Sage Journals: Discover world-class research

Abstract

Objective

Cartilage tissue engineering has evolved as one of the therapeutic strategies for cartilage defect, which relies on a large number of viable chondrocytes. Because of limited availability of cartilage and low chondrocytes yield from cartilage, the need for an improve isolation protocol for maximum yield of viable cells is a key to achieving successful clinical constructs. This study optimizes and compares different protocols for isolation of chondrocytes from cartilage.

Design

We employed enzymatic digestion of cartilage using collagenase II and trypsin. The chondrocytes yield, growth kinetics, aggrecan, and collagen type 2 (COL2) expression were evaluated. Collagen type 1 (COL1) mRNA expression was assessed to monitor the possibility of chondrocytes dedifferentiation.

Results

Chondrocyte yield per gram of cartilage was significantly higher (P < 0.05) using collagenase II in Hank’s balanced salt solution (HBSS) compared with 0.25% trypsin. The number of chondrocyte yield per gram was higher in cartilage digested with collagenase in HBSS compared with Dulbecco’s modified Eagle medium/F12; however, the difference was not statistically significant. Chondrocytes seeded at lower densities had shorter population doubling time compared to those seeded at higher density. Protein and gene expression of chondrocyte phenotype indicates the expression of aggrecan and COL2. The expression of COL1 was significantly increased (P < 0.05) in passage 3 compared with primary chondrocytes. The mRNA expression of chondrocyte phenotype was similar in primary and passaged one cells.

Conclusions

Collagenase in HBSS yield the highest number of viable chondrocytes and the isolated cells expressed chondrocyte phenotype. This protocol can be employed to generate large number of viable chondrocytes, particularly with limited cartilage biopsies.

Keywords

chondrocyte collagenase II human cartilage isolation protocol trypsin

Introduction

Articular cartilage defect is a major cause of morbidity and socioeconomic burden in the ageing population.¹ One major therapeutic strategy for articular cartilage repair is matrix-assisted autologous chondrocyte implantation (MACI), an improved form of the first generation, autologous chondrocyte implantation (ACI), which has shown promising results.² The technique involves isolation, culture expansion, and implantation of autologous chondrocytes on membrane or scaffold.¹ ACI was first used for the treatment of cartilage defects in humans in 1987 and was first reported by Brittberg et al.³ in 1994. A key step in ACI/MACI is cell isolation, which is usually obtained through the mechanical or enzymatic breakdown of tissue biopsies and subsequent expansion in culture medium in a sterile condition. The use of collagenase for chondrocyte isolation from cartilage has been previously reported.^3-5

Cartilage is somewhat acellular tissue with only 5% to 10% of its volume comprising chondrocytes.⁶ The need for large populations of viable chondrocytes has been a major challenge for tissue engineering using primary cells for the repair of cartilage defects. The cell yield from cartilage digest is typically low (less than 20% of the total available cells) and the procedure outcome varies due to disparities between donors and user competency.⁷ Despite this limitation, a high cell density is critical for the maintenance of chondrocyte phenotype and matrix synthesis⁸ and remains a major challenge in cartilage repair. In order to improve on the cell yield required for cartilage repair, in vitro cell expansion has been employed. This process may be futile because chondrocytes expansion in a monolayer or passaged chondrocytes can undergo dedifferentiation, thereby exhibiting a more fibroblastic phenotype characterized by increased expression of collagen type 1 relative to collagen type 2.^9,10 As such, this may negatively affect the capacity of chondrocytes for effective cartilage regeneration^9,11 and poses a considerable limitation in existing regenerative therapeutic approaches using expanded populations of chondrocytes.

A report indicated that total knee replacement surgeries contributed large amounts of biological waste to operating rooms waste production.¹² Cartilage biopsies that are removed during total knee arthroplasties are biological waste that can be harness for the isolation of viable primary chondrocytes for cartilage tissue engineering. Chondrocytes represent the most frequently used cell type for cartilage tissue engineering. Subsequently, tissue engineering always consumes many cells and as such, optimized protocol for isolation of chondrocytes could form a powerful tool to boost the yield of chondrocytes for cartilage regeneration. Oseni et al.⁶ stated that the necessity to include a predigest step in multistep approaches for the isolation of chondrocytes added no advantage in increasing the number of viable chondrocytes. In manipulating the exposure of cartilage to enzymatic digestion, the concentration and incubation time are key determinants factors for isolation of viable chondrocytes. This is because prolonged exposure to harsh enzyme condition could affect the viability, proliferative and matrix forming capacities of isolated chondrocytes.¹ Furthermore, isolation of chondrocytes can be utilized for MACI to repair cartilage defect or could allow valuable models to study the preservation of cartilage-specific phenotype, molecular characteristics, and responses to cellular changes in the cartilage tissues.¹³

Therefore, this study optimizes protocol for isolation of primary chondrocytes from cartilage for possible tissue engineering or study in vitro osteoarthritis model.

Materials and Methods

Cartilage Biopsies

The protocol was approved by the Medical Research and Ethics Committee, Ministry of Health, Malaysia with reference number [KKM.NIHSEC/P17-1554 (5)]. Written informed consent was obtained from the patients. Cartilage specimens of osteoarthritic patients (n = 24, age = 40-70 years) undergoing total knee arthroplasty (TKA) in Serdang Hospital, Selangor, Malaysia were obtained from femoral condyles and tibial plateau of the knee joint under aseptic conditions and immersed in a sterile bottle containing an appropriate amount of phosphate buffered saline (PBS) with 1% penicillin-streptomycin-amphotericin B (Corning, NY, USA) and transported immediately to laboratory for further processing.

