Sage Journals: Discover world-class research

Abstract

Study Design

A prospective study.

Objectives

This study aims to explore the correlation between interleukin (IL)- 6 levels in intervertebral disc (IVD) tissue and clinical outcomes in patients undergoing lumbar surgery for lumbar degenerative disease (LDD).

Methods

This prospective study analyzed 32 patients (22 men and 10 women, average age 69.6 years) who underwent lateral lumbar interbody fusion (LLIF). IL-6 gene expression in IVD tissues collected during surgery was measured and correlated with pre- and postoperative clinical outcomes, including pain intensity assessed via Numeric Rating Scales (NRS) and quality of life (QOL) evaluated through the Japanese Orthopaedic Association Back Pain Evaluation Questionnaire (JOABPEQ).

Results

IL-6 levels showed statistical correlations with postoperative intensity of low back pain (LBP) and several JOABPEQ domains. Patients with higher expression of IL-6 levels experienced more severe postoperative LBP and lower scores in lumbar function, walking ability, social life function, and mental health. The effectiveness rate of JOABPEQ scores was exceptionally high for low back pain (.548), walking ability (.677), and social functioning (.563), demonstrating the effectiveness of LLIF. The average operation time was 105.6 minutes, and the estimated blood loss was 85.6 mL.

Conclusions

The study underscores IL-6 as a potential biomarker for predicting surgical outcomes in LDD. High IL-6 levels correlate with worse postoperative LBP and lower QOL scores. Integrating molecular markers like IL-6 with patient-reported outcomes could provide a more comprehensive approach to postoperative care in spinal disorders, aiming to improve the overall QOL for LDD patients undergoing LLIF surgery.

Keywords

low back pain lateral lumbar interbody fusion indirect decompression patient-reported outcome measures Japanese orthopedic association back pain evaluation questionnaire interleukin- 6

Introduction

Low back pain (LBP) is a global health concern, significantly impacting individual well-being, work performance, social roles, and healthcare costs.^1-3 The primary etiology of LBP is intervertebral disc (IVD) degeneration, which compromises spinal stability and contributes to various spinal disorders. Although spinal fusion surgery, particularly in cases of spinal degenerative diseases with instability, is a common treatment, it often results in low patient satisfaction and sometimes necessitates multiple surgeries. Recent research has increasingly acknowledged the molecular link between the degradation of the extracellular matrix in IVD cells, influenced by inflammatory cytokines, and the development of LBP.^4,5 It has been demonstrated that, compared to pain-free IVD tissue, there is an increased expression of cytokines, particularly interleukin (IL)- 6 and tumor necrosis factor (TNF)-α, in painful IVD tissue, emphasizing the potential role of cytokines in the pathophysiology of LBP.^6,7

Our prior research explored this relationship further, uncovering a significant correlation between elevated IL-6 levels in IVD tissues and increased pain severity.⁸ This discovery is pivotal for understanding the impact of preoperative cytokine levels on postoperative LBP, especially in spinal fusion surgeries. Additionally, the utility of minimally invasive spine surgeries, such as lateral lumbar interbody fusion (LLIF) for indirect decompression,^9-14 is recognized, along with the need for patient-reported outcome measures (PROMs) postoperative evaluation methods.

To assess the disability of patients with lumbar degenerative diseases (LDD), accessible and cost-effective tools that address both physical and psychometric aspects, such as questionnaires, are necessary.¹⁵ While tools like the Roland-Morris Disability Questionnaire (RMDQ)¹⁶ and the Oswestry Disability Index (ODI)¹⁷ have their applications, their limitations have paved the way for promising alternatives like the Japanese Orthopaedic Association Back Pain Evaluation Questionnaire (JOABPEQ).^18,19 JOABPEQ’s comprehensive domains cover back pain, lumbar function, walking ability, social life function, and mental health, offering a holistic understanding of patient health with high reliability.

In light of this background, our study aims to bridge the existing knowledge gap by correlating the molecular mechanisms of LBP with clinical outcomes following spine surgery. Understanding the interaction between cytokine levels in IVD tissue and patient-reported outcomes, post-surgery could revolutionize postoperative treatment approaches and optimize care for patients with LDD. Therefore, our study aims to evaluate the gene expression of IL-6 in IVD tissue collected during LLIF and its correlation with postoperative clinical outcomes using tools like JOABPEQ and pain scores.

Methods

IRB Statement

This study was conducted following the guidelines of the Helsinki Declaration²⁰ and received approval from the Ethics Committee and the Profit Reciprocity Committee of the Tokai University School of Medicine (Approval Number: 20R-263). All participants submitted written informed consent. The consent form detailed that during surgery, degenerated or herniated IVD tissue would be removed, and a part of this tissue might be requested for donation. This research investigated the correlation between IL-6 gene expression in the IVD during surgery and pain intensity, as well as JOABPEQ scores, pre- and post-LLIF surgery.

