Noscapine Suppresses Metastasis in Oral Cancer by Targeting the CXCL-8/CXCR2 Chemokine Signaling Pathway

Abstract

Background

Oral cancer remains a significant global health issue, largely due to the high morbidity and mortality associated with metastatic disease. Noscapine, a phthalide isoquinoline alkaloid derived from opium, has gained recognition for its selective anticancer effects, particularly its ability to induce apoptosis in cancer cells while sparing normal cells. However, its potential to inhibit metastasis in oral cancer has not been fully clarified. This study investigates the anti-metastatic properties of noscapine in oral cancer, focusing on its regulatory impact on the CXCL8/CXCR2 chemokine signaling pathway.

Methods

KB-1 oral squamous carcinoma cells were used for in vitro experiments. Cell viability was determined using the MTT assay, while apoptotic changes were assessed by acridine orange/ethidium bromide (AO/EtBr) dual staining and observed under a fluorescence microscope. The effect of noscapine on cell migration was evaluated with a scratch wound healing assay. Molecular docking studies were performed to assess noscapine's binding affinities to chemokine signaling proteins, including CXCL8, CXCR2, SDF-1, and CXCR4. Real-time PCR was employed to quantify the mRNA expression levels of these chemokines.

Results

Noscapine significantly decreased the viability of KB-1 cells in a dose-dependent manner, with IC₅₀ values of 40.49 ± 4.67 μM at 24 h and 38.03 ± 5.83 μM at 48 h (p ≤ 0.05), while having minimal cytotoxic effects on normal human gingival fibroblasts. AO/EtBr staining confirmed apoptosis, as evidenced by chromatin condensation and nuclear fragmentation. Molecular docking revealed strong binding affinities for CXCL8 and CXCR2, and noscapine treatment resulted in marked downregulation of their mRNA expression, indicating inhibition of chemokine-mediated metastasis. The scratch assay further confirmed noscapine's ability to suppress cell migration.

Conclusion

Collectively, these findings highlight noscapine's potential as a low-toxicity therapeutic candidate for metastatic oral squamous cell carcinoma and support its further evaluation in preclinical and clinical studies.

Introduction

Oral cancer poses a substantial global health challenge, with oral squamous cell carcinoma (OSCC) accounting for over 90% of all cases. ¹ According to the Global Cancer Observatory (GLOBOCAN) 2022 data, there were an estimated 389,485 new cases of lip and oral cavity cancer worldwide, resulting in 188,230 deaths-figures that underscore the considerable morbidity and mortality associated with this disease. ² Despite advances in diagnostic techniques and therapeutic strategies, the prognosis for patients with metastatic OSCC remains poor. The lethality of OSCC is largely attributable to the ability of malignant cells to breach the basement membrane, disseminate via the bloodstream, and establish metastatic colonies in distant organs, which is the principal cause of cancer-related mortality.^3-5 Traditionally, cancer cells were thought to be solely responsible for unchecked proliferation and metastasis; however, contemporary research has revealed that metastasis is a multifaceted process involving various pathogenic stages, including immune evasion, survival in the circulatory system, and colonization of remote tissues. ⁶ Noscapine, a phthalide isoquinoline alkaloid first isolated from Papaver somniferum in 1817, has been employed as a reliable antitussive agent for over five decades. Among natural compounds, noscapine and similar agents have garnered significant attention in cancer research due to their favorable safety profiles and promising antitumor activities. ⁷

Noscapine, originally developed as a cough suppressant, is now recognized as a potent anticancer agent with significant therapeutic potential against a range of malignancies, including colon, gastric, breast, and ovarian cancers. Its mechanism of action involves targeting microtubules, thereby arresting cells in metaphase and inducing apoptosis through multiple pathways. Noscapine achieves this by downregulating anti-apoptotic proteins and upregulating pro-apoptotic proteins such as caspases and Bax. ⁷ Currently, noscapine is being evaluated in Phase I/II clinical trials as a tubulin-binding agent, and it has demonstrated excellent water solubility, high tolerability, and negligible toxicity. ⁸ Preclinical studies have shown that noscapine not only inhibits tumor growth but also activates apoptotic pathways in cancer cells. The use of nanoparticles and their derivatives to deliver noscapine has further enhanced its bioavailability and therapeutic efficacy, owing to their favorable pharmacokinetic profiles and low toxicity. In addition to its direct anticancer effects, noscapine has been shown to inhibit hypoxia-induced HIF-1α expression and angiogenesis, highlighting its multifaceted role in tumor suppression. ⁸ When used as a chemosensitizer at low doses, noscapine enhances the cytotoxicity of other anticancer agents, such as docetaxel, particularly in triple-negative breast cancer cells, by inducing cellular stress and activating MAPK pathways (JNK and p38). Moreover, noscapine possesses antifibrotic properties that disrupt the tumor stroma, thereby improving the delivery and efficacy of nanocarrier-based therapeutics in malignant tissues. Collectively, these attributes underscore noscapine's promise as a versatile and low-toxicity anticancer agent, warranting further investigation in both preclinical and clinical settings. ⁹