Cartilage Preparation for Digestion

Three methods were employed for the isolation of primary chondrocytes. Macroscopically healthy part of the cartilage was washed 3 times with PBS (Gibco, Waltham, MA, USA) containing 1% penicillin-streptomycin-amphotericin B (Corning). The cartilage was then minced with sterile scalpel blade into small pieces (approximately 2 × 2 mm) in a petri dish containing PBS. The minced cartilage was then digested with either trypsin or collagenase II. The latter was either dissolved in Hank’s balanced salt solution (HBSS with calcium and magnesium; Gibco) or Dulbecco’s modified Eagle medium/Nutrient Mixture F-12 (DMEM/F-12) supplemented with 5% fetal bovine serum (FBS).

Cartilage Digestion Using Trypsin-EDTA

Cartilage digestion was done as described previously¹³ with slight modification. The 1× PBS containing minced cartilage was carefully removed by a pipette and the petri dish was immediately filled with 10 mL solution of 0.25% trypsin-EDTA (ScienCell, Carlsbad, CA, USA) per gram of cartilage. The cartilage pieces were then digested for 3 hours or overnight (20 hours) at 37°C and 5% CO₂, followed by addition of 20 mL of DMEM/F-12 with glutamine (Gibco) to the cell suspension. The cell suspension was then filtered with 70-µm cell strainer (Falcon, BD, Franklin Lakes, NJ, USA) into to a 50 mL Falcon tube and centrifuged at 300g (4°C) for 10 minutes. The supernatant was carefully discarded and the cell pellet was resuspended in 20 mL of DMEM/F-12 and centrifuged at 200g for 5 minutes. The supernatant was again carefully discarded and the cell pellet was resuspended in 10 mL of DMEM/F-12 supplemented with 10% FBS (Gibco) and 1% antibiotic-antimycotic (Corning). The cell number and viability was determined by trypan blue dye exclusion test.

Cartilage Digestion Using Collagenase II in HBSS

In this protocol, collagenase II in HBSS was utilized for the dissociation of cells from primary tissue. The PBS containing minced cartilage was carefully removed with a pipette and the petri dish was immediately filled with 10 mL solution of different concentration (0.1% and 0.2%) of collagenase II (275 U/mg; Gibco) in HBSS per gram of cartilage. The cartilage pieces were then digested overnight (20 hours) at 37°C and 5% CO_2. After overnight incubation, cell suspension was dispersed through a cell strainer (70 µm; Falcon) and washed 2 times by centrifugation in PBS without collagenase. The cell pellet was then resuspended after the final wash in DMEM/F-12 supplemented with 10% FBS (Gibco) and 1% antibiotic-antimycotic (Corning). Cell viability was determined by trypan blue dye exclusion test.

Cartilage Digestion Using Collagenase II in DMEM/F-12

The isolation of primary chondrocytes was done according to the method described by Tew et al.¹⁴ with modification. Cartilage was diced in serum-free DMEM/F-12 and the media was then carefully removed by a pipette. The diced cartilage was digested in either 0.1% or 0.2% of collagenase II in DMEM/F-12 supplemented with 5% FBS (Gibco) and 1% antibiotic-antimycotic (Corning). Then, the diced cartilage was incubated overnight (20 hours) in 10 mL of collagenase II solution per gram of cartilage in an incubator at 37°C, 5% CO₂. The cell suspension was then strained through a cell strainer (70 µm) and was centrifuged at 300g for 5 minutes to obtain a cell pellet. The pellet was then washed 2 times with DMEM/F-12 containing 10% FBS. Then, the cells were gently re-suspended in culture media and counted using trypan blue exclusion test. At the end of cartilage digestion with the three protocols, the cells were plated in tissue culture flasks at a density of 1 × 10⁴ or 2 × 10⁴ cells/cm². The cells were observed regularly with the microscope and culture medium was changed every 3 days.

Chondrocyte Expansion

The morphology of the cells was examined regularly and the image was taken with a microscope. When the cells reached 80% to 90% confluence, they were trypsinized and the harvested chondrocytes (P0) were centrifuged and resuspended in culture medium. The cells were then replated at a density of 1 × 10⁴ cells/cm² in a culture flask and this was repeated until 3 passages.

Chondrocyte Growth Curve

At 80% to 90% confluence, the chondrocytes (P2) were trypsinized and seeded at different densities (5 × 10³, 10 × 10³, and 20 × 10³ cells/ cm²) in 96-well plates (Corning). One hundred microliters of cell suspension was added to each well in quadruplicates for each seeding density and incubated at 37°C, 5% CO₂ for 1, 2, 3, 4, 5, 6, and 7 days, respectively. Then, 10 µL of cell counting kit (CCK)-8 (Nacalai Tesque, Japan) was added to each well and incubated for another 3 hours. The background/control wells contain only the culture medium without the cells and the absorbance was measured at 450 nm using microplate reader (Sunrise, Tecan). The absorbance of the background was then subtracted from the absorbance of the samples. Growth rate (k) was determined from the growth curve using exponential regression as previously described.¹⁵ The exponential regression model gives a fitted curve in the form of equation as shown below:

N i = N_{0} e^{k t i}

where Ni = number of live cells at time ti, N₀ = initial number of cells, and k = growth rate.

k = \frac{\ln (2)}{PDT}

Then, the equation was used to calculate the population doubling time (PDT). Regression analysis was performed to determine the type of relationship between seeding density and PDT.

