Jiedu Huayu Extract Alleviate Acute Liver Failure via Promotion of GPX4 Expression and Inhibition of D-GalN/LPS-Induced Ferroptosis

Abstract

Objective

This study aims to explore the potential mechanisms of Jiedu Huayu granules (JDHY) mitigate D-galactosamine (D-GalN) and lipopolysaccharide (LPS)-induced acute liver failure (ALF) in a cell damage model.

Methods

ALF was modeled using various concentrations of D-GalN + LPS. JDHY-medicated serum at different concentrations was then co-cultured with the cell model in proportion. The best concentration and time of JDHY-medicated serum intervention were determined by Cell Counting Kit-8, Alanine Aminotransferase (ALT), and Aspartate Aminotransferase (AST). Western blot was used to assess the expression of Ferritin Heavy Chain 1 (FTH1), Transferrin Receptor 1(TfR1), Glutathione Peroxidase 4 (GPX4), Lysyl Oxidase (LOX), Prostaglandin-Endoperoxide Synthase 2(PTGS2). Malondialdehyde was analyzed for cell lipid peroxidation, and enzyme-linked immunosorbent assay was used to detect glutathione, Tumor Necrosis Factor-alpha, Interleukin-10, Interleukin-6 expression, and liver function indicators (ALT, AST). Additionally, GPX4 was knocked down using cell transfection, and the molecular mechanisms of JDHY in treating ALF were explored through Western blot, PCR, and enzyme-linked immunosorbent assay.

Results

The appropriate dose and time of D-GalN/LPS-induced ALF (10 mg/mL D-GalN + 1 μg/mL LPS for 48 h) and the optimal intervention concentration of JDHY-medicated serum (15%) were determined through ALT, AST, and Cell Counting Kit-8 assays. JDHY treatment reduced ALT and AST levels, alleviated cell lipid peroxidation, and inhibited ferroptosis. The mechanism involves JDHY enhancing the antioxidant capacity in liver cells by increasing the expression of GPX4 and glutathione, regulating ferroptosis proteins (downregulating TfR1, upregulating FTH1), inhibiting LOX and PTGS2, and suppressing inflammation (downregulating Tumor Necrosis Factor-alpha and Interleukin-6, upregulating Interleukin-10). In addition, GPX4 knockdown experiments revealed that knocking down GPX4 worsened ALF, while JDHY can alleviate ALF by promoting GPX4 expression and enhancing the antioxidant capacity of liver cells.

Conclusion

JDHY enhance GPX4 expression and reduce lipid peroxidation in liver cells affected by ALF, protecting liver cell, alleviating inflammatory, and inhibiting ferroptosis.

Introduction

Acute liver failure (ALF) is a severe and life-threatening syndrome characterized by rapid progression, hepatocyte necrosis, and hepatic dysfunction. ¹ Despite advancements in intensive care and the effective use of Emergency Liver Transplantation (ELT), ALF remains associated with a high mortality rate. ² Systemic inflammation plays a key role in liver injury, heavily influencing the clinical outcome and prognosis of ALF.^3,4 Recent studies have proposed the “Triple Strike theory,” which suggests that after direct damage to liver cells from viruses, toxins, pathogens, etc, a “cytokine storm” is triggered by endotoxins originating from the gut. This storm drives an excessive, prolonged, and uncontrollable inflammatory response. ⁵

In 2012, ferroptosis was identified as a form of non-apoptotic cell death characterized by iron-dependent lipid peroxidation. Research has shown that ferroptosis is widely involved in acute and chronic liver injury. When ferroptotic cells rupture, they release damage-associated molecular patterns, which disrupt the regulation of inflammatory cytokine and activate the innate immune system. ⁶ Glutathione (GSH), the main substrate for Glutathione Peroxidase 4 (GPX4), is considered a key inhibitor of ferroptosis. ⁷ The relationship between the lysyl oxidase (LOX) and prostaglandin-endoperoxide synthase (PTGS) systems and lipid peroxidation has been known for some time. However, recent studies have found that LOX/PTGS pathway can lead to iron overload via peroxide activity, causing cell death by releasing pro-inflammatory mediators. ⁶ Since the GSH/GPX4 pathway regulates cellular lipid peroxides, it indirectly controls the LOX/PTGS axis. However, under certain conditions, pro-inflammatory cytokines secreted by the LOX/PTGS axis can, in turn, destabilize the GSH/GPX4 system. ⁸