The CXCL8/CXCR2 chemokine signalling pathway has been firmly established as a crucial mediator of cancer progression and metastasis. Chemokines, first characterised in 1984 as agents responsible for neutrophil migration, are soluble proteins with molecular weights between 8 and 15 kDa; to date, approximately fifty distinct chemokines and twenty corresponding receptors have been identified in humans. Among these, CXCL8 (also known as interleukin-8) and its receptor CXCR2 have been implicated in a spectrum of pro-tumourigenic processes, including cellular proliferation, angiogenesis, and the recruitment of immunosuppressive cells to the tumour microenvironment. Recent investigations have further elucidated the role of the CXCL8/CXCR2 axis in the pathogenesis of oral cancer and its potential as a therapeutic target. For instance, Jiang et al (2023) demonstrated that CXCL8/CXCR2 signalling enhances both stemness and chemoresistance in oral squamous cell carcinoma (OSCC), suggesting that its inhibition may offer a promising strategy for overcoming therapeutic resistance. ¹⁰ Similarly, Liu et al (2022) reported that blockade of the CXCL8–CXCR1/2 axis attenuates tumour growth and metastasis in OSCC by modulating the tumour microenvironment, ¹¹ while Wang et al (2021) provided a comprehensive analysis underscoring the multifaceted roles of CXCL8 in angiogenesis, metastasis, and immune evasion in oral malignancies. ¹² Collectively, these findings underscore the enduring significance of noscapine and the CXCL8/CXCR2 pathway in contemporary cancer research, and offer new insights into their respective roles in the development and management of oral cancer. The present study, therefore, seeks to investigate the capacity of noscapine to impede the metastatic potential of oral cancer cells by targeting the CXCL8/CXCR2 chemokine signalling pathway.

Materials and Methods

Cell Line Maintenance

The cell lines (KB-1) were cultured in Dulbecco's Modified Eagle Medium (DMEM) and supplied with 10% fetal bovine serum (FBS) and 1% antibiotics, such as amphotericin, streptomycin, and penicillin. Tissue culture flasks (T25 flask, 75 cm²) from Corning, USA, were used to cultivate cells under controlled conditions of 37 °C, 5% CO₂, and high humidity. The cell lines used in our study were procured from the National Centre for Cell Science (NCCS), Pune, India, which is a recognized and authorized national repository for cell lines.

The Cell Viability (MTT) Assay

The MTT assay was used to evaluate the viability of lines and human gingival fibroblast cells treated with Noscapine. ¹³ This technique assesses how yellow tetrazolium salt is transformed into insoluble formazan crystals, which causes a color shift. This process involved seeding of trypsinized cells in 96 well plates with 5 × 10³ cells per-well. Following seeding, the cells were cultivated for three hours at 37 °C in a medium devoid of serum. After that, 100 µl of serum-free medium was used to wash them twice. Initially, control cells were kept in a medium devoid of serum. The cells were then subjected to varying concentrations of Noscapine (5-80 µM/ml) for 24 and 48 h. A 100 µl of MTT compound (0.5 mg/ml in DMEM) was added to each well that contained the control and treated cells. In a humidified CO₂ incubator, the plates were incubated for four hours at 37 °C. Following incubation, 1× PBS was used to rinse the wells and remove the MTT solution. 100 µl of dimethyl sulfoxide is used to dissolve the formazan crystals. The color intensity was then measured with the help of a microplate reader (ELISA) at 570 nm. The percentage of viable fibroblast was calculated using the following formula: [(A570 nm treated − A570 nm control)/A570 nm control] × 100.

Cell Morphological Characteristics

The optimal dose, half maximal inhibitory concentration (IC50), determined as 40.493 ± 4.673 μM/ml through the MTT assay for the line, was selected for further analysis. In 6-well plates, cells were plated to a density of 2 × 10⁵ and subjected to Noscapine for 24 h. After the Noscapine treatment, they were washed once in phosphate buffered saline (PBS, pH 7.4), and observed using an inverted microscope to assess cell morphology. ¹⁴

Apoptosis Recognition and Analysis

Double labeling using the acridine orange dye (AO) and a substance called ethidium bromide (EtBr) determined the manner of cell death. As mentioned in earlier studies, ¹³ the Acridine orange/ethidium bromide (AO/EtBr) dual staining method was utilized to analyze the impact of noscapine on death. Following 24 h of noscapine (20 and 40 μM/ml) treatment, the cells were gathered and washed with PBS. Subsequently, the pellets were incubated with 5 µl of AO (1 mg/mL) and 5 µl of EtBr (1 mg/mL). The noscapine induced apoptotic changes in the labeled cells were visualized with the help of an inverted fluorescence microscope.

Scratch Wound Healing Assay

The assay was performed in vitro to assess Noscapine's anti-migratory effects on oral cancer cells. ¹³ Human oral cancer cells (2 × 10⁵ cells/well) were planted in 6 well culture plates. The wound was created by scratching the cell monolayer with 200 μl tip and washed with PBS; the images were captured using an inverted microscope. Cells were treated with Noscapine at 20 and 40 μM/ml for 24 h. Control cells were kept in serum-free culture media. Following treatment, the injured areas were imaged with the same microscope. All experiments were done in triplicate.

Real Time Polymerase Chain Reaction (RT-PCR)

RT-PCR was used to study the apoptotic gene expression and chemokine signaling molecules. A Trizol reagent (Sigma) is used to extract the RNA using standard protocols. The PrimeScript first strand cDNA synthesis kit (TakaRa, Japan) was used to synthesize cDNA from 2 μg of RNA. Target genes were amplified with specific primers, whose sequences are listed in Table 1. The PCR reactions were carried out with GoTaq qPCR Master Mix (Promega), which includes SYBR Green I dye and all other PCR components. Real-time PCR was performed with the Bio-Rad CFX96 PCR system. The cycle threshold (CT) values were evaluated using the comparative CT method, and the relative fold change in expression was calculated using the 2^(–ΔΔCT) method, as described by Schmittgen.^13,15

Table 1.

Primer Sequences Utilized in This Study to Perform Real-Time Polymerase Chain Reaction (RT-PCR).