Included Patients

The research participants were all over 20 years old and had received conservative therapy-resistant treatment for at least 3 months before undergoing lumbar surgery to treat LDD. All patients were diagnosed based on a detailed medical history, neurological and radiological examinations, myelography results, and post-myelography computed tomography (CT) scans and/or magnetic resonance imaging (MRI). Before the surgery, the authors explained to the patients the use of the IVD samples collected during the surgery, and participants read and consented to the sample donation. The exclusion criteria were severe mental illness, severe disability or paralysis causing difficulty in standing or moving, a previous (within 5 years) or current cancer diagnosis, current suspected infection, or the presence of symptoms that the principal investigator suspected might be an infection. These were contraindications for inclusion in this study.

Demographic and clinical data were collected after the commencement of the study. From August 2019 to May 2021, IVD tissue was collected from patients diagnosed with lumbar degenerative disc disease with accompanying LBP, leg pain (LP), and/or leg numbness (LN) who consented to specimen collection. IVD tissue from multi-level discs was collected into a single tube for genetic testing. The study investigated the correlation between the expression of the IL-6 gene in the IVD tissues and the severity of pain and JOABPEQ scores before and 1 year after surgery.

Ultimately, we analyzed 32 patients (22 men and 10 women, average age 69.6 ± 6.8 years) who underwent indirect surgery through LLIF with percutaneous pedicle screw and were available for evaluation of pain and JOABPEQ scores 1-year post-operation. We also evaluated lumbar spine bone mineral density (BMD) and T-score using a dual-energy X-ray absorptiometry (DXA) scan (Horizon W ® DXA system, Hologic, Inc). Our criteria for fusion surgery were a sagittal plane translation exceeding 3 mm, a segmental angle formation angle exceeding 10° in dynamic X-ray evaluation, or a posterior expansion of the intervertebral disc space exceeding 5° in flexion X-ray images.

Surgical Technique

We executed the basic procedure for indirect decompression through LLIF and posterior fixation based on the surgical technique described by Ozgur et al.,¹⁴ as outlined in our previous papers.^21-26 The approach for LLIF surgery was performed using either extreme lateral interbody fusion (XLIF) (NuVasive, San Diego, California) or oblique lateral interbody fusion (OLIF) (Medtronic, Minneapolis, Minnesota). There was no specific criterion for choosing between XLIF and OLIF, and the choice of approach was left to the surgeon’s discretion. For all patients, we implemented LLIF using a single-incision mini-open direct visualization approach. Briefly, this involved placing the patient in a lateral position and making a skin incision towards the target intervertebral disc. We then approached the disc, conducted a discectomy, and performed a cage trial and insertion. In all LLIF segments, we added percutaneous pedicle screw fixation, utilizing either intraoperative fluoroscopy or an intraoperative CT navigation system.

Lumbar MRI

All patients received a standard lumbar MRI scan prior to surgery. The MRI, covering the lumbar region from L1–L2 to L5–S1, was conducted using T2-weighted sequences, employing either a 1.5- or 3.0-Tesla imaging system (Ingenia or Achieva models, Philips Medical Systems, located in Best, The Netherlands). The severity of IVD degeneration was assessed using the midsagittal T2-weighted images, adhering to the criteria of the Pfirrmann classification system and its modified version.²⁷ Moreover, the modified Pfirrmann grading, a method based on MRI characteristics, is widely recognized for its noninvasive approach to determining the extent of IVD degeneration.²⁸

We also performed MRI to determine the midsagittal canal diameter (CD) and axial central canal area (CCA) of the thecal sac before and within 2 weeks after surgery.

RNA Isolation and Quantitative Reverse Transcription-Polymerase Chain Reaction

Total cellular RNA from the IVD tissues was extracted using the Trizol technique. The tissues were initially preserved in RNALater (Ambion, Foster City, CA) and kept at −80°C until needed. The RNALater was discarded for RNA extraction, and the tissues were immediately frozen in liquid nitrogen before being immersed in Trizol (Invitrogen, Carlsbad, CA). Solid tissues were then homogenized using an Omni Tissue Homogenizer (Omni International, Kennesaw, GA). The RNA was precipitated using 70% ethanol and further purified with the RNeasy Mini Kit (Qiagen, Valencia, CA), following the provided instructions. The reverse transcription of RNA into cDNA was conducted using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA), with a reaction mixture containing 100 ng of total RNA and a volume of 20 μL. The resultant cDNA was diluted 10 times using nuclease-free water. Quantitative PCR (qPCR) was then performed to measure the expression levels of specific genes, utilizing a SYBR Green Real-Time PCR kit (Thermo Fisher Scientific) on the LightCycler® 480 System (Roche Applied Science, Mannheim). The qPCR reactions were done in triplicates in a 96-well plate, with each well containing 10 μL using ABI 2x SYBR Green Master Mix. The PCR conditions were an initial 20 s denaturation at 95°C, followed by 40 cycles of 3 s at 95°C and 30 s at 60°C. GAPDH was used as the normalization control. The cycle threshold (Ct) values were calculated by subtracting the Ct value of GAPDH from that of the target gene. Primers for IL-6 and GAPDH were obtained from Sangon Biotech (Shanghai, China). Primer sequences that were employed for IL-6 were 5′- GATGAGTACAAAAGTCCTGATCCA -3′ for forward sequence and 5′- CTGCAGCCACTGGTTCTGT -3′ for reverse sequence. The sequences for GAPDH were 5′- TGGGTGTGAACCATGAGAAGTA -3′ for forward primer sequence and 5′- GAGTCCTTCCACGATACCAAAG -3′ for reverse primer sequence.