Jiedu Huayu granules (JDHY) are a clinical formula derived from a modification of Yin Chen Tang from the famous Chinese classic “Shang Han Lun”. The main ingredients include 30 g of Artemisia capillaris, 30 g of Hedyotis diffusa, 50 g of Paeonia lactiflora, 15 g of Rheum officinale, 15 g of Radix curcumae, and 15 g of Acorus tatarinowii. JDHY have been used for over 20 years to treat liver failure. Previous animal studies have shown that these granules can reduce inflammatory factor expression, decrease liver damage, and promote liver cell regeneration. ⁹ In addition, JDHY can reduce mitochondrial oxidative stress by upregulating the levels of superoxide dismutase (SOD) and downregulating malondialdehyde (MDA) levels. ¹⁰ JDHY also significantly decrease the opening of the mitochondrial permeability transition pore (MPTP) and the expression of bcl-2 mRNA and protein, indicating that they may be an effective anti-inflammatory and antioxidant therapeutic agent. ¹¹ Therefore, this study aims to further explore the relationship between ALF and ferroptosis, while also exploring the mechanism by which JDHY treat ALF, building on previous research and incorporating the latest developments.

Materials and Method

Animals and Cells

C57BL/6J mice, aged 2-3 months, were purchased from Guangxi Medical University. Ten mice were selected, and primary liver cells were isolated using a two-step perfusion method. ¹² After isolating liver cells, they were placed in 25 cm² culture flasks. Each flask received 5 mL of DMEM medium containing 10% fetal bovine serum, and the cells were cultured in a cell incubator set to 37 °C with 5% CO₂ (SHEL LAB, SCO6WE). After the cells fuzed to about 80%, they were passaged at a 1:3 ratio.

Medications

D-GalN and LPS were purchased from Tianjin Chemical Co., Ltd (Sigma, USA). Jiedu Huayu Granules are composed of Artemisia capillaris, Hedyotis diffusa, Paeonia lactiflora, Rhubarb, Curcuma, purchased from the Jiangyin Tianjiang Pharmaceutical Co., Ltd (China).

Reagents

Fetal bovine serum (Hangzhou Tianhang Biotechnology Co., Ltd,141215, China), pancreatic enzyme EDTA (Jinuo Biopharmaceutical Technology Co., Ltd, GNM25200, China), phosphorylation protease inhibitor (ASPEN, AS1008, USA), RIPA total protein lysis solution (ASPEN, AS1004, USA), BCA protein concentration determination kit (ASPEN, AS1086, USA), reduced glutathione determination kit (Nanjing Jiancheng, A006-2,China). CCK-8 detection kit (Biyun Tian Biotechnology Co., Ltd, C0038, China), Aminotransferase (ALT) test kit (Nanjing JianCheng, C009-2, China), Aminotransferase (AST) test kit (Nanjing Jiancheng, C010-2, China), MDA test kit (Nanjing JianCheng, C009-2, China), GSH test kit (Nanjing JianCheng, A006-2, China), SDS-PAGE gel preparation kit(ASPEN, AS1012, USA), RIPA Total Protein Lysate (ASPEN, AS1004, USA), BCA protein concentration assay kit (ASPEN, AS1086, USA), ECL chemiluminescence detection kit (ASPEN, AS1059, USA).