Gene	Forward Primer	Reverse Primer	Tm
p53	AGGCCTTGGAACTCAAGGAT	TGAGTCAGGCCCTTCTGTCT	60
Bax	TACCTCTTCCCTTCCTTTCTCC	TCCTGGATGAAACTAGAGTGGG	58
Bcl-2	CATGTGTGTGGAGAGCGTCAAC	CAGATAGGCACCCAGGGTGAT	58
Caspase-3	GCTATTGTAGGCGGTTGT	TGTTTCCCTGAGGTTTGC	55
CXCL8	GTCTGCTAGCAGGCTCCAC	GCTTCCACATGTCCTCACAA	58
CXCR2	CGCTCCGTCACTGATGTCA	GAGTGAGACCACCTTGCACA	58
SDF-1	GTGCCCTTCAGATTGTAGCC	CCTTCCCTAACACTGGTTTCA	58
CXCR-4	AAATGGGCTCAGGGGACTAT	TCCCAAATACCAGTTTGCC	60
GAPDH	CGACCACTTTGTCAAGCTCA	CCCCTCTTCAAGGGGTCTAC	58

Statistical Analysis

All experiments were conducted in triplicate, and results are expressed as mean ± standard deviation (SD) or mean ± standard error of the mean (SEM), as applicable. Statistical comparisons between multiple groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey's Honest Significant Difference (HSD) post hoc test to identify differences between individual groups. A p-value of < 0.05 was considered statistically significant. Although a formal sample size power analysis was not performed, the number of replicates (n = 3) was consistent with previous in vitro studies and sufficient to observe statistically significant trends.

Molecular Docking

Protein Preparation

The crystal structures of CXCL-8 (PDB ID: P10145), CXCR-2 (PDB ID: P25025), SDF1 (PDB ID: P48061), and CXCL-4 (PDB ID: P61073) are retrieved from the Research Collaboratory for Structural Bioinformatics (RCSB) database at resolutions of 1.25 Å, 3.40 Å, 1.90 Å, and 2.50 Å, respectively. ¹⁶ These structures were prepared by eliminating any bound complexes and calculating the protonation statuses of ionizable residues in order to ensure correct electrostatic interactions during docking. Water molecules were removed from the structures in order to simplify the system. The force field parameters were then set to precisely imitate the proteins’ behavior during docking simulations. Finally, the protein architectures were improved and optimized prior to docking.

Ligand Preparation

Noscapine was employed as the ligand in the current study. The chemical structure was obtained from PubChem ¹⁷ (http://pubchem.ncbi.nlm.nih.gov). Initially acquired in SDF format, the structure was then converted to PDB format using Chimera software, ¹⁸ allowing for a thorough investigation of its three-dimensional layout.

Docking

In this study, AutoDock 1.5.7 ¹⁹ is used to investigate binding conformations and ligand-protein interactions of noscapine with each of the four protein targets. For each protein, grid box specifications were established to guarantee precise active site targeting. X: −13.787, Y: 10.535, and Z: 11.453 were the centers of the 98 × 90 × 90 point grid for CXCL-8. The 76 × 106 × 126 grid for CXCR-2 was defined using X: 77, Y: 107, and Z: 127 as its centers. The grid size for SDF1 was 66 × 68 × 48, centered at X: 67, Y: 69, and Z: 49, and for CXCL-4 it was 76 × 126 × 114, centered at X: 77, Y: 127, and Z: 115. The highest-scoring ligand-protein complex was chosen based on the binding energy and stability of the contacts using flexible ligand docking, which was carried out using the Lamarckian Genetic Algorithm (LGA). AutoDock speeds up the docking process by assessing different binding conformations and potential interactions between the ligand and the protein.

Analysis of Docked Complex

Following the docking process, the data were examined to identify the most promising candidates for future research. This analysis involved calculating the predicted interaction energy to calculate the ligand's binding affinity. The Biovia Discovery Studio Visualizer (2021) was used to detect hydrogen bonds, hydrophobic interactions, and electrostatic interactions among ligands and proteins in docked structures. These interactions shed light on structural optimization and disclose the processes of ligand activation.

Results

Cytotoxic Potential and Their Morphological Alterations Induced by Noscapine on the Oral Cancer Cell Line (KB-1)

The results revealed a significant reduction (p ≤ 0.05) in cell proliferation, with percentages of 93.19%, 86.04%, 72.85%, 51.47%, 29.59% and 19.00% in 24 h and 90.73%, 79.53%, 70.75%, 50.26%, 27.93% and 20.06% in 48 h time points at concentrations of 5, 10, 20, 40, 60, 80 μM/ml of Noscapine, respectively in KB-1 cells (Figure 1A). Noscapine significantly reduced the viability of compared to the control (untreated) group at both 24 and 48-h time intervals (p ≤ 0.05). The percentage of cell viability gradually decreased significantly (p ≤ 0.05) with an increase in the concentration of Noscapine, reaching 50% growth inhibition at a dose of 40.493 ± 4.673 (24 h) and 38.034 ± 5.829 (48 h) μM/ml (Figure 1A). Notably, all calculated IC50 values for Noscapine were lower in cancer cells (KB-1) than for in normal cells (hGFs). The cell viability percentage of gingival fibroblast cells followed 99.01%, 99.91%, 97.95%, 97.96%, 89.08% and 76.68% in 24 h and 98.81%, 97.11%, 98.71%, 94.41%, 86.19% and 69.74% in 48 h time points at concentrations of 5, 10, 20, 40, 60, 80 μM/ml of Noscapine respectively (p ≤ 0.05) (Figure 1B). Therefore, the mentioned dose was chosen for subsequent experiments. Lower concentrations of Noscapine did not exhibit significant effects.

Figure 1.

The Cytotoxic Effects of Noscapine on Oral Cancer Cells (KB-1) and Human Gingival Fibroblast (HGF) Cells. (A) KB-1 Cells Were Treated with Varying Concentrations of Noscapine (5-80 μM/ml) for 24 and 48 h to Assess Cell Viability. (B) The Cytotoxicity of Noscapine on HGF Cells was Evaluated by Treating Them with the Same Concentration Range (5-80 μM/ml) for 24 and 48 h. the MTT Assay was Carried out by Adding 100 μL of MTT Solution (0.5 mg/mL), Incubation for 4 h, and Then Adding DMSO. At 570 nm, Absorbance was Measured. All Experiments Were Conducted in Triplicate, and the Results are Expressed as Mean ± SD (n = 3). * Indicates a Statistically Significant Difference Compared to the Untreated Control Group (p < 0.05).