Pain Intensity

Three Numeric Rating Scales (NRS) scores were used to assess pain severity: LBP, LP, and LN, respectively. For assessing LBP, LP, and LN,²² NRS evaluations were conducted, ranging from 0, indicating no pain, to 10, representing the most severe pain conceivable. These assessments were carried out both prior to and 1 year following surgery. The symbol Δ was used to denote the difference in pain levels, comparing postoperative measurements with those taken preoperatively.

JOABPEQ

The JOABPEQ is a patient-centered tool for assessing the quality of life (QOL) in individuals with lower back disorders. It generates 5 functional scores (about low back pain, lumbar function, walking ability, social life, and mental health) based on responses to 25 questions. These scores can be calculated either through the formulas provided or by inputting the data into an Excel file available on the Japanese Orthopaedic Association’s website (https://www.jssr.gr.jp/jssr_web/html/index.html). We conducted assessments using the JOABPEQ both before surgery and 1 year after. The evaluation of its effectiveness was based on 2 parameters: the effectiveness rate and the gained score. The effectiveness rate was determined either by an increase of 20 or more points in a patient’s score from pre-surgery to post-surgery or by achieving a post-treatment score of 90 or above. In addition, cases with a score of 100 points preoperatively and a score of 100 points postoperatively were deleted. The effectiveness rate was computed as the proportion of patients who met these criteria out of the total number examined. The gained score was determined by comparing pre-and post-surgical scores among the patients.

Statistical Analysis

We performed all statistical analyses using IBM SPSS Statistics (version 23.0, IBM Corp., Armonk, NY), and reported all values as mean ± standard deviation. To verify the normal distribution of our data, we adopted the Shapiro-Wilk test. Specifically, we used Student's t-test to analyze normally distributed data, while applying the Mann-Whitney U test to non-normally distributed data. Additionally, to identify significant correlations, we utilized either Pearson’s or Spearman’s product-moment correlation analysis. We set a threshold of 5% for type 1 error in all statistical tests, considering P values less than .05 as indicative of statistical significance.

Results

Table 1 in our study presents data from 32 patients with an average age of 69.6 ± 6.8 years, predominantly male (69%). Their average body mass index (BMI) was 25.9 ± 4.5 kg/m². The BMD and T-score values were 1.006 ± .198 g/cm² and .2 ± 1.7, respectively. The primary treatment indications included lumbar canal stenosis with lumbar degenerative spondylolisthesis (94%, n = 30) and lumbar disc herniation (6%, n = 2). MRI evaluations revealed an average Pfirrmann score of 4.2 and a modified score of 5.9, indicating moderate to severe disc degeneration. Treatment involved lumbar levels L2-L3 (5%, n = 2), L3-L4 (35%, n = 15), and L4-L5 (60%, n = 26), totaling 43 levels. The most common surgical intervention was single-level fusion (69%). The average surgery duration was 105.6 ± 42.4 minutes, with an estimated blood loss of 85.6 ± 128.8 mL. The mean postoperative hospital stay was approximately 16 days. Noteworthy postoperative complications included endplate injury (9%), delayed (28%) and immediate (38%) cage subsidence, transient motor weakness (16%), thigh pain/numbness (22%), and revision surgery (9%). The effects of indirect decompression were assessed using MRI, which showed significant increases in the average midsagittal canal diameter and axial central canal area pre- and post-surgery (CD; from 5.2 ± 2.3 mm to 7.9 ± 2.2 mm, CCA; from 46.9 ± 24.9 mm² to 70.1 ± 26.8 mm², P < .001) (data not shown).

Table 1.

Characteristics of the Subjects in the Present Study.