Establishing a C57BL/6J Mouse Liver Cell Injury Model

Liver cells in the exponential growth phase were seeded into a 96-well plate with 8000 cells per well, and placed in a culture incubator for 12 h. After incubation, serum-free culture medium (100 μL) was added to each well. The cells were starved for 12 h to synchronize the cell cycle. Subsequently, DMEM (100 μL; containing 10% fetal bovine serum (FBS)) was added to each well. After 24 h of cultivation, the old culture medium was discarded. D-galactosamine (D-GalN) and lipopolysaccharide (LPS) were prepared in working solutions at different concentrations (D-GalN 0, 1, 5, 10, 20 mg/mL with 1 μg/mL LPS), with five replicates for each concentration. After co-culturing D-GalN and LPS with liver cells for 12, 24, and 48 h, the cells were washed twice with PBS. Then 10% Cell Counting Kit-8 (CCK8) working solution was added to each well and incubated for 2 h. Using 50% liver cell death as the expected target value, the most suitable modeling concentration for D-GalN combined with LPS in liver cell injury models was selected. ¹³

Preparation of JDHY-Containing Medicinal Serum

C57BL/6J mice were randomly divided into a blank group and a JDHY intervention group, with 10 mice in each group. The dosage of the traditional Chinese medicine (TCM) was set at 57.55 g/kg/day.^10,11 The JDHY group received the medicine via gavage at a dose of 2 mL per 100 g of body weight. The blank control group received normal saline at a dose of 2 mL per100 g of body weight. Two hours after the final gavage, the mice were anesthetized, and blood was collected from the abdominal aorta. The collected blood was centrifuged at 3000 rpm at 4 °C for 30 min, followed by heat inactivation at 56 °C for 30 min and storage at −80 °C for future use.

Determine the Optimal Intervention Concentration of JDHY Drug Containing Serum

Liver cells in the exponential growth phase were digested with trypsin and adjusted to a concentration of 4 × 10⁵ cells/mL before being seeded in a 96-well plate. After 12 h of cultivation in DMEM medium containing 10% FBS, the old medium was aspirated, and serum-free DMEM medium was added for another 12 h to synchronize the cell cycle. Following this, the ALF liver cell injury model was established using D-GalN and LPS at the optimal concentration determined based on the results of section 2.4. Simultaneously, different concentrations of JDHY -medicated serum were set up for intervention (concentration gradients: 2.5%, 5%, 10%, 15%, 20%). Each concentration gradient had 5 replicate wells. After co-treatment of liver cells with D-GalN + LPS working solution and JDHY -medicated serum for 12, 24, and 48 h, cell viability was assessed using the CCK8 assay. Additionally, alanine ALT and aspartate AST levels were measured to evaluate liver function and determine the optimal dosage concentration of JDHY-medicated serum for the cell intervention experiment.

CCK8 Assay

The logarithmic growth phase cells were digested with trypsin and adjusted to a concentration of 1 × 10⁵ cells/mL. They were seeded at a density of 1 × 10⁴ cells per well in a 96-well plate and incubated until cells adhered to the wall. The culture medium for each group was replaced with 100 μL of serum-free basal medium containing 1% bovine serum albumin for 12 h of starvation treatment. Subsequently, the culture medium was replaced with 100 μL of cell sample-specific medium containing a certain concentration of drugs for each group, while the control group received medium with only the solvent. Blank wells (containing only medium, without cells) were also included. The cells were cultured for an appropriate period. Then, CCK-8 solution (10 μL) was added to each well, and the plate was incubated in the cell culture incubator for 1 to 4 h. The absorbance at 450 nm was measured using an enzyme marker, and the cell viability was calculated using the following formula: Proliferation rate (%) = (Experimental group − Blank) / (Control group − Blank) × 100%.

Enzyme-Linked Immunosorbent Assay (ELISA)

After collecting the specimens, they were centrifuged at 2000 g for 10 min at 4 °C to remove insoluble material. The supernatant was collected and stored at −20 °C or lower temperatures for later use. Further procedures followed the instructions of biochemical, ELISA, and related reagent kits.