The line was exposed to Noscapine (20 and 40 μM/ml) for 24 h. In comparison to the control cells, the treated cells exhibited notable morphological alterations, including cell shrinkage and reduced cell density characteristic features of apoptotic cells were evident in the Noscapine-treated cells. Additionally, cells undergoing apoptosis displayed other morphological changes, such as rounding up, shrinkage, and loss of contact with neighboring cells. Some sensitive cells were also observed to detach from the surface of the plates (Figure 2).

Figure 2.

Effect of Noscapine on Cell Morphology of Human Oral Cancer and Gingival Fibroblast Cell Line. (A) Untreated KB-1 Cells Exhibiting No Change in their Morphology. Cells were Treated with Noscapine (20, 40 and 60 μM/ml) for 24 Hours. Post-treatment with Noscapine, the Number of Cells Reduced, and These Cells Displayed Characteristics Such as Cell Shrinkage and Blebbing of Cytoplasmic Membranes. (B) Gingival Fibroblast, Along with the Control Group, were Subjected to the Same Concentration for 24 h. After Treatment, the Images were Captured in an Inverted Microscope at 10x Magnification.

Apoptotic Cell Identification Using AO/EtBr Dual Staining

AO/EtBr dual staining was used to evaluate nuclear morphology in cells treated with Noscapine along with control cell to obtain a better understanding on the causes of cell death, particularly apoptosis and necrosis (Figure 3). Our quantitative apoptosis analysis and the AO/EtBr staining results agreed that treated to Noscapine exhibited the highest degree of apoptosis, which was indicated by nuclear deformation and the loss of cell wall integrity.

Figure 3.

Noscapine was Administered to Human Oral Cancer Cell Lines for 24 h at 20 μM and 40 μM Dosages, in Addition to a Control Group. After the Cells Were Incubated, They Were Dual-Stained Using Acridine Orange and Ethidium Bromide (50 μg/mL Each in a 1:1 Ratio). An Inverted Fluorescent Phase-Contrast Microscope was Used to View the Stained Cells at a Magnification of 10×.

Intracellular Signalling Molecules Governing Proapoptotic Gene Expression in KB-1 Cells

The B-cell lymphoma 2 (Bcl-2) protein family consists of the anti-apoptotic protein Bcl-2 and pro-apoptotic proteins including p53, Bcl-2-associated X protein (Bax), and caspase-3. These proteins are necessary for caspase activation, cytochrome c release into the cytosol, and the integrity of the outer membrane of the mitochondria. We used real-time PCR to look at the mRNA expression levels of Bcl-2 family proteins in order to learn more about their functions. The findings demonstrated that noscapine markedly decreased the expression of the anti-apoptotic protein Bcl-2 in the KB-1 cell line while increasing the expression of pro-apoptotic proteins (p53, Bax, and caspase-3, as shown in Figure 4). This implies that noscapine-induced apoptosis in depends critically on the Bcl-2 protein family.

Figure 4.

The Oral Cancer Cell Line KB-1 was Used to Examine the Effects of Noscapine (40 μM/ml) on the Expression of Apoptotic Genes (Bcl-2, Bax, Caspase-3, and p53). The Results were Displayed as Fold Changes in Comparison to the Control, with the Expression Levels Of Target Genes Normalized to GAPDH mRNA Expression. SYBR Green Chemistry was Used For RT-qPCR, and the ΔΔCt Method was Used to Standardize Ct Results. The Graph Displays the Mean ± SEM for Each of the Three Separate Experiments. A Statistically Significant Difference between the Drug-Treated and Control Groups is Indicated by the Symbol “*” at a p-Value of Less Than 0.05.

The Anti-Metastatic Potential of Noscapine

The impact of Noscapine on migration was assessed using a scratch assay. The results showed that, in comparison to the untreated control cells, noscapine dramatically lowered the rate of cell migration. In particular, within 24 h, the cells in the control group had spread to nearly half of the scratched area. In contrast to the control group, migration was significantly inhibited by treatment with 40 µM/ml of noscapine (p ≤ 0.05). Noscapine-treated cells migrated over a significantly shorter distance than the control group (Figure 5). Additionally, semi-quantitative PCR was used to assess the mRNA expression levels of factors involved in chemokine signaling pathways, including CXCL-8 (C-X-C motif chemokine ligand 8), CXCR2 (C-X-C chemokine receptor 2), stromal cell-derived factor 1 (SDF1), and CXCR4 (C-X-C chemokine receptor type 4). When KB-1 cell lines were treated with Noscapine, RT-PCR analysis revealed a significant decrease in mRNA expression of CXCL8, which binds to CXCR2 to promote inflammatory responses (Figure 6). CXCL8 and CXCR2 mRNA expression levels in were significantly reduced by noscapine treatment (p ≤ 0.05). The anti-migratory effects of Noscapine were confirmed by the notable downregulation of these chemokines, which act as chemoattractants that promote cell migration.

Figure 5.

In Vitro Scratch Wound Healing Assay. Human Oral Cancer Cells Were Injured and Cell Migration Assay with and Without Treatment of Noscapine (20 and 40 μM/ml) was Performed at 24 h. A Linear Scratch was Made in Confluent Monolayers Using a sterile 200 μL Pipette tip. Proliferation was Prevented by Using a serum-Free media. Images Were Obtained Using an Inverted Phase Contrast Microscope.

Figure 6.