Characteristic		Data
No. of patients		32
Age (years), mean (SD)		69.6 (6.8)
Sex (male/female), n		22/10
Height (cm), mean (SD)		160.7 (7.7)
Body weight (kg), mean (SD)		67.0 (12.3)
BMI (kg/m²), mean (SD)		25.9 (4.5)
Tobacco use, n (%)		6 (19)
Steroid use, n (%)		1 (3)
Lumbar	BMD (g/cm²)	1.006 (.198)
Lumbar	T-score	.2 (1.7)
Indications, n (%)	LCS+ (LDS)	30 (94)
Indications, n (%)	LDH	2 (6)
MRI grading (P)		4.2 (.4)
MRI grading (M-P)		5.9 (1.6)
Levels treated, n (%)	L2-L3	2 (5)
	L3-L4	15 (35)
	L4-L5	26 (60)
	Overall	43
Number of fused segments, n (%)	1 level	22 (69)
	2 level	9 (28)
	3 level	1 (3)
	Mean	1.3 (.5)
OR time (min), mean (SD)		105.6 (42.4)
EBL (mL), mean (SD)		85.6 (128.8)
Length of stay (days), mean (range, SD)		15.8 (4.6)
Endplate injury, n (%)		3 (9)
Delayed cage subsidence, n (%)		9 (28)
Cage subsidence, n (%)		12 (38)
Transient motor weakness, n (%)		5 (16)
Thigh pain and/or numbness, n (%)		7 (22)
Revision surgery, n (%)		3 (9)

Data presented as mean (SD) or number of patients (%).

BMI, Body mass index; BMD, Bone mineral density; OR, Operation; EBL, Estimated blood loss; LCS, Lumbar canal stenosis; LDS, Lumbar degenerative spondylolisthesis; DLS, Degenerative lumbar scoliosis; FS, Foraminal stenosis; LDH, Lumbar disc herniation. MRI Grading (P); Pfirrmann classification. MRI Grading (M-P); Modified Pfirrmann classification.

Table 2 presents the IL-6 levels, showing an average Ct of 32.6 ± 1.5. The threshold cycle difference (ΔCt) between IL-6 and the reference gene GAPDH is 9.8 ± 3.2. GAPDH, with an average Ct of 22.9 ± 3.2, serves as the baseline control and has a ΔCt of 0. A higher ΔCt value for IL-6 suggests lower gene expression of IL-6, whereas a lower ΔCt indicates higher IL-6 gene expression.

Table 2.

Gene Expression of Chemokine and Inflammatory Cytokine in IVD Tissues by RT-PCR.

IVD Tissues	Target Gene Avg C_t	ΔC_t Target-Normalizer
IL-6	32.6 (1.5)	9.8 (3.2)
GAPDH	22.9 (3.2)	0

Data are expressed as mean ± standard deviation (SD). SD; Standard deviation, IVD; intervertebral disc. ΔCt, The difference in threshold cycles for the target gene (Ct^target– Ct^GAPDH).

Table 3 presents the NRS results, demonstrating notable postoperative improvements in low back pain (NRS_LBP), leg pain (NRS_LP), and leg numbness (NRS_LN), with average score reductions of 3.8, 4.9, and 4.3 points, respectively, highlighting the treatment’s efficacy.

Table 3.

Pain Intensity for Each Group.

	Preope	Postope	Change (Δ)	P ^†
NRS_LBP	7.0 (2.3)	3.2 (3.0)	−3.8 (2.9)	<.001*
NRS_LP	7.1 (2.3)	2.3 (2.5)	−4.9 (2.7)	<.001*
NRS_LN	6.8 (2.3)	2.6 (2.9)	−4.3 (3.4)	<.001*

NRS_LBP, Numeric Rating Scale for low back pain; NRS_LP, Numeric Rating Scale for leg pain; NRS_LN, Numeric Rating Scale for leg numbness.

^†Comparison with pre op, *Statistically significant.

Table 4 shows the JOABPEQ scores, revealing substantial postoperative enhancements in low back pain, lumbar function, walking ability, social life function, and mental health. Notably, more than half of the patients reported improvements in low back pain and social life function, with walking ability exhibiting the most significant improvement rate at 67.7%.

Table 4.

Two-Group Comparison Pre and Postoperative JOABPEQ.

(A)
	Preope	Postope	Change (Δ)	P ^‡
Low back pain	43 (37.7 ± 30.7)	71 (61.7 ± 31.6)	28 (24.0 ± 43.0)	.004*
Lumbar function	58 (55.7 ± 25.2)	67 (63.5 ± 25.9)	0 (7.8 ± 21.0)	.043*
Walking ability	14 (18.0 ± 19.0)	57 (56.3 ± 33.1)	36 (38.3 ± 33.1)	<.001*
Social life function	27 (29.3 ± 21.3)	65 (55.1 ± 27.3)	24.5 (25.8 ± 25.1)	<.001*
Mental health	42 (40.1 ± 20.1)	54 (53.0 ± 20.4)	13.5 (12.9 ± 19.4)	.001*

(B)
JOABPEQ Domain
Low back pain	17/31 (.548)
Lumbar function	8/32 (.250)
Walking ability	21/31 (.677)
Social life function	18/32 (.563)
Mental health	10/32 (.313)

(A) Two-group comparison of gained score (Post-Pre score).

