX2 is reported to affect proliferation in numerous cell types (Wegner 1999). Here, we investigated the growth inhibition of SOX2 siRNA in TU212 cells by colony forming assays, and found that colony formation was decreased by silencing SOX2 expression in siRNA(SOX2) TU212 cells. Using an MTT assay, we further showed that SOX2 siRNA inhibits TU212 proliferation at 24 hr to 96 hr after SOX2 silencing (Fig. 2), suggesting that silencing SOX2 can suppress cell proliferation in TU212 cells.
Tumor metastasis, consisting of multiple sequential steps starting with invasion of cancer cells into surrounding tissues, is the key factor that compromises the prognosis of tumor patients and accounts for 90% of tumor death (Christofori 2006; Yang et al. 2014a). Numerous studies have suggested that SOX2 could promote cell migration (Christofori 2006; Li et al. 2013; Yang et al. 2014a, 2014b). Here we confirm this, demonstrating that silencing SOX2 decreases cell invasion and migration in LSCC cells (Fig. 3). With reduced migratory and invasive capacity, SOX2-silenced TU212 cells show poor spreading into surrounding tissues and minimal penetration of the walls of lymphatic and/or blood vessels. Hence, suppressing SOX2 siRNA in TU212 cells demonstrated a role for SOX2 in the process of metastasis.
Although cell death occurs in malignancies through multiple processes (autophagy, necrosis and apoptosis), the best described in association with LSCC is apoptosis (Chen et al. 2014). Apoptosis, identified by morphological and molecular changes, is mediated through caspases (Adams 2003). Feng et al. (2013) previously reported that knockdown of SOX2 results in a decrease in survivin expression, thereby initiating the mitochondria-dependent apoptosis related to caspase-9 activation. We found that silencing SOX2 induces apoptosis in TU212 cells and cleavage of both caspase-3 and caspase-8 (Fig. 4). Caspase-3 is known to play a central role in apoptotic activation (Yin et al. 2011). Upstream of caspases, apoptosis is decided by changes in the balance between anti-apoptotic Bcl-2 and pro-apoptotic Bax, for example (Adams and Cory 2007). Bcl-2 binds to Bax and inhibits Bax activation. In this study, we found an upregulation in Bcl-2 expression and a downregulation in Bax expression after silencing SOX2. Thus, apoptosis in siRNA(SOX2) cells was likely initiated through the caspase cascade, with a prevention in the release of Bax from the Bax/Bcl-2 heterodimeric complex (Ley et al. 2005). However, the precise mechanism(s) by which SOX2 silencing causes apoptosis in TU212 cells remains to be elucidated.
To further study the pathway of SOX siRNA-induced apoptosis as well as inhibition of metastasis, we assessed changes in MAPK/JNK signaling. We showed that the expression level of MAP4K was up-regulated and the phosphorylation level of JNK down-regulated in TU212 cells with SOX2 siRNA (Fig. 5). MAP4K4 was previously reported as a key protein in the induction of apoptosis following SOX2 silencing (Chen et al. 2014). Thus, we can suppose that SOX2 inhibits the proliferation and metastasis and induces apoptosis in TU212 cells through a down-regulation of JNK phosphorylation mediated by MAP4K4.
Since MAP4K4 has been strongly associated with apoptosis and metastasis, we next silenced its expression in siRNA(SOX2) cells and found that silencing MAP4K4 reverses the inhibition of metastasis induced by SOX2 siRNA (Figs. 5, 6, 7). Also, the apoptosis induced by SOX2 siRNA was able to be suppressed by MAP4K4 silencing (Fig. 8). Previous reports have indicated that p53 upregulates JNK signaling to drive apoptosis (Miled et al. 2005) and that MAP4K4 regulates JNK (Machida et al. 2004; Su et al. 1997; Yao et al. 1999). To assess whether MAP4K4 is the upstream mediator of JNK activity, we silenced MAP4K4 in siRNA(SOX) cells and found that the inhibition of p-JNK was recovered. Also, the up-regulation of MAP4K4 could not be decreased by the JNK inhibitor, SP600125 (Fig. 6). Thus we can conclude that MAP4K4 is an upstream mediator of JNK phosphorylation, and that the regulatory effect of SOX2 on apoptosis and metastasis was, at least in part, mediated through the MAP4K4/JNK signaling pathway.
Some studies have demonstrated that MAP4K4 contributes to growth and migration properties of tumor cells (Collins et al. 2006; Liu et al. 2011) and showed that its expression levels closely correlate with clinical progression and poor prognosis among various tumor types, including hepatocellular carcinoma (Liu et al. 2011), colorectal cancer (Hao et al. 2010), and pancreatic ductal adenocarcinoma (Liang et al. 2008). However, here we demonstrated that SOX2 siRNA induced a high level of MAP4K4 and suppressed the phosphorylation of JNK. Our results thus suggest that MAP4K4 is an up-stream mediator that regulates the activity of JNK in SOX2 siRNA-induced invasion and migration as well as apoptosis of laryngeal cancer cells. Therefore, we conclude that SOX2 plays an important role in controlling LSCC progression through MAP4K4/JNK signaling pathway.
Overall, in the present study, we demonstrate that silencing SOX2 by siRNA significantly inhibits the proliferation, migration and invasion of laryngeal squamous cell carcinoma TU212 cells and promotes their apoptosis. We show that silencing MAP4K4 in the presence of SOX2 siRNA reverses the effect in TU212 cells. We thus consider that SOX2, as a key regulator through upstream MAP4K4/JNK signaling pathways, could be a potential therapeutic target in the treatment of patients with laryngeal cancer or as a useful tool in its prevention.
Footnotes
Competing Interests
The authors declared no potential competing interests with respect to the research, authorship, and/or publication of this article.
Author Contributions
XL performed the cell culture, cell transfections and colony forming assays. YW carried out the RNA interference, RT-PCR, western blotting and flow cytometry. LH performed the wound healing, MTT and Hoechst staining assays. XJ conducted the data analysis. NY and YW designed the study and drafted the manuscript. All authors have read and approved the final manuscript.
Funding
The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by a grant from the Natural Science Foundation of Liaoning Province (No.: 201202287).