Population Doubling Time of Chondrocytes

To validate the result of CCK-8, the PDT of chondrocytes were determined using cell count. The primary chondrocytes were trypsinized and plated in 6-well plates at densities of 5 ×10³, 10 ×10³, and 20 × 10³ cells/cm² in triplicates. The cells were then incubated at 37°C, 5% CO₂. At confluence, the cells were harvested by trypsinization (0.05% trypsin-EDTA) and the cells were counted using trypan blue exclusion test. PDT was calculated as previously described.¹⁶

PDT = \frac{\log_{10} (2) x Δ t}{\log_{10} (N_{H}) - \log_{10} (N_{S})}

where N_H = number of cells harvested, N_S = number of cells seeded, and ∆t = duration of incubation.

Chondrocyte Staining for Proteoglycan

Proteoglycan synthesis by chondrocytes was evaluated with Alcian blue staining as previously described with slight modification.¹⁷ Cells were seeded at a density of 10 × 10³ cells/cm² in a 24-well plate and incubated for 5 days. After incubation, the cells were fixed in 4% paraformaldehyde for 20 minutes at room temperature and stained with 1% Alcian blue (pH 2.5; Nacalai Tesque, Japan) overnight. Then, the cells were washed 3 times with distilled water and images were captured using a Nikon inverted microscope (Nikon Eclipse TS100).

Immunofluorescence

Isolated chondrocytes (P1) were seeded at a density of 4 × 10⁴ cells/well in 24-well plates and incubated at 37°C, 5% CO₂ for 5 days. At day 5 of culture, the media was removed and cells in the monolayer were fixed in 4% paraformaldehyde for 20 minutes after washing with PBS at room temperature for protein expression using immunofluorescence. The cells were then permeabilized with PBS supplemented with 0.1% Triton X-100 and incubated at room temperature for 15 minutes, followed by washing of the cells 3 times with PBS supplemented with Tween 20 (PBST). Cells were blocked using 1% bovine serum albumin (BSA) supplemented with 0.1% Tween 20 for 30 minutes at room temperature to block the nonspecific binding of antibodies. After washing the cells three times with PBST, the cells were incubated with primary antibodies (mouse monoclonal antibodies to human collagen type 2 and aggrecan; GeneTex, Irvine, CA, USA) overnight at 4°C. After incubation, the cells were washed 3 times with cold PBST and incubated with secondary antibody (goat anti-mouse IgG (H&L)-FITC conjugated; GeneTex) for 2 hours at room temperature. The primary and secondary antibodies were diluted using a blocking solution (1% BSA in PBS and 0.1% Tween 20). The respective concentrations of the antibodies were as follows: collagen type 2 (10 µg/mL), aggrecan (5µg/mL) and goat anti-mouse IgG (H&L)-FITC (5 µg/mL). Cells incubated with secondary antibody without the primary antibody was used to assess the specificity of the antibodies. Finally, the cells were counterstained with DAPI (Nacalai Tesque, Japan) for 10 minutes and PBS was added to avoid dehydration of the cells. The images were then captured using a Zeiss fluorescence microscope (Axio Vert A10).

q-RTPCR

Collagen type 2 and aggrecan expression was performed to determine the chondrogenic phenotype of the isolated chondrocytes, whereas the expression of collagen type 1 was evaluated to monitor the possibility of chondrocytes dedifferentiation into fibroblast-like cells. At 80% confluence, primary and passaged (P1 and P3) chondrocytes were washed with PBS and trypsinized for RNA extraction. The trypsinized cells (1 × 10⁶) were centrifuged at 300g for 5 minutes at 4°C. The RNA was then extracted using FavorPrep total RNA mini kit (Favorogen Biotech, Taiwan) according to the manufacturer’s instructions. After RNA extraction, the concentration and purity of the total RNA was determined using spectrophotometer (Eppendorf BioSpectrometer kinetic).

A quantity of 100 ng of extracted RNA was used to synthesize cDNA with qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK) according to the manufacturer’s instructions. Briefly, 1 µL of 20× reverse transcriptase (RTase) and 3 to 5µL of total RNA were added to 4 µL of cDNA synthesis mix and made up to 20 µL final volumes with polymerase chain reaction (PCR) grade H₂O. The mixture was then incubated at 42°C for 30 minutes and later incubated at 85°C for 10 minutes to denature RTAse. After cDNA was synthesized from RNA, 2 µL of template DNA (cDNA) and 0.8 µL each of forward and reverse primers (Integrated DNA Technologies, Singapore) was added to 10 µL of 2× qPCRBIO SyGreen Blue mix (PCR Biosystems) and made up to 20 µL final volume with PCR grade H₂O. Data were collected and processed with sequence detection system software (BioRad CFX96 qPCR Detection System, Hercules, CA, USA) using 1 cycle at 95°C for 2 minutes to activate the polymerase, followed by 40 cycles at 95°C, 5 seconds for denaturation and 60°C, 30 seconds for annealing/extension. Primers for aggrecan (forward: TGAGGAGGGCTGGAACAAGTACC; reverse: GGAGGTGGTAATTGC AGGGAACA) and collagen type 1 (forward: CGGCTCCTGCTCCTCTTAG; reverse: CACACG TCTCGGTCATGGTA) were obtained from Naranda et al.¹³ whereas that of collagen type 2 (forward: CCCTGAGTGGAAGAGTGGAG; reverse: GAGGCGTGAGGTCTTCTGTG) and GAPDH (forward: CAGAACATCATCCCTGCCTCT; reverse: GCTTGA CAAAGTGGTCGTTGAG) were sourced from Yoon et al.¹⁸ and Chabane et al.,¹⁹ respectively.

The C_t values of the gene of interest were normalized to GAPDH. Finally, the gene expression level of passage 1 and 3 chondrocytes was normalized to primary chondrocyte and fold change was calculated using 2^−∆∆Ct. Amplification efficiency of each primers was determined using a standard curve. Figure 1 shows the experimental design.

Figure 1.

Experimental design.