Score = median (mean ± S.D.).

(B) Two-group comparison of effective rate.

Number of improved patients/Number of patients (effective rate).

^‡Comparison between groups * Statistically significant.

Our study explored the correlation between IL-6 levels and diverse patient background characteristics. Table 5 encapsulates these correlations, using Pearson’s correlation coefficient (r) and associated P-values to assess statistical significance. Analyzed patient characteristics encompassed age, sex, height, body weight, BMI, Pfirrmann score, and modified Pfirrmann score. The correlations between IL-6 levels and these demographic and clinical characteristics were generally weak, failing to reach statistical significance.

Table 5.

Correlation Analysis Between IL6 and Patient Background.

		Age	Sex	Height	Body Weight	BMI	MRI Grading (P)	MRI Grading (M-P)
IL6	r	.233	.068	−.081	−.068	−.156	−.282	.046
IL6	P	.223	.726	.677	.725	.420	.138	.818

*Statistically significant.

MRI Grading (P); Pfirrmann classification. MRI Grading (M-P); Modified Pfirrmann classification.

Table 6 provides a detailed correlation analysis exploring the relationship between IL-6 levels and pain scores. Preoperatively, a significant negative correlation was observed between IL-6 levels and low back pain scores (suggesting IL-6 as a potential biomarker for pain severity). Postoperatively, this correlation persisted strongly (r = −.649, P < .001), implying that higher IL-6 levels may correlate with greater pain severity or lesser improvement post-surgery. A significant negative correlation was also evident between IL-6 levels and changes in NRS_LBP scores (r = −.439, P = .017), suggesting reduced improvement in low back pain post-surgery in patients with elevated IL-6 levels. However, no significant correlation emerged with changes in NRS_LP and NRS_LN scores. Figure 1 illustrates this with a scatter plot of IL-6 expression relative to pain before and after surgery.

Table 6.

Correlation Analysis Between Each Domain of NRS Score (A) or JOABPEQ (B) and Patient Satisfaction. * Statistically Significant.

		Pre NRS_LBP	Pre NRS_LP	Pre NRS_LN	Post NRS_LBP	Post NRS_LP	Post NRS_LN	ΔNRS_LBP	ΔNRS_LP	ΔNRS_LN
IL6	r	−.247	−.231	−.126	−.649*	−.353	−.355	−.439*	−.156	−.247
IL6	P	.197	.228	.516	<.001	.061	.059	.017	.420	.196

Figure 1.

Scatter plots illustrating the correlation between each domain of pain and IL-6 levels before and after surgery. LBP (Low Back Pain), LP (Leg Pain), LN (Leg Numbness).

Table 7 showed the preoperative correlations between IL-6 levels and specific JOABPEQ domains, namely lumbar function (r = .378, P = .043) and mental health (r = .420, P = .023). These findings suggest a potential association between elevated IL-6 levels and diminished lumbar functionality and mental health. Moreover, postoperatively, significant correlations emerged across all JOABPEQ domains. However, the post-surgical change in these correlations (Δ) did not exhibit significant correlations with IL-6 levels. Figure 2 provides a scatter plot illustrating IL-6 expression in relation to each JOABPEQ domain.

Table 7.

Correlation Analysis Between IL6 and JOABPEQ Domains.

(A)		Pre low back pain	Pre lumbar function	Pre walking ability	Pre social life function	Pre mental health
IL6	r	.221	.378*	.303	.309	.420*
IL6	P	.258	.043	.118	.103	.023
(B)		Post low back pain	Post lumbar function	Post walking ability	Post social life function	Post mental health
IL6	r	.389*	.467*	.517*	.432*	.444*
IL6	P	.041	.011	.005	.019	.016
(C)		Δ low back pain	Δ lumbar function	Δ walking ability	Δ social life function	Δ mental health
IL6	r	.115	.044	.293	.253	−.054
IL6	P	.561	.820	.130	.186	.780

(A); Before surgery, (B); After surgery, (C); Change amount (Δ).

*Statistically significant.

Figure 2.

Scatter plots depicting the relationship between each domain of the Japanese Orthopedic Association Back Pain Evaluation Questionnaire (JOABPEQ) and IL-6 levels pre- and post-surgery. Domains include: LBP (Low Back Pain), LF (Lumbar Function), WA (Walking Ability), SLF (Social Life Function), MH (Mental Health).