Western Blot (WB) Analysis

After the intervention with different groups, the old medium was discarded, and the cells were washed twice with PBS. Lysis buffer was added, and the cells were scraped after 10 min of lysis. The lysate was centrifuged, and the supernatant was collected for protein quantification. An appropriate amount of loading buffer was added, and the protein samples were denatured t at 100 °C for 10 min in a metal bath. A 10% separating gel and concentrating gel were prepared. Each sample (20 μg of protein) was loaded for electrophoresis under conditions of 90 V for 30 min and 120 V for 60 min. After electrophoresis, the proteins were transferred onto a membrane at 300 mA for 60 min. The target protein and internal reference bands were cut from the membrane after transfer and blocked with 5% skim milk for 1 h. The membrane was then washed with Tris-Buffered Saline with Tween 20 (TBST) 3 times for 10 min each. Primary antibody incubation was performed overnight at 4 °C. After 1-h room temperature incubation, the membrane was washed with TBST 3 times for 10 min each. It was then incubated with secondary antibody for 1 h, followed by another 3 washes for 10 min each. ECL luminous liquid was prepared for protein band exposure.

GPX4 Cell Transfection

The day before transfection, seed 5 × 10⁵ cells per well in a 6-well plate in 2 mL of antibiotic-free medium. Ensure cell confluency is 60%-70% at the time of transfection. Dilute siRNA to the desired concentration (final concentration 50 nM) using 250 μL of Opti-MEM serum-free medium per well, gently mix, and incubate at room temperature for 5 min. Gently mix Lipofectamine 2000 before use, take 5 μL of Lipofectamine 2000, dilute in 250 μL of Opti-MEM serum-free medium, and incubate at room temperature for 5 min. Mix the diluted siRNA and Lipofectamine 2000 from the previous steps (total volume 500 μL), gently mix, and let it sit at room temperature for 20 min. Add 500 μL of transfection mixture and 1500 μL of basic culture medium to each well, gently mix. Incubate in a 37 °C CO₂ incubator, change to complete culture medium after 6 h of transfection. Perform siRNA silencing efficiency detection 48 h after transfection, determine the optimal transfection of GPX4-siRNA using Western Blot.

PCR Analysis

Total RNA was extracted from cells, and reverse transcription was performed to convert total RNA into cDNA. A Real-Time PCR reaction was prepared, and the reaction conditions were set accordingly. The housekeeping gene β-actin was quantified simultaneously as a control during the experiment. Amplification reactions were carried out using a fluorescence quantitative PCR instrument, and the fluorescence signal values of each sample were recorded in real-time using the software of instrument. The relative expression levels of the target gene were calculated using the 2^−ΔΔCT method.

Statistical Analysis

Statistical methods were performed using SPSS version 22.0. Measurement data were expressed as mean ± standard deviation. One-way ANOVA was used for analysis when variances were homogeneous, and paired sample t-tests were used for inter-group comparisons. When variances were not homogeneous, the Mann-Whitney U test was applied. P value of <.05 was considered statistically significant.

Results

Optimal Concentration for Constructing ALF Hepatocyte Injury Model with D-GalN + LPS

D-GalN and LPS are classic compounds used to induce liver failure models. To determine the specific concentrations of D-GalN/LPS that induce cell damage in ALF liver cells, we used CCK8 assays to assess the impact of different concentrations of D-GalN/LPS on liver cell viability. A fixed concentration of LPS (1 μg/mL) was used to induce liver cell damage. ¹⁴ When cells were incubated with D-GalN at concentrations of 5-20 mg/mL for 12-48 h, D-GalN exhibited significantly cytotoxicity in a dose- and time-dependent manner. Cell viability rates were 46.8%, 58.7%, and 67.5% after 48 h of co-culture with 5 mg/mL, 10 mg/mL, and 15 mg/mL D-GalN, respectively. In line with our objective, we designated 10 mg/mL D-GalN combined with 1 μg/mL LPS as the optimal concentration for inducing liver cell damage, resulting in over 50% cell mortality, thereby establishing the ALF model group (Figure 1A-B).