Data Analysis

Data are mean ± standard deviation (SD) with n ≥ 3. Statistical Package for the Social Sciences (IBM SPSS, Armonk, NY, USA; version 20) was used for the data analysis. Data were tested for normality using Shapiro-Wilk test, whereas Levene’s test was used to test for the homogeneity of variance. Welch’s analysis of variance (ANOVA) was used to analyze the data with more than 2 variables, followed by Games-Howell post hoc test if a significant difference was observed because the data did not satisfy the ANOVA assumption of homogeneity of variance. Two variable data were analyzed using unpaired t test. A value of P < 0.05 was set as a significant level.

Results

Chondrocytes Yield after Digestion of Cartilage

Viable chondrocytes yield per wet gram of cartilage of different digestion method is presented in Table 1 . Collagenase II and trypsin were the 2 enzymes employed for digestion of the cartilage. The cell viability in different isolation methods was ≥90%. Results showed that chondrocytes yield/wet gram of cartilage digested in 0.1% and 0.2% collagenase II in HBSS were significantly higher (P < 0.05) compared with 0.25% trypsin-EDTA incubated overnight. There was no significant difference in the chondrocytes yield/ wet gram of cartilage between 0.1% or 0.2% collagenase II in HBSS and 0.2% collagenase II in DMEM/F-12 supplemented with 5% serum. Furthermore, chondrocytes yield/g of cartilage was also significantly higher (P < 0.05) using 0.1% or 0.2% collagenase II in HBSS and 0.2% collagenase II in DMEM/F-12 supplemented with 5% FBS compared with 0.25% trypsin-EDTA incubated for 3 hours. Chondrocytes yield/g of cartilage digested with 0.25% trypsin-EDTA overnight was not significantly different (P > 0.05) when compared with cartilage digested in 0.25% trypsin-EDTA for 3 hours. Overall, the results showed that chondrocytes yield/g of cartilage was better using collagenase II in HBSS, though collagenase II in DMEM/F-12 had shown a comparable cell yield. Chondrocytes yield was dose-dependent using collagenase II.

Table 1.

Viable Chondrocytes Yield of Different Digestion Methods.*

Digestion Method	Incubation Time (h)	Cell Yield/Wet Gram of Cartilage
0.25% trypsin-EDTA	3	0.68 ± 0.23 × 10^6b
0.25% trypsin-EDTA	20	1.08 ± 0.13 × 10^6b,c
0.1% Col II in DMEM/F-12 containing 5% FBS	20	1.88 ± 0.49 × 10^6a,b,c
0.1% Col II in HBSS	20	2.15 ± 0.26 × 10^6a
0.2% Col II in DMEM/F-12 containing 5% FBS	20	3.05 ± 0.83 × 10^6a,c
0.2% Col II in HBSS	20	3.53 ± 0.83 × 10^6a

Col II = collagenase II; DMEM/F-12 = Dulbecco’s modified Eagle medium/Ham’s F-12; FBS = fetal bovine serum; HBSS = Hank’s balanced salt solution; EDTA = ethylenediaminetetraacetic acid.

Values are mean ±SD, n = 4. Data with the same letter are not significantly different (P > 0.05) using Welch’s ANOVA followed by Games-Howell multiple comparison tests.

Morphology of Primary Chondrocytes

The morphology of primary chondrocytes at day 3 and 6 ( Fig. 2 ) indicated that chondrocytes isolated with 0.2% collagenase II in HBSS or DMEM/F-12 displayed a uniform morphology with good attachment to the culture flask. Most cells were examined to be identical in size with round/polygonal shape. At day 3, chondrocyte multiplication was obvious in the cells isolated with collagenase II in HBSS or DMEM/F-12 and cultivated in media supplemented with 10% serum ( Fig. 2A and C ). The cells attained 70% to 80% confluence at day 6 of expansion ( Fig. 2B and D ). However, primary chondrocytes isolated with trypsin-EDTA showed fewer number of cells and could not attain confluence at day 6 of culture expansion ( Fig. 2E and F ). The low number of chondrocytes obtained during expansion from the cartilage digested in trypsin hindered the subsequent experiment using the cells isolated by this method. As a result, we were not able to compare the chondrocytes isolated using collagenase II and trypsin beyond this stage. Therefore, the subsequent experiment was performed with chondrocytes isolated using 0.2% collagenase II in HBSS because it yielded the highest number of cells per gram of cartilage.

Figure 2.

Morphology of primary chondrocytes isolated using different digestion methods. Morphology of chondrocytes isolated using different methods at days 3 and 6. (A, B) 0.2% collagenase II in HBSS, (C, D) 0.2% collagenase II in DMEM/F-12, and (E, F) 0.25% trypsin-EDTA digested for 20 hours. The initial seeding density was 10 × 10³ cells/cm³ for the 3 methods. Magnification 100×. DMEM/F-12 = Dulbecco’s modified Eagle medium/Ham’s F-12; HBSS = Hank’s balanced salt solution; EDTA = ethylenediaminetetraacetic acid.

The morphology of different passages (P1-P3) of chondrocytes isolated with 0.2% collagenase II in HBSS was examined and depicted in Figure 3 . The cells displayed round/polygonal shape at different passages examined.

Figure 3.

Morphology of different passage of chondrocytes isolated with collagenase II in HBSS. P1, P2, and P3 are passage 1, 2, and 3 chondrocytes, respectively, cultured in DMEM/F-12 supplemented with 10% FBS at confluence displaying round/polygonal shape. The initial seeding density was 10 × 10³ cells/cm³. Magnification 100×. DMEM/F-12 = Dulbecco’s modified Eagle medium/Ham’s F-12; FBS = fetal bovine serum; HBSS = Hank’s balanced salt solution.