Case Example

A 70-year-old man presented with L4 LDS accompanied by LBP and radicular pain, with scores of 8.5 on the NRS_LBP, 8.5 on the NRS_LP, and 9 on the NRS_LN. He underwent an L4/5 surgical procedure (as shown in Figure 3). The patient experienced a smooth post-surgical recovery without any complications. MRI scans post-surgery revealed successful correction of the slippage and achievement of indirect decompression. There was an improvement in all preoperative pain symptoms. The JOABPEQ scores showed significant improvements across various domains: low back pain improved from 14 to 100, lumbar function from 58 to 83, walking ability from 21 to 64, social life function from 24 to 51, and mental health from 34 to 48. The ΔCt value of IL-6 was 15.67. CT scans conducted 1 year post-surgery confirmed successful bone fusion (as depicted in Figure 4).

Figure 3.

Pre- and postoperative lateral radiograph and sagittal and axial MRIs revealing indirect decompression of the central canal at L4/5.

Figure 4.

Preoperative and postoperative coronal and sagittal 3D CT scans were performed. A postoperative bony bridge was successfully achieved. 3D CT (Three-dimensional Computed Tomography).

Discussion

This study delved into the correlation between IL-6 levels in IVD tissue and the clinical outcomes of patients undergoing surgery for LDD. Our research suggests that molecular markers, particularly the pro-inflammatory cytokine IL-6, indicate surgical outcomes, impacting patient-reported pain levels and functional outcomes.

IL-6 plays a vital role in LDD pathophysiology. We found a correlation between preoperative IL-6 levels and postoperative outcomes, notably in LBP and lumbar function. This indicates IL-6’s potential as a biomarker for predicting surgical outcomes and guiding postoperative management. Notably, elevated IL-6 levels in IVD tissue during surgery could foresee more intense LBP a year post-surgery.

The utility of the JOABPEQ in the evaluation of PROMs is well-recognized.^29,30 Our findings show significant correlations between IL-6 levels and various JOABPEQ domains postoperatively, linking molecular changes in the spine to patients’ QOL. This dual approach, combining molecular markers with patient-reported measurements, advances our understanding of surgical outcomes.

Furthermore, consistent with previous reports, the indirect decompression achieved through LLIF enhances patients’ QOL. The improvement in JOABPEQ scores following LLIF underscores the potential of this surgical technique in managing patients with LDD.^10,31 However, further research is necessary to fully understand the relationship between IL-6 levels and this surgical outcome.

Moreover, an interesting aspect of our study is the lack of significant correlation between IL-6 levels and changes in JOABPEQ scores (ΔJOABPEQ). Despite the significant correlations with several postoperative JOABPEQ domains, the relationship between IL-6 levels and the changes in these scores post-surgery was not statistically significant. This could be due to the smaller sample size when calculating ΔJOABPEQ, which requires pre- and post-surgery scores for each patient. Additionally, the 1-year timeframe for evaluating JOABPEQ scores may allow for numerous physiological and psychosocial changes, potentially diminishing or complicating IL-6’s influence.

Although IL-6 is a key biomarker in understanding inflammation in lumbar surgeries and subsequent LBP development, it is 1 of many biomarkers available.^32,33 We recognize the importance of longitudinal evaluations post-surgery to gain a deeper understanding of the dynamics of inflammatory responses and their correlation with patient recovery and pain management. Longitudinal studies involving blood and potentially IVD tissue samples would allow us to track changes in IL-6 levels and other inflammatory markers over time. This could provide valuable insights into the effectiveness of surgical interventions and the progression of postoperative recovery.

Finally, recognizing the limitations of this study is crucial. Firstly, our cohort’s small size may limit our results’ reliability. Furthermore, expanding our analysis to include a broader range of inflammatory markers, not just IL-6, could provide more comprehensive insights into ongoing inflammatory processes. Additionally, while our study investigated the correlation between IL-6 expression in IVD tissue during surgery and changes in LBP intensity and postoperative JOABPEQ scores 1 year after surgery, it did not explore correlations with longer-term postoperative outcomes. Understanding these relationships could enhance our knowledge of how preoperative molecular profiles impact long-term patient outcomes. Moreover, the issue of adjacent segment disease following fusion surgery and the potential investigation of the impact of inflammatory cytokines within the disc in such scenarios could also be valuable. Another limitation is the absence of an assessment of systemic inflammation through blood markers, which are vitally important in understanding the extensive inflammatory response associated with spinal disorders and their treatment. Future research should aim to measure systemic inflammatory markers like IL-6 in the blood both preoperatively and postoperatively, to compare systemic and local inflammation levels and their correlation with clinical pain outcomes.

To address these limitations, future studies should include a larger patient population and investigate the roles of various cytokines and molecular markers. This approach could enable a closer understanding of the complex interplay between molecular changes, surgical techniques, and patient-reported outcomes, ultimately contributing to more personalized and effective treatments for patients with LDD.