Effects of Noscapine (20 and 40 μM/ml) on the Expression of Chemokine Genes in the Oral Cancer Cell Line (KB-1) (CXCL-8, CXCR-2, SDF-1, and CXCR-4). Fold Variations in Comparison to the Control Group Are Used TO Display the Results of Normalizing Gene Expression Levels to GAPDH mRNA. Following a 24-h Treatment Period, RT-qPCR was Carried Out Using SYBR Green Detection and Verified Primers. Three Separate Experiments’ Mean ± SEM is Shown by Each Bar. “*” Signals Statistical Significance between the Drug-Treated and Control Groups (p < 0.05).

Noscapine Inhibits Cell Migration via Targeting Chemokines

The molecular docking evaluation of Noscapine with CXCL-8, CXCR-2, SDF1, and CXCL-4 highlights the compound's substantial therapeutic potential by demonstrating its stable and specific interactions with important chemokines and receptors implicated in diseases of signaling pathways. Noscapine had the strongest affinity for CXCR-2 of all of these, with a binding energy of −6.37 kJ/mol (Figure 7). With bond distances ranging from 2.9 Å to 3.7 Å, this interaction is stable because it forms multiple hydrogen bonds with residues like LEU192, CYS233, VAL320, SER191, SER277, PHE234, and ASP322. Alkyl and pi-alkyl bonds with LEU192, VAL320, and PRO194 are examples of hydrophobic interactions that further improve this complex's stability. It is notable that Noscapine's interaction with CXCR-2 is further strengthened and specification by pi-donor hydrogen and pi-sulfur bonds with CYS233. This strong interaction demonstrates how Noscapine can alter CXCR-2 activity, which is essential for chemokine-mediated inflammation and tumor growth.

Figure 7.

Molecular Docking between Noscapine and CXCR-2. (A) Location of Binding of Noscapine with CXCR-2. (B) Three-Dimensional Interaction of Noscapine with CXCR-2. (C) Two-Dimensional Interaction of Noscapine with the Receptor.

Noscapine formed significant hydrogen bonds with GLU46, GLN6, and LYS9 at distances of 2.9 Å, 2.9 Å, and 3.6 Å, respectively, and had a binding energy of −6.12 kJ/mol for CXCL-8 (Figure 8). The ligand-protein complex is further stabilized by hydrophobic interactions with residues such as LYS9, LEU47, and CYS48 in addition to hydrogen bonds. According to the thorough structural analysis, Noscapine complements the CXCL-8 binding pocket's active site and stabilizes the interaction by fitting snugly inside it. This demonstrates how Noscapine targets CXCL-8, a chemokine that is closely linked to fostering angiogenesis and the growth of cancer cells. The binding affinity of noscapine for CXCL-4 was found to be −5.63 kJ/mol (Figure 9). The stability of this interaction is aided by hydrogen bonds with ARG188 and ASP262 (distances of 3.0 Å and 2.8 Å, respectively), and the binding strength is strengthened by hydrophobic pi-alkyl interactions with VAL196. These interactions demonstrate how Noscapine may alter CXCL-4 activity, which is implicated in platelet aggregation and cancer metastasis. Noscapine formed hydrogen bonds with SER4, CYS9, ARG12, and ALA35 with bond distances ranging from 2.9 Å to 3.1 Å, demonstrating a moderate binding energy of −5.5 kJ/mol for SDF1 (Figure 10). The complex is further stabilized by hydrophobic interactions with ARG12, CYS34, and ARG8. Noscapine's capacity to alter SDF1-related signaling pathways, which are frequently linked to chemotaxis and tumor invasion, is demonstrated by this interaction profile.

Figure 8.

Binding Affinity between Noscapine and CXCL-8. (A) Binding site of Noscapine in CXCL-8. (B) Three-Dimensional Interaction of Noscapine with its Receptor Surface. (C) Two-Dimensional Representation of Interaction between Noscapine and CXCL-8.

Figure 9.

Binding Conformation of Noscapine with CXCR-4. (A) Location of Noscapine Binding with CXCR-4. (B) Interaction of Noscapine with CXCR-4 in Three-Dimension. (C) Two-Dimensional Interaction of Noscapine with CXCR-4.

Figure 10.

Docking analysis of Noscapine with SDF1. (A) Binding position of Noscapine with SDF1. (B) Three-Dimensional Analysis of Interaction between Noscapine and SDF1. (C) Two-Dimensional Interaction of Noscapine with SDF1.

Figure 11.

Schematic Representation of Noscapine's Proposed Anti-Cancer Mechanism in Oral Squamous Cell Carcinoma (OSCC). This Illustration Summarizes the Three major Objectives and Findings of the Study: Inhibition of Cell Growth: Noscapine Treatment Reduces OSCC Cell Proliferation. Induction of Apoptosis: Noscapine Induces Apoptosis by Modulating the mRNA Expression of Apoptotic Signaling Molecules—Upregulating pro-Apoptotic Markers (eg, Bad, Bax) and Downregulating Anti-Apoptotic Markers (eg, Bcl-2). Inhibition of Cell Migration: Noscapine Suppresses Cancer Cell Migration by Downregulating key Chemokine Pathways, Specifically the CXCL-8/CXCR2 and SDF-1/CXCR4 Axes. Together, These Effects Highlight Noscapine's Therapeutic Potential in Impairing OSCC Progression by Targeting Both Survival and Migration Signaling Networks.

Additional information about Noscapine's binding mechanisms can be obtained from the visual depictions of its docking interactions. Noscapine's 3D structural alignment within the binding site of protein's are shown in Panel A, along with its interactions. The stability of this ligand-protein complex is highlighted by its appropriate orientation and spatial fit within the protein's active site. With gradients highlighting the compatibility between Noscapine and the protein's active site, Panel B displays the surface representation of the binding pocket, highlighting the donor and acceptor regions for hydrogen bonds. A thorough 2D schematic of Noscapine's interactions with protein's are shown in Panel C, where important hydrogen bonds and hydrophobic forces that are essential for maintaining the stability of the ligand-receptor complex are highlighted (Figure 7-11). Together, these results demonstrate Noscapine's potent and specific binding affinity for a variety of chemokines and receptors, with CXCR-2 showing the strongest interaction, followed by CXCL-8, CXCL-4, and SDF1 (Table 2).