Figure 1.

Establishing ALF hepatocyte model and optimal intervention concentration of JDHY-containing serum. (A-B) Bar charts and curves of ALF liver cell injury models constructed with different concentrations of D-GalN/LPS. Based on the expected target value of 50% liver cell mortality rate, 10 mg/mL D-GalN + 1 μg/mL LPS was selected as the modeling concentration for ALF liver cell models. (C-D) Co-cultured JDHY-containing serum at different concentrations (2.5%, 5%, 10%, 15%, 20%) with established ALF liver cell models for 12, 24, and 48 h. Cell viability was performed cell viability detection using CCK8. (E-G) ALT levels measured at 12, 24, and 48 h. (H-J) AST levels performed at 12, 24, and 48 h. (K-L) MDA peroxidation detection measured at 12, 24, and 48 h. • represents co culture for 12 h, # represents co culture for 24 h, ⧫ represents co culture for 48 h, P < .05 compared to the model group, * represents inter group comparison P < .05, ** represents P < .01, ** represents P < .001, *** represents P < .0001.

Optimal Dose and Time Window of JDHY-Containing Serum Intervention for D-GalN + LPS-Induced ALF

To evaluate the hepatocyte injury induced by D-GalN/LPS and the potential protective effects of JDHY-containing serum, we used CCK8 assay to examine the impact of different concentrations of JDHY-containing serum on the cell viability in an ALF hepatocyte model induced by 10 mg/mL D-GalN + 1 μg/mL LPS. We tested different concentration gradients of JDHY-containing serum (2.5%, 5%, 10%, 15%, 20%) and compared them with a Control group (hepatocytes + blank serum) and a model group (hepatocytes + 10 mg/mL D-GalN + 1 μg/mL LPS). Results showed that all concentration of JDHY-containing serum enhanced liver cell proliferation in a dose-dependent manner. Among them, 10% JDHY serum significantly increased in relative proliferation rates at 24 and 48 h compared to the model group (P < .05). Similarly, 20% JDHY serum at 48 h also significantly increased compared to the model group (P < .05). The best treatment effect was observed with 15% JDHY serum, with relative proliferation rates of 79.0%, 72.7%, and 67.8% at 12, 24, and 48 h, respectively, demonstrating significantly differences compared to the model group (P < .05) (Figure 1C-D). To further confirm the optimal concentration of JDHY-containing serum for therapeutic efficacy, we evaluated the liver function by measuring ALT and AST levels in ALF hepatocytes induced by D-GalN and LPS at various time points after treatment with JDHY-containing serum. The results indicated that different concentrations of JDHY-containing serum improved ALF conditions. Specifically, the 10% JDHY serum significantly decreased in ALT and AST levels compared to the model group at 12, 24, and 48 h (P < .05). The 20% JDHY serum group also significantly decreased in ALT and AST levels at 48 h (P < .05). In the group treated with 15% JDHY serum, the ALT and AST levels at 24 and 48 h significantly decreased compared to the model group (P < .05), with the most pronounced effects observed (Figure 1E-J). This suggests that JDHY-containing serum can inhibit liver function damage induced by D-GalN/LPS in ALF. Based on these results, and to align with the cultivation time of ALF hepatocytes (D-GalN/LPS), we selected 15% JDHY serum and a treatment duration of 48 h as the optimal concentration and treatment period for subsequent experiments.