Conclusions

In conclusion, this study demonstrated the significance of preoperative IL-6 levels within the IVD in predicting and understanding the clinical outcomes of surgical interventions in patients with lumbar LDD. IL-6 within the IVD is a key component in the network of inflammatory mediators involved in the pathology of LDD and the postoperative recovery process, representing a critical factor influencing patient outcomes. Therefore, IL-6 levels within the IVD may serve as a valuable biomarker for enhancing patient care in the management of LDD patients following surgery.

Footnotes

Authors’ Note

This study, including any part of it, does not have any prior or duplicate submissions or publications elsewhere.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Akihiko Hiyama

References

Deyo

Mirza

Martin

. Back pain prevalence and visit rates: estimates from U.S. national surveys, 2002. Spine. 2006;31:2724-2727. doi:10.1097/01.brs.0000244618.06877.cd.

Dionne

Dunn

Croft

. Does back pain prevalence really decrease with increasing age? A systematic review. Age Ageing. 2006;35:229-234. doi:10.1093/ageing/afj055.

Hartvigsen

Hancock

Kongsted

, et al. What low back pain is and why we need to pay attention. Lancet. 2018;391:2356-2367. doi:10.1016/s0140-6736(18)30480-x.

Bermudez-Lekerika

Crump

Tseranidou

, et al. Immuno-modulatory effects of intervertebral disc cells. Front Cell Dev Biol. 2022;10:924692. doi:10.3389/fcell.2022.924692.

Khan

Jacobsen

Khan

, et al. Inflammatory biomarkers of low back pain and disc degeneration: a review. Ann N Y Acad Sci. 2017;1410:68-84. doi:10.1111/nyas.13551.

Uçeyler

Rogausch

Toyka

, et al. Differential expression of cytokines in painful and painless neuropathies. Neurology. 2007;69:42-49. doi:10.1212/01.wnl.0000265062.92340.a5.

Wang

Bao

Yang

, et al. A cohort study comparing the serum levels of pro- or anti-inflammatory cytokines in patients with lumbar radicular pain and healthy subjects. Eur Spine J. 2016;25:1428-1434. doi:10.1007/s00586-015-4349-4.

Hiyama

Suyama

Sakai

, et al. Correlational analysis of chemokine and inflammatory cytokine expression in the intervertebral disc and blood in patients with lumbar disc disease. J Orthop Res. 2022;40:1213-1222. doi:10.1002/jor.25136.

Hiyama

Katoh

Sakai

, et al. Radiographic and clinical evaluation of single-level lateral interbody fusion in patients with severe stenosis analyzed using cluster analysis. Medicine (Baltim). 2021;100:e27775. doi:10.1097/md.0000000000027775.

10.

Hiyama

Sakai

Katoh

, et al. Comprehensive assessment of indirect decompression through lateral lumbar interbody fusion for degenerative lumbar spinal stenosis: a Japanese orthopedic association back pain evaluation questionnaire-based analysis. Global Spine J 2023;Online ahead of print:21925682231204254. doi:10.1177/21925682231204254.

11.

Isaacs

Sembrano

Tohmeh

. Two-year comparative outcomes of MIS lateral and MIS transforaminal interbody fusion in the treatment of degenerative spondylolisthesis: Part II: radiographic findings. Spine. 2016;41(Suppl 8):S133-144. doi:10.1097/brs.0000000000001472.

12.

Mayer

. A new microsurgical technique for minimally invasive anterior lumbar interbody fusion. Spine. 1997;22:691-699. doi:10.1097/00007632-199703150-00023.

13.

Oliveira

Marchi

Coutinho

, et al. A radiographic assessment of the ability of the extreme lateral interbody fusion procedure to indirectly decompress the neural elements. Spine. 2010;35:S331-337. doi:10.1097/BRS.0b013e3182022db0.

14.

Ozgur

Aryan

Pimenta

, et al. Extreme Lateral Interbody Fusion (XLIF): a novel surgical technique for anterior lumbar interbody fusion. Spine J. 2006;6:435-443. doi:10.1016/j.spinee.2005.08.012.

15.

Prinsen

CAC

Mokkink

Bouter

, et al. COSMIN guideline for systematic reviews of patient-reported outcome measures. Qual Life Res. 2018;27:1147-1157. doi:10.1007/s11136-018-1798-3.

16.

Roland

Morris

. A study of the natural history of back pain. Part I: development of a reliable and sensitive measure of disability in low-back pain. Spine. 1983;8:141-144. doi:10.1097/00007632-198303000-00004.

17.

Fairbank

Couper

Davies

, et al. The Oswestry low back pain disability questionnaire. Physiotherapy. 1980;66:271-273.

18.

Fukui

Chiba

Kawakami

, et al. Japanese orthopaedic association back pain evaluation questionnaire. Part 3. Validity study and establishment of the measurement scale : subcommittee on low back pain and cervical myelopathy evaluation of the clinical outcome committee of the Japanese orthopaedic association, Japan. J Orthop Sci. 2008;13:173-179. doi:10.1007/s00776-008-1213-y.