Table 2.

Docking Results with Amino Acids Interactions of VEGFA, VEGFR, FGF2 and FGFR1 with Colchicine.

Receptor Protein	Binding Energy (kJ/mol)	Amino Acid	Inter Action Bond	Type of Interaction	Distance (Å)
SDF1	−5.5	SER4	Conventional Hydrogen Bond	Hydrogen Bond	3.11559
		CYS9	Conventional Hydrogen Bond	Hydrogen Bond	3.14617
		ARG12	Conventional Hydrogen Bond	Hydrogen Bond	2.92911
		ALA35	Conventional Hydrogen Bond	Hydrogen Bond	2.94078
		ARG12	Alkyl	Hydrophobic	4.88748
		CYS34	Pi-Alkyl	Hydrophobic	4.70544
		ARG8	Pi-Alkyl	Hydrophobic	4.75218
CXCL-4	−5.63	ARG188	Conventional Hydrogen Bond	Hydrogen Bond	3.06751
		ASP262	Carbon Hydrogen Bond	Hydrogen Bond	2.8646
		VAL196	Pi-Alkyl	Hydrophobic	4.98615
CXCL-8	−6.12	GLU46	Carbon Hydrogen Bond	Hydrogen Bond	2.90897
		GLN6	Carbon Hydrogen Bond	Hydrogen Bond	2.90322
		LYS9	Carbon Hydrogen Bond	Hydrogen Bond	3.65947
		LYS9	Alkyl	Hydrophobic	4.35785
		LEU47	Alkyl	Hydrophobic	4.42566
		CYS48	Pi-Alkyl	Hydrophobic	4.26115
CXCR-2	−6.37	LEU192	Conventional Hydrogen Bond	Hydrogen Bond	2.95673
		CYS233	Conventional Hydrogen Bond	Hydrogen Bond	3.69951
		VAL320	Conventional Hydrogen Bond	Hydrogen Bond	3.16988
		SER191	Carbon Hydrogen Bond	Hydrogen Bond	3.23993
		SER277	Carbon Hydrogen Bond	Hydrogen Bond	3.03925
		PHE234	Carbon Hydrogen Bond	Hydrogen Bond	3.74435
		ASP322	Carbon Hydrogen Bond	Hydrogen Bond	3.63672
		CYS233	Pi-Donor Hydrogen Bond;Pi-Sulfur	Hydrogen Bond;Other	4.10432
		LEU192	Alkyl	Hydrophobic	4.37658
		VAL320	Pi-Alkyl	Hydrophobic	5.47749
		PRO194	Pi-Alkyl	Hydrophobic	5.15327

Discussion

Common cancer therapies include chemotherapy, surgery, and radiation therapy, each of which has a number of disadvantages. Nowadays, the majority of anticancer medications come from natural sources. Natural compounds inhibit cell signaling pathways and trigger cellular apoptosis to produce their anticancer effects. Common cancer therapies that have a number of disadvantages include chemotherapy, surgery, and radiation therapy. Nowadays, the majority of drugs against cancer come from natural sources. Natural compounds inhibit cell signaling pathways and trigger cellular apoptosis to produce their anticancer effects. Regarding this, our research contributes to the increasing amount of data demonstrating the efficacy of natural substances such as noscapine as substitutes for traditional treatments. This study investigated Noscapine's potential as an anti-cancer therapeutic agent in oral cancer treatment, focused on its impact on cancer cell viability, morphology, migration, and apoptosis, with a special emphasis on the CXCL-8/CXCR2 chemokine signaling pathway using in silico and gene expression studies. Noscapine, an opium alkaloid produced from Papaver somniferum, has received a lot of interest in recent years for its anti-cancer activities without the usual side effects associated with other chemotherapeutic treatments. ²⁰ Noscapine's anticancer potential was found in 1998, ²¹ and since then, studies have extended to investigate its usefulness in a variety of cancer types. Our findings show that Noscapine exhibits specific cytotoxicity towards oral cancer cells () when compared to normal cells. This selectivity is important for possible therapeutic uses because it shows Noscapine can target cancer cells while causing minimal damage to normal cells. In this study, we investigated Noscapine's cytotoxic and pro-apoptotic effects on the oral cancer cell line KB-1. Initially, were treated to varied concentrations of noscapine (5-80 μM/ml) for a period of both 24 and 48 h to determine its inhibitory effect on their growth. It was found that noscapine injection drastically reduced viability in a dose- and time-dependent manner.

The cytotoxic effect of a drug can be evaluated using the MTT assay, which measures mitochondrial activity within living cells. ²² In the best conditions, this MTT dye is reduced to insoluble formazan purple crystals by the NAD (P) H dependent oxido-reductase enzyme. After dissolving these deep purple formazan crystals in DMSO, the cytotoxicity is measured by the solution's absorbance. In the oral cancer cell line KB-1, noscapine decreased cell proliferation in a dose-dependent manner; the IC50 was shown to be 40 µM/ml and was chosen for further experiments. These findings align with previous research indicating that noscapine significantly reduces cell viability and exhibits anticancer activity across multiple cancer cell lines.^23-25 However, using the MTT assay technique, noscapine at different concentrations (5-80 µM/mL) did not show harmful effects in the normal (3T3L1) cell line. This result unequivocally shows that noscapine is nontoxic to healthy cells and primarily cytotoxic to cancerous cells.

Noscapine's anticancer properties were evaluated by observing morphological changes in the oral cancer cell line at concentrations ranging from 5 to 80 µM/mL, using an inverted phase-contrast microscope. The range of doses allowed for a thorough examination of Noscapine's effects on cellular structure. The findings revealed that cells exposed to Noscapine displayed significant morphological changes when compared to untreated cells, including reduced cell density, cell shrinkage, and cytoplasmic blebbing, all of which are characteristic of apoptosis and were observed in a dose-dependent manner.