Alcian Blue Staining for Proteoglycan

Alcian blue staining was used to characterize the deposition of proteoglycan in the cells isolated with 0.2% collagenase II in HBSS. The results indicated a strong positive blue staining of isolated chondrocytes and cultivated in media supplemented with FBS ( Fig. 4 ). This showed that chondrocytes (P1 and P3) retained cartilage phenotype, specifically proteoglycan, which is one of the major components of the extracellular matrix.

Figure 4.

Chondrocytes stained with Alcian blue for proteoglycan. P1 and P3: passages 1 and 3 chondrocytes isolated using 0.2% collagenase II in HBSS and cultured in DMEM/F-12 supplemented with 10% FBS showing positive stain for proteoglycan. Scale bars: 100 µm. DMEM/F-12 = Dulbecco’s modified Eagle Medium/Ham’s F-12; FBS = fetal bovine serum; HBSS = Hank’s balanced salt solution.

Growth Kinetics of Chondrocytes

The growth kinetics of chondrocytes isolated with 0.2% collagenase II in HBSS was studied using different seeding densities and the growth rate of the cells was monitored for 7 days ( Fig. 5A ). The absorbance of cells was measured daily using CCK-8. Cells seeded at a high density (2 × 10⁴ cells/cm²) exhibited a logistic growth pattern. The cell growth increased slowly during the first 3 days, followed by a logarithmic phase from day 3 until day 5 and then a stationary phase. Similarly, the same growth pattern was observed for cells seeded at a density of 1 × 10⁴ cells/cm² but with lower absorbance value. The growth pattern of the cells seeded at lower density (5 × 10³ cells/cm²) showed a slow but steady continuous growth throughout the 7 days period without displaying a logistic growth pattern. The PDT for each seeding density was then determined from the growth curve. Chondrocytes seeded at a higher density showed longer PDT compared with lower densities ( Fig. 5B ). To validate the result of the absorbance method, the cell count was performed. The PDT of cell count method displayed similar PDT when compared with the absorbance method ( Fig. 5B ). The result showed that there was no significant difference (P > 0.05) in the PDT of the chondrocytes seeded at different densities. However, the PDT of chondrocytes seeded at a higher density was longer compared with the lower densities.

Figure 5.

Growth kinetics of chondrocytes seeded at different densities. Values are mean ± SD, n = 3 for cell count or n = 4 for Abs method. Growth curve (A) and population doubling time (B) of chondrocytes seeded at different densities. Data are not significantly different between the seeding densities using Welch’s ANOVA. Abs = absorbance; LSD = low seeding density (5 × 10³ cells/cm²); MSD = medium seeding density (1 × 10⁴ cells/cm²); HSD = high seeding density (2 × 10⁴ cells/cm²).

The results of growth rate for absorbance method are presented in Table 2 . The growth rate of the cells decreases with increase in seeding density, suggesting lower seeding density had the highest growth rate.

Table 2.

Growth Rate of Chondrocytes.^a

Seeding Density (cells/cm²)	Growth Rate	r ²
5 × 10³	0.232 ± 0.026	0.974 ± 0.014
1 × 10⁴	0.222 ± 0.012	0.963 ± 0.023
2 × 10⁴	0.186±0.034	0.943±0.026

Values are mean ± SD, n = 4. Growth rate was determined using exponential regression from absorbance method. r² = coefficient of determination.

Regression analysis showed a positive relationship between seeding density and PDT, suggesting lower seeding density had a shorter duration of PDT ( Table 3 ). The relationship was significant (P = 0.029) for the absorbance method, whereas the relationship was not statistically significant (P = 0.211) for the cell count method.

Table 3.

Regression Analysis Between Seeding Density and Population Doubling Time (PDT).^a

Method	r	P
Absorbance	0.627	0.029
Cell count	0.461	0.211

There was positive correlation between seeding density and PDT. r = correlation coefficient.

Protein Expression of Aggrecan and Collagen Type 2

The cartilage-specific phenotype was studied using immunofluorescence to observe newly formed collagen type 2 and aggrecan after cultivation of the freshly isolated chondrocytes. Immunocytochemical staining of the chondrocytes revealed high expression of aggrecan ( Fig. 6A ) and collagen type 2 ( Fig. 6B ). There was no expression in the negative control ( Fig. 6C ) which confirmed the specificity of the antibodies used for the staining.

Figure 6.

Expression of aggrecan and collagen type 2 by immunofluorescence. Expression of aggrecan (A) and collagen type 2 (B) was observed in passage 1 chondrocytes. There was no expression in the negative control (C) incubated with only secondary antibody, indicating specificity of the antibodies. Scale bars: 50 µm.

Gene Expression of Cartilage-Specific Phenotype

The mRNA expression of collagen type 2 in primary and passaged chondrocytes is depicted in Figure 7A . Results indicated the expression of collagen type 2 in both primary and passaged chondrocytes. The expression of collagen type 2 was significantly decreased in passage 3 when compared with primary chondrocytes. There was no significant difference in the expression of collagen type 2 between primary and passage 1 chondrocytes. The mRNA expression of aggrecan is depicted in Figure 7B . A fluctuating aggrecan expression across the 3 passages with passage 1 chondrocytes showing the highest expression. However, there was no significant difference in the expression of aggrecan between the three passages. To determine the possibility of chondrocytes dedifferentiation into fibroblast-like cells, the gene expression of collagen type 1 was assessed. Collagen type 1 showed an increase in expression with an increasing in passage number ( Fig. 7C ). A significant increase in the expression of collagen type 1 was observed in passage 3 compared with primary chondrocytes.