19.

Fukui

Chiba

Kawakami

, et al. Japanese orthopaedic association back pain evaluation questionnaire. Part 2. Verification of its reliability : the subcommittee on low back pain and cervical myelopathy evaluation of the clinical outcome committee of the Japanese orthopaedic association. J Orthop Sci. 2007;12:526-532. doi:10.1007/s00776-007-1168-4.

20.

World Medical Association . World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. JAMA. 2013;310:2191-2194. doi:10.1001/jama.2013.281053.

21.

Hiyama

Katoh

Nomura

, et al. Intraoperative computed tomography-guided navigation versus fluoroscopy for single-position surgery after lateral lumbar interbody fusion. J Clin Neurosci. 2021;93:75-81. doi:10.1016/j.jocn.2021.08.023.

22.

Hiyama

Katoh

Nomura

, et al. The effect of preoperative neuropathic pain and nociceptive pain on postoperative pain intensity in patients with the lumbar degenerative disease following lateral lumbar interbody fusion. World Neurosurg. 2022;164:e814-e823. doi:10.1016/j.wneu.2022.05.050.

23.

Hiyama

Katoh

Sakai

, et al. Comparison of radiological changes after single- position versus dual- position for lateral interbody fusion and pedicle screw fixation. BMC Muscoskel Disord. 2019;20:601. doi:10.1186/s12891-019-2992-3.

24.

Hiyama

Katoh

Sakai

, et al. Minimally invasive approach for degenerative spondylolisthesis: lateral single-position surgery with intraoperative computed tomography navigation and fluoroscopy: a technical Note. World Neurosurg. 2023;179:e500-e509. doi:10.1016/j.wneu.2023.08.131.

25.

Hiyama

Katoh

Sakai

, et al. A new technique that combines navigation-assisted lateral interbody fusion and percutaneous placement of pedicle screws in the lateral decubitus position with the surgeon using wearable smart glasses: a small case series and technical Note. World Neurosurg. 2021;146:232-239. doi:10.1016/j.wneu.2020.11.089.

26.

Hiyama

Nomura

Sakai

, et al. Utility of power tool and intraoperative neuromonitoring for percutaneous pedicle screw placement in single position surgery: a technical Note. World Neurosurg. 2022;157:56-63. doi:10.1016/j.wneu.2021.09.113.

27.

Pfirrmann

Metzdorf

Zanetti

, et al. Magnetic resonance classification of lumbar intervertebral disc degeneration. Spine. 2001;26:1873-1878. doi:10.1097/00007632-200109010-00011.

28.

Griffith

Wang

Antonio

, et al. Modified Pfirrmann grading system for lumbar intervertebral disc degeneration. Spine. 2007;32:E708-712. doi:10.1097/BRS.0b013e31815a59a0.

29.

Akeda

Yamada

Takegami

, et al. Evaluation of central sensitization inventory in patients undergoing elective spine surgery in a multicenter study. Global Spine J. 2023;13:1716-1727. doi:10.1177/21925682211047473.

30.

Taniwaki

Hoshino

Kinoshita

, et al. Lower preoperative Hounsfield unit values as a risk factor for poor 5-year clinical outcomes after lumbar spine surgery. Eur Spine J. 2023;33:11-18. doi:10.1007/s00586-023-07995-9.

31.

Nakashima

Kanemura

Satake

, et al. Patient-reported quality of life following posterior lumbar interbody fusion or indirect decompression using lateral lumbar interbody fusion. Spine. 2020;45:E1172-e1178. doi:10.1097/brs.0000000000003535.

32.

Canlı

Billens

Van Oosterwijck

, et al. Systemic cytokine level differences in patients with chronic musculoskeletal spinal pain compared to healthy controls and its association with pain severity: a systematic review. Pain Med. 2022;23:1947-1964. doi:10.1093/pm/pnac091.

33.

Pinto

Neves

Laranjeira

, et al. The importance of inflammatory biomarkers in non-specific acute and chronic low back pain: a systematic review. Eur Spine J. 2023;32:3230-3244. doi:10.1007/s00586-023-07717-1.

Evaluating the Efficacy of IL-6 as Predictors of Lateral Lumbar Interbody Fusion Success: Insights From Pain Scores and JOABPEQ Assessments

Abstract

Study Design

Objectives

Methods

Results

Conclusions

Keywords

Introduction

Methods

IRB Statement

Included Patients

Surgical Technique

Lumbar MRI

RNA Isolation and Quantitative Reverse Transcription-Polymerase Chain Reaction

Pain Intensity

JOABPEQ

Statistical Analysis

Results

Case Example

Discussion

Conclusions

Footnotes

Authors’ Note

Declaration of Conflicting Interests

Funding

ORCID iD

References