Apoptosis, or programmed cell death, is characterized by chromatin condensation, DNA fragmentation, cell shrinkage, and activation of caspase enzymes. Cancer progression disrupts the apoptotic process. The most widely recognized anticancer technique is to prompt apoptosis in tumor cells, which is employed in a wide range of cancer treatments. Nuclear fragmentation and cell shrinkage are defining features of apoptotic cell death. AO/EB, a fluorescent DNA-binding dye, was used to identify cell death and morphological alterations during apoptosis. Ethidium bromide is a fluorescent intercalating agent that binds to the DNA bases. Ethidium bromide binds only to cells with reduced cytoplasmic membrane integrity, and the nucleus is only red in those cells. Early apoptotic cells have constricted or fragmented chromatin with a bright green nucleus. Late apoptotic cells exhibit orange chromatin that is broken and compacted. ²³ In our results green cells were evenly distributed across untreated cells. In comparison to the untreated group, Noscapine treatment group cells stained with more perinuclear brilliant green patches and orange to red nuclei suggested that Noscapine induces the apoptosis in oral cancer cells.

Our findings indicate that noscapine's induction of apoptosis is most likely mediated by modulation of apoptotic pathways, including caspase activation and Bcl-2 family protein regulation. At the level of the genome, Noscapine administration increases the pro-apoptotic Bax expression while inhibiting anti-apoptotic Bcl-2 expression in KB-1 cells. This alteration in the balance of apoptosis regulators gives insight into the processes by which Noscapine induces cancer cell death. Noscapine's dual action of inhibiting survival pathways and activating apoptotic machinery is what makes it so effective. Recent study has shed more light on Noscapine's potential as a cancer treatment. Findings have shown that Noscapine derivatives have promise anticancer activity against breast cancer cells, with several compounds exceeding the parent Noscapine. The study also showed the ability of these compounds to overcome multidrug resistance in cancer cells.^26,27 Recent study investigates nano-noscapine as an alternative therapy for prostate cancer, improving drug delivery and efficacy to overcome the drawbacks of conventional noscapine. Nano-noscapine caused cell cycle arrest and death in LNCaP prostate cancer cells by targeting the GLI1 and BAX genes. ²³ Additionally, a 2022 study demonstrated the effects of Noscapine on colorectal cancer stem cells. They discovered that Noscapine greatly reduced the vitality and sphere-forming abilities of these cells, indicating its potential for targeting cancer stem cells, which are frequently resistant to conventional therapies. ²⁸

Recent research has investigated the interaction of Noscapine with other medicines to improve its anticancer efficacy. For example, studies when coupled with docetaxel, especially the N-3-Br-benzyl-noscapine derivative, boosted anti-cancer activities in drug-resistant xenografts. ²⁹ The noscapine-gemcitabine combination showed synergistic effectiveness against non-small-cell lung cancer, resulting in enhanced apoptosis and reduced tumor volume. ³⁰ In ovarian cancer treatment, noscapine improved cisplatin sensitivity in resistant cells. Combining 2.5 µM noscapine and varied cisplatin concentrations significantly reduced cell proliferation and tumor growth. ³¹ When combined with doxorubicin (30 µM noscapine and 0.4 µg/mL doxorubicin), the combination enhanced pro-apoptotic protein expression while decreased anti-apoptotic and angiogenic factors, resulting in superior results compared to individual drug treatments across multiple cancer types. ²⁰ Furthermore, the development of nanocarrier systems for Noscapine has expanded drug delivery strategies, demonstrating increased bioavailability and targeted distribution of the chemical, hence enhancing its efficacy in cancer models. This method has shown potential in overcoming medication resistance and could be used to various tumors, including oral cancer, to improve treatment outcomes. ⁹

In the scratch wound healing assay, noscapine significantly inhibited cell migration. The suppression of cell migration is crucial in regard to cancer metastasis, as it indicates that noscapine may be able to prevent cancer cells from spreading to different parts of the body. In the earlier research, the therapeutic potential of noscapine in bladder cancer, demonstrating that it induces reactive oxygen species (ROS)-mediated apoptosis and G2/M phase cell cycle arrest via the PI3 K/Akt/FoxO3a signaling pathway. And also, Noscapine was shown to effectively inhibit cell proliferation, invasiveness, and migration while promoting apoptosis and mitochondrial membrane depolarization. These findings support noscapine as a promising therapeutic agent in bladder cancer treatment. ²⁵ In this study, to elucidate the molecular mechanism of noscapine in the migration and metastasis of osteosarcoma cancer cells, we employed molecular docking to simulate its interactions with key CXCL-8/CXCR2 signaling molecules, including CXCL-8, CXCR-2, SDF1, and CXCL-4. The molecular docking analysis reveals Noscapine's significant therapeutic potential through its stable and specific interactions with key chemokines and receptors, including CXCR-2, CXCL-8, CXCL-4, and SDF1. Among these, Noscapine exhibited the strongest binding affinity for CXCR-2 (−6.37 kJ/mol), supported by multiple hydrogen bonds and hydrophobic interactions, particularly with residues like LEU192, CYS233, and VAL320. This strong interaction suggests Noscapine's capability to modulate CXCR-2 activity, which plays a pivotal role in inflammation and tumor progression. Similarly, Noscapine's binding with CXCL-8 (−6.12 kJ/mol) and CXCL-4 (−5.63 kJ/mol) highlights its potential to inhibit angiogenesis and cancer metastasis, with stable interactions mediated by key hydrogen bonds and hydrophobic forces. The interaction with SDF1 (−5.5 kJ/mol) further suggests Noscapine's role in disrupting chemotaxis and tumor invasion pathways. Visualization of these interactions through 2D and 3D representations underscores the structural compatibility and stability of Noscapine within the active sites of these targets. These findings collectively position Noscapine as a promising candidate for targeting chemokine-mediated pathways, offering potential therapeutic applications in cancer and inflammatory diseases.