Figure 7.

mRNA expression of chondrocyte phenotype. Data are mean ± SD, n = 3. COL2 mRNA expression (A), aggrecan mRNA expression (B) and COL1 mRNA expression (C). Results are relative expression to P0. Bars with the same letter are not significantly different using Welch’s ANOVA followed by Games-Howell multiple comparison tests. COL2 = collagen type 2; COL1 = collagen type 1; P0 = primary chondrocytes; P1 = passage 1 chondrocytes; P3 = passage 3 chondrocytes.

Discussion

The isolation of chondrocytes from cartilage biopsies by enzymatic digestion is an important step to generate cell-based implants for cartilage repair.²⁰ Different methods for isolation of chondrocytes from cartilage have been established. Some of these methods utilized different concentrations of proteases and lengths of incubation. Cartilage tissue engineering is evolving rapidly as therapeutic strategies for cartilage defects that required chondrocytes for the engraftment of the construct into the defective area.⁶ Cell-based therapy for cartilage defects required high cell numbers. Because of a limited number of cartilage and considering the low number of cell yield in the primary culture,¹³ an optimized and validated protocol for isolation of chondrocytes would be a key step toward achieving cost-effective and efficient tissue engineering for cartilage repair. In this study, an optimized method for isolation of chondrocytes from human cartilage was established. To validate the method, the isolated chondrocytes were characterized for the expression of chondrocyte phenotype to ensure the quality of the cells. In addition, the effect of seeding densities on the growth kinetics of isolated chondrocytes were investigated.

The results indicated that chondrocytes yield per gram of cartilage was higher in collagenase II in HBSS. A number of studies have demonstrated the use of collagenase II in the isolation of chondrocytes^1,20 with a varying number of chondrocytes yield. Similarly, several studies have reported the use of serum-free or serum-supplemented media as the medium for dissolving collagenase for cartilage digestion to isolate viable chondrocytes.^1,14,21 For many years, the use of predigest phase with trypsin, pronase, or hyaluronidase as an initial step to loosen the tissue for effective breakdown of the fibrillar network by collagenase to release chondrocytes have been reported. The number of chondrocytes per gram of cartilage was significantly reduced in cartilage digested with trypsin. Naranda et al.¹³ reported the use of trypsin as the simple and affordable procedure for the isolation of chondrocytes from cartilage. Collagenase II being a structural component of the joint cartilage could locally unwind the triple-helical collagen before it cleaves the Gly-Ile and Gly-Leu peptide bonds.²² While trypsin acts by cutting the lysine or arginine amino acid residue on their c-termini unless these amino acids are followed by proline.²³ Digestion of cartilage with 0.2% weight per volume (550 U/mL) of collagenase II in HBSS produced the highest number of chondrocytes in this study. Vedicherla and Buckley¹ stated that much of the inconsistent report of protocol for chondrocytes isolation in the literature could be attributed to the discrepancy in the enzyme concentrations and enzyme solution to tissue mass ratio. Since there are variations for different lots of collagenase, it is therefore important for consistent reporting based on the unit of enzyme activity to ensure reproducible results.

The chondrocyte morphologic feature was round to polygonal in shape. As chondrocytes undergo successive passages, their morphology could change from round shape to spindle-like shape with increased expression of collagen type 1.²⁴ It has been shown in this study that chondrocytes seeded at higher density were able to maintain their round or polygonal shape up to 3 passages. In addition, chondrocyte attachment and growth were apparent in monolayer culture for the cells isolated with collagenase II at day 1 of cultivation, whereas cell attachment onto the flask in the case of trypsin was poor and could not yield a reasonable number of cells within limited time. In most cases, the cells isolated with trypsin failed to attain a confluence even after 2 weeks of cultivation in culture medium supplemented with serum. Furthermore, only a few numbers of cells adhered onto the flask from the primary cells isolated with trypsin. This suggests that trypsin interfered with the membrane adhesive proteins, such as cadherins and integrins.²⁵ In the cell membrane, these proteins provide anchors to link cytoskeleton with extracellular matrix (ECM) for the regulation of cell migration and adhesion.²⁵ EDTA, which was used along with trypsin, is a chelator of divalent ions and its presence could perturb magnesium and calcium-dependent membrane proteins such as integrins and cadherins for stable interaction with their ligands.²⁶ Similarly, Delon and Brown²⁷ demonstrated that integrins link the cytoskeleton to ECM ligands, which provide a robust attachment to allow cell-shape adjustment and tissue integrity. Taken together, the result of this study did not support the use of trypsin-EDTA as an efficient method for the isolation of chondrocytes as reported by Naranda et al.¹³ The method seems not cost-effective due to the fact that the time and culture media required to yield a sufficient number of chondrocytes are not comparable to the use of collagenase II.

The growth curve of chondrocytes seeded at higher densities depicted 3 different phases. It started with an initial lag phase, which was followed by exponential growth and lastly the stationary phase. This pattern of the growth curve is in line with the general behavior of cells. Chondrocytes seeded at a lower density displayed a slow continuously growth pattern, indicating a longer time is required for the cells to reach a stationary phase. Therefore, chondrocytes seeded at low densities may be appropriate for the assays that can be performed over a long period of time. However, it is important to note that chondrocytes seeded at low densities are more likely to undergo dedifferentiation. In the present study, shorter PDT was observed in the chondrocytes seeded at lower densities. Baghaban et al.²⁸ demonstrated similar PDT for rat chondrocytes. Similarly, PDT comparable or higher than the one observed in this study for human nasal chondrocytes²⁹ and human articular chondrocytes³⁰ have been reported. The reason for these inconsistencies between studies may be attributed to different culture conditions, the source of cartilage, or nature of chondrocytes (primary vs. passaged). Chondrocytes in a monolayer culture can undergo rapid proliferation with increase passaging as a result of dedifferentiation.^21,30