JDHY-Containing Serum Inhibits D-GalN + LPS-Induced ALF Ferroptosis and Lipid Peroxidation

To determine whether the effects of JDHY on ALF are related to ferroptosis, we measured the expression of MDA, GSH, GPX4, Ferritin Heavy Chain 1 (FTH1), and Transferrin Receptor 1 (TFR1), which are closely associated with the ferroptosis. The experiment consisted of three groups: (1) Control group (normal liver cells + blank serum), (2) JDHY group (D-GalN + LPS working solution + 15% JDHY serum), and (3) Model group (D-GalN + LPS working solution + blank serum), co-cultured for 48 h. The results showed that, compared to the ALF model group, MDA levels were significantly reduced after JDHY treatment (P < .05, Figure 1K-L), indicating that JDHY improved the lipid peroxidation levels in ALF liver cells. Furthermore, WB and ELISA results indicated that the GSH and GPX4 levels were significantly lower in the ALF model group but significantly increased after JDHY treatment (P < .05, Figure 2A-C). Additionally, JDHY treatment led to an increase in FTH1 levels and a decrease in TFR1 levels, demonstrating a significantly difference compared to the model group (P < .05, Figure 2D-F). FTH1 helps convert free Fe²⁺ within the cell into stable Fe³⁺ for storage, while TFR1 promotes cellular uptake of Fe²⁺, contributing to iron overload. These results suggest that JDHY promotes the expression of GSH/GPX4, thereby inhibiting ferroptosis in ALF liver cells.

Figure 2.

JDHY-containing serum inhibits ferroptosis induced ALF by D-GalN + LPS. (A-B) WB analysis of GPX4 protein expression. (C) Detection of GSH expression using a reagent kit. Compared with the model group, the JDHY-containing serum group showed significantly differences in GPX4 and GSH (P < .05). (D-F) WB analysis of FTH1 and TFR1 protein expression. Compared with the model group, there was a significantly difference in the increase of FTH1 and the decrease of TFR1 in the JDHY-containing serum group (P < .05).

JDHY-Containing Serum may Suppress Ferroptosis and Inflammatory Response of ALF Hepatocytes Induced by LOX/PTGS Through Regulating GSH/GPX4 Signaling Pathway

Our previous research has indicated that the mechanism by which JDHY treats ALF is related to its ability to alleviate immune inflammation.^10,11 To gain a comprehensive understanding of the targets and intervention mechanisms of JDHY in ferroptosis, we integrated the latest research findings, which showed that the LOX/PTGS signaling pathway is closely associated with ferroptosis and inflammatory responses. This pathway is, to some extent, regulated by the antioxidant activity of GPX4, which is linked to the development of ALF ⁸ (Figure 3A).

Figure 3.

JDHY-containing serum may inhibit iron deposition and inflammatory response induced by LOX/PTGS in ALF liver cells by regulating the GSH/GPX4 signaling pathway. (A) Mechanism diagram of GPX4 signaling inhibition of iron deposition and inflammatory response induced by LOX/PTCS. (B-D) WB detection of LOX and PTGS protein expression. (E-G) ELISA detects the expression of TNF-α, IL-6, and IL-10 inflammatory factors. P < .05 indicates a significantly statistical difference between the model group and the JDHY group.

Subsequently, we performed WB analysis to detect the protein expression of the LOX/PTGS signaling pathway and used ELISA to measure the levels of related inflammatory factors, such as Tumor Necrosis Factor-alpha (TNF-α), Interleukin-6 (IL-6), and Interleukin-10 (IL-10). The results showed that the expression levels of LOX and PTGS proteins (Figure 3B-D), as well as the inflammatory factors TNF-α and IL-6, were elevated in the model group, while IL-10 levels decreased (Figure 3E-G). This suggests that the LOX/PTGS signaling pathway may initiate an inflammatory response in ALF. Following JDHY intervention, the levels of LOX/PTGS, TNF-α, and IL-6 were reduced, while IL-10 levels increased, with a significantly difference compared to the model group (P < .05). These findings suggest that JDHY may alleviate the expression activity of LOX/PTGS and inhibit the subsequent expression of inflammatory factors by promoting the production of GSH/GPX4.