Recent research on formulations and derivatives of noscapine has deepened our knowledge of its molecular interactions and pharmacological potential. The binding properties of a noscapine-based ionic liquid with human hemoglobin, for instance, were reported by Thakur et al Using both biophysical and computational methods, they revealed stable non-covalent interactions and conformational changes, indicating improved drug–protein compatibility and bioavailability potential. ³² Similar to this, Nayak et al showed how a triflate-based noscapine ionic liquid interacted with BSA, exhibiting high-affinity binding and protein structural rearrangement that supports the positive pharmacokinetic behavior of noscapine. ³³ Chaudhary et al also synthesized new 1,3-benzodioxole-tagged noscapine ionic liquids and verified their cytotoxicity on HeLa cells using in vitro and in silico tests, suggesting that they have higher anticancer activity than native noscapine. ³² These complementary results underline the therapeutic potential of noscapine and imply that deliberate structural changes may improve its stability and effectiveness even more, opening the door for its application in sophisticated formulations and combination treatments that target chemokine-driven pathways in oral cancer.

CXCL-8 and its receptor CXCR2 were chosen as the study's main molecular targets due to their proven functions in oral cancer, specifically in promoting angiogenesis, tumor growth, and metastasis. Interleukin-8, also named for CXCL-8, is a pro-inflammatory chemokine that promotes endothelial cell migration and proliferation through CXCR2, which promotes tumor invasiveness and neovascularization. It has been shown that overexpression of CXCL-8/CXCR2 signaling components is associated with poor prognosis and disease progression in a number of cancers, including oral squamous cell carcinoma (OSCC). ³⁴ According to earlier research, this chemokine axis is a crucial modulator of the tumor microenvironment that promotes immune evasion and increases the potential of metastasis. As a result, targeting CXCL-8/CXCR2 is thought to be a viable treatment strategy, as evidenced by multiple preclinical models showing decreased tumor burden and metastasis upon inhibition. ³⁵

Notably, our study found that Noscapine had a considerable impact on critical chemokine signaling pathways. Noscapine administration significantly reduced CXCL8 mRNA expression and CXCR2 expression in treated cells. In addition, we found a decrease in SDF-1 (CXCL12) and CXCR4 mRNA expression. These findings are especially notable because these chemokines promote tumor growth, angiogenesis, and metastasis in a variety of malignancies, including oral cancer. ³⁶ Noscapine's downregulation of CXCL-8/CXCR2 and SDF-1/CXCR4 signaling may explain its observed anti-metastatic effects. CXCL8 stimulates endothelial cell proliferation and migration through CXCR2 and CXCR1, ³⁷ while the SDF-1/CXCR4 axis is important for tumor cell metastatic growth and invasion. ³⁸ Noscapine's comprehensive strategy to fight oral cancer, which targets not only cell proliferation and survival but also metastatic processes via modulation of major chemokine signaling pathways, makes it a good option for further study. While these findings are encouraging, additional in vivo investigations and clinical trials are required to fully understand Noscapine's mechanisms of action and potential as a therapeutic agent for oral cancer treatment. Future research could look into potential synergies between Noscapine and existing cancer therapies, perhaps leading to new combination therapies targeting the CXCL-8/CXCR2 and SDF-1/CXCR4 axes in oral cancer. Furthermore, studying Noscapine's impact on additional chemokine pathways, as well as its possible immunomodulatory capabilities, could help us gain a better understanding of its anticancer potential. Its efficacy in many cancer models provides compelling evidence for further research in oral cancer, which could lead to new therapeutic techniques that enhance patient outcomes.

Though the results are currently restricted to in vitro observations, this work offers encouraging evidence for the anticancer activity of noscapine in oral cancer through suppression of the CXCL-8/CXCR2 signaling pathway. To assess Noscapine's pharmacokinetics, tumor targeting effectiveness, and systemic safety in a setting more physiologically relevant to the body, more validation through in vivo research is necessary. Furthermore, Noscapine's therapeutic potential might be increased if it were combined with targeted delivery systems like nanoparticles or with traditional chemotherapy drugs like doxorubicin or cisplatin. Such combinatorial approaches should be investigated in future studies in order to improve therapy specificity and overcome medication resistance. Mechanistic research, dose optimization, toxicity profiling, and other thorough preclinical assessments are required for clinical translation. These actions will promote Noscapine's advancement toward clinical trials and demonstrate its viability as a stand-alone or adjunct therapy in the treatment of oral cancer.

Conclusion

This study highlights the potential of Noscapine as a targeted therapeutic agent against oral cancer metastasis. By inhibiting the CXCL-8/CXCR2 chemokine signaling pathway, Noscapine significantly reduced cancer cell proliferation, migration, and viability while promoting apoptosis. Our results show that Noscapine has a therapeutic safety profile by selectively inducing apoptosis in cancer cells while sparing healthy cells. The findings reveal Noscapine's dual action of interfering with metastatic signaling and inducing pro-apoptotic mechanisms, providing a comprehensive approach to combating oral cancer progression. Moreover, gene expression and molecular docking experiments validated Noscapine's robust interaction with chemokines like CXCR-2, CXCL-8, and SDF1, highlighting its capacity to interfere with a variety of metastasis-related pathways. These results not only affirm the efficacy of Noscapine as a non-toxic, naturally derived compound but also underscore its relevance in addressing the unmet needs in oral cancer therapy, especially for metastatic cases. Our research offers novel insights on the molecular function of noscapine in modulating chemokine signaling, which may make it a viable therapeutic approach. Future research should focus on in vivo validation and clinical trials to translate these findings into practice, potentially establishing Noscapine as a cornerstone in targeted cancer treatment.