Characterization of chondrocyte phenotype at the protein and gene levels showed the expression of collagen type 2 and aggrecan. These 2 matrix proteins are the predominant proteins in the extracellular matrix of cartilage and they are important in maintaining ECM homeostasis. To further confirm the possibility of chondrocytes dedifferentiation in a monolayer, Alcian blue staining for the expression of proteoglycan and gene expression for collagen type 2 and aggrecan until passage 3 were investigated. The results demonstrated the expression of proteoglycan, indicating the cells retained their chondrocyte phenotype even at P3. Furthermore, gene expression of collagen type 2 decreases with passaging, whereas a fluctuating level of aggrecan expression was observed. This pattern of expression of these matrix proteins observed corroborated the findings of Zwickl et al.³¹ They observed a progressive decrease in collagen type 2 expression but a fluctuating aggrecan expression with the increasing number of passages. Contrary to this observation, the expression of both matrix proteins has been shown to be inversely correlated with number of passages.³² However, the decrease in collagen type 2 gene expression in this present study was not significantly different between primary and passage 1 chondrocytes. A comparison between chondrocytes isolated from normal and osteoarthritic joints showed no apparent differences in the synthesis of collagen type 2.³³ The increased expression of collagen type 1 is related to a shift in the morphology of chondrocyte phenotype toward a fibroblast one. To further confirm this, gene expression level of collagen type 1 was examined. There was no significant change in the expression of collagen type 1 between primary and passage 1 chondrocytes. This shows that the chondrogenic potential of P1 chondrocytes was not significantly altered in this study.

Conclusion

The present study provides an insight into the protocol for the isolation of chondrocytes from articular cartilage. Isolation of chondrocytes with collagenase II in HBSS has shown to produce a significant number of cells that retained chondrocyte phenotype. This protocol can be employed to generate a large number of chondrocytes for tissue engineering to repair cartilage defect or treat osteoarthritis. In addition, the data presented here did not support the use of trypsin-EDTA for efficient chondrocyte isolation. The data also suggest that passaged chondrocytes displayed more fibroblast phenotype and as such low passage chondrocytes should be employed for studies that may involve the repair of cartilage or in vitro models of osteoarthritis.

Footnotes

Acknowledgments and Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by Putra Grant, Universiti Putra Malaysia with grant number: GP-IPS/9578600 and GPB/9657800.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval

The protocol was approved by the Medical Research and Ethics Committee, Ministry of Health, Malaysia with reference number KKM.NIHSEC/P17-1554 (5).

Informed Consent

Written informed consent was obtained from all patients before the study.

Trial Registration

Not applicable.

ORCID iD

Suleiman Alhaji Muhammad

References

Vedicherla

Buckley

CT.

Rapid chondrocyte isolation for tissue engineering applications: the effect of enzyme concentration and temporal exposure on the matrix forming capacity of nasal derived chondrocytes. Biomed Res Int. 2017;2017:2395138.

Kon

Filardo

Martino

Di Marcacci

ACI and MACI. J Knee Surg. 2012;25(1):17-22.

Brittberg

Lindahl

Nilsson

Ohlsson

Isaksson

Peterson

Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med. 1994;331(14): 889-95.

Brittberg

Sjögren-Jansson

Thornemo

Faber

Tarkowski

Peterson

, et al. Clonal growth of human articular cartilage and the functional role of the periosteum in chondrogenesis. Osteoarthritis Cartilage. 2005;13(2_suppl):146-53.

Tallheden

Bengtsson

Brantsing

Sjögren-Jansson

Carlsson

Peterson

, et al. Proliferation and differentiation potential of chondrocytes from osteoarthritic patients. Arthritis Res Ther. 2005;7(3):R560-R568.

Oseni

Butler

Seifalian

AM.

Optimization of chondrocyte isolation and characterization for large-scale cartilage tissue engineering. J Surg Res. 2013;181(1):41-8.

Jakob

Démarteau

Schäfer

Stumm

Heberer

Martin

Enzymatic digestion of adult human articular cartilage yields a small fraction of the total available cells. Connect Tissue Res. 2003;44(3-4):173-80.

Schulze-Tanzil

de Souza

Castrejon

John

Merker

Scheid

, et al. Redifferentiation of dedifferentiated human chondrocytes in high-density cultures. Cell Tissue Res. 2002;308(3):371-9.

Darling

Athanasiou

KA.

Rapid phenotypic changes in passaged articular chondrocyte subpopulations. J Orthop Res. 2005;23(2_suppl):425-32.

10.

Diaz-Romero

Nesic

Grogan

Heini

Mainil-Varlet

Immunophenotypic changes of human articular chondrocytes during monolayer culture reflect bona fide dedifferentiation rather than amplification of progenitor cells. J Cell Physiol. 2008;214(1):75-83.

11.

Chung

Mesa

Miller

Randolph

Gill

Burdick

JA.

Effects of auricular chondrocyte expansion on neocartilage formation in photocrosslinked hyaluronic acid networks. Tissue Eng. 2006;12(9):2665-73.

12.

Stall

Kagoma

Bondy

Naudie

Surgical waste audit of 5 total knee arthroplasties. Can J Surg. 2013;56(2_suppl):97-102.

13.

Naranda

Gradišnik

Gorenjak

Vogrin

Maver

Isolation and characterization of human articular chondrocytes from surgical waste after total knee arthroplasty (TKA). PeerJ. 2017;5:e3079.

14.

Tew

Murdoch

Rauchenberg

Hardingham

TE.

Cellular methods in cartilage research: primary human chondrocytes in culture and chondrogenesis in human bone marrow stem cells. Methods. 2008;45(1):2-9.

15.

Deasy

Gharaibeh

Pollett

Jones

Lucas

Kanda

, et al. Long-term self-renewal of postnatal muscle-derived stem cells. Mol Biol Cell. 2005;16(7):3323-33.

16.

Zhang

Zheng

Wen

Han

Zhang

, et al. Differentiation potential of neural stem cells derived from fetal sheep. Anim Cells Syst (Seoul). 2017;21(4):233-40.

17.

Newton

Staines

Spevak

Boskey

Teixeira

Macrae

, et al. Chondrogenic ATDC5 cells: an optimised model for rapid and physiological matrix mineralisation. Int J Mol Med. 2012;30(5):1187-93.

18.

Yoon

Kim

Somaiya

Noh

Choi

Lim

, et al. Type II collagen and glycosaminoglycan expression induction in primary human chondrocyte by TGF-β1. BMC Musculoskelet Disord. 2015;16:141.

19.

Chabane

Zayed

Benderdour

Martel-Pelletier

Pelletier

Duval

, et al. Human articular chondrocytes express 15-lipoxygenase-1 and -2: potential role in osteoarthritis. Arthritis Res Ther. 2009;11(2_suppl):R44.

20.

Centola

Tonnarelli

Hendriks

van den Doel

Feliciano

Papadimitropoulos

, et al. An improved cartilage digestion method for research and clinical applications. Tissue Eng Part C Methods. 2015;21(4):394-403.

21.

Rosenzweig

Matmati

Khayat

Chaudhry

Hinz

Quinn

TM.

Culture of primary bovine chondrocytes on a continuously expanding surface inhibits dedifferentiation. Tissue Eng Part A. 2012;18(23-24):2466-76.

22.

Chung

Dinakarpandian

Yoshida

Lauer-Fields

Fields

Visse

, et al. Collagenase unwinds triple-helical collagen prior to peptide bond hydrolysis. EMBO J. 2004;23(15):3020-30.

23.

Olsen

Ong

Mann

Trypsin cleaves exclusively C-terminal to arginine and lysine residues. Mol Cell Proteomics. 2004;3(6):608-14.

24.

Lee

Chae

Jang

Lee

Son

Fully dedifferentiated chondrocytes expanded in specific mesenchymal stem cell growth medium with FGF2 obtains mesenchymal stem cell phenotype in vitro but retains chondrocyte phenotype in vivo. Cell Transplant. 2017;26(10):1673-87.

25.

Huang

Hsing

Lai

Chen

Lee

Chan

, et al. Trypsin-induced proteome alteration during cell subculture in mammalian cells. J Biomed Sci. 2010;17(1):36.

26.

Schubert

Strohmeyer

Bharadwaj

Ramanathan

Krieg

Friedrichs

, et al. Assay for characterizing the recovery of vertebrate cells for adhesion measurements by single-cell force spectroscopy. FEBS Lett. 2014;588(19):3639-48.

27.

Delon

Brown

NH.

The integrin adhesion complex changes its composition and function during morphogenesis of an epithelium. J Cell Sci. 2009;122(Pt 23):4363-74.

28.

Eslaminejad

Taghiyar

Falahi

Quantitative analysis of the proliferation and differentiation of rat articular chondrocytes in alginate 3D culture. Iran Biomed J. 2009;13(3):153-60.

29.

Idrus

RBH

Hui

Ibrahim

Hussein

Saim

. The expansion potential of human nasal septum chondrocytes for the formation of engineered cartilage. ScienceAsia. 2007;33(2_suppl):145-52.

30.

Schrobback

Klein

Schuetz

Upton

Leavesley

Malda

Adult human articular chondrocytes in a microcarrier-based culture system: expansion and redifferentiation. J Orthop Res. 2011;29(4):539-46.

31.

Zwickl

Niculescu-Morzsa

Halbwirth

Bauer

Jeyakumar

Reutterer

, et al. Correlation analysis of SOX9, -5, and -6 as well as COL2A1 and aggrecan gene expression of collagen I implant-derived and osteoarthritic chondrocytes. Cartilage. 2016;7(2_suppl):185-92.

32.

Lin

Fitzgerald

Willers

Wood

Grodzinsky

, et al. Gene expression profiles of human chondrocytes during passaged monolayer cultivation. J Orthop Res. 2008;26(9):1230-7.

33.

Yang

KGA

Saris

DBF

Geuze

van Rijen

MHP

van der Helm

YJM

Verbout

, et al. Altered in vitro chondrogenic properties of chondrocytes harvested from unaffected cartilage in osteoarthritic joints. Osteoarthritis Cartilage. 2006;14(6):561-70.

Optimization of Protocol for Isolation of Chondrocytes from Human Articular Cartilage

Abstract

Objective

Design

Results

Conclusions

Keywords

Introduction

Materials and Methods

Cartilage Biopsies

Cartilage Preparation for Digestion

Cartilage Digestion Using Trypsin-EDTA

Cartilage Digestion Using Collagenase II in HBSS

Cartilage Digestion Using Collagenase II in DMEM/F-12

Chondrocyte Expansion

Chondrocyte Growth Curve

Population Doubling Time of Chondrocytes

Chondrocyte Staining for Proteoglycan

Immunofluorescence

q-RTPCR

Data Analysis

Results

Chondrocytes Yield after Digestion of Cartilage

Morphology of Primary Chondrocytes

Alcian Blue Staining for Proteoglycan

Growth Kinetics of Chondrocytes

Protein Expression of Aggrecan and Collagen Type 2

Gene Expression of Cartilage-Specific Phenotype

Discussion

Conclusion

Footnotes

Acknowledgments and Funding

Declaration of Conflicting Interests

Ethical Approval

Informed Consent

Trial Registration

ORCID iD

References