JDHY Enhance Therapeutic Effect on ALF by Upregulating GPX4

Cell Transfection

Based on the above results, the mechanism by which JDHY intervenes in ALF ferroptosis and inflammatory response may be closely related to GPX4 expression. To further elucidate the relationship between JDHY and GPX4, we conducted cell transfection experiments using GPX4-siRNA. Three types of GPX4-siRNA were included in the experiment for screening, with the following groups: (1) Control group, (2) NC-siRNA group, (3) GPX4-siRNA-1 group, (4) GPX4-siRNA-2 group, and (5) GPX4-siRNA-3 group. After transfection, the silencing effect of siRNA was assessed 48 h later, and WB was used to determine the optimal transfection GPX4-siRNA (Figure 4A-B).

Figure 4.

JDHY exerts therapeutic effects on ALF by enhancing GPX4 overexpression. (A-B) Transfection efficiency of GPX4 siRNA detected by WB, with GPX4-siRNA-1 showing the best effect (specific gene sequences refer to Table 1). (C) Cell proliferation rate detected by CCK8. (D-E) Kit detects ALT and AST. (F-H) WB and qPCR detect GPX4 protein expression. (I) Detection of GSH expression using the reagent kit. (J) MDA detection of cell peroxidation expression. (K-M) WB detection of POR and SLC7A11 protein expression. P < .05 indicates a significantly statistical difference between the model group and the JDHY group.

Table 1.

Primer Sequence and Types.

Primers	Species	Sequence（5`-3`）
GPX4-siRNA-1	NM_008162_stealth_219	GGCACATGGTCTGCCTGGATAAGTA
GPX4-siRNA-2	NM_008162_stealth_432	GCTACAACGTCAAGTTTGACATGTA
GPX4-siRNA-3	NM_008162_stealth_555	GGAACTTTACCAAGTTTCTCATTGA
NC	NC	GCTTCAAGTGACACAACGTTATGTA

JDHY Can Exert Therapeutic Effects on ALF by Promoting GPX4 Production

After determining the optimal GPX4 siRNA, liver cells were divided into five groups: (a) Control group, (b) D-GalN + LPS group, (c) D-GalN + LPS + JDHY serum group, (d) D-GalN + LPS + si-GPX4 group, and (e) D-GalN + LPS + JDHY serum + si-GPX4 group. Results from the CCK8 assay and biochemical tests (ALT, AST) indicated that compared to the model group (b), JDHY increased the cell proliferation (P < .05, Figure 4C) and decreased ALT and AST levels (P < .05, Figure 4D-E), suggesting a protective effect on the liver cell. However, in the D-GalN + LPS + si-GPX4 group (d), the cell proliferation rate significantly decreased, and ALT and AST levels significantly increased compared to the model group (b) (P < .05). Similar effect was observed when comparing groups (c) and (e), indicating that the knockout of GPX4 exacerbated liver toxicity in ALF and that liver protection effect of JDHY is closely related to GPX4 expression (Figure 4C-E). To further validate our hypothesis, WB and PCR analyses were conducted to assess GPX4 expression across groups. The results demonstrated that compared to the D-GalN + LPS + si-GPX4 group (d), the D-GalN + LPS + JDHY serum + si-GPX4 group (e) significantly promoted GPX4 expression (P < .05), although it could not reverse the silencing effect of si-GPX4 (Figure 4F-H). Additionally, MDA and GSH levels aligned with the WB/PCR results, showing that the D-GalN + LPS + JDHY serum + si-GPX4 group (e) had significantly higher GSH levels and lower MDA levels compared to the D-GalN + LPS + si-GPX4 group (d) (P < .05, Figure 4I-J). This indicated that JDHY could promote GSH/GPX4 expression and improve liver cell oxidative responses, thereby exerting its liver protective effects.

To further confirm whether the promotion of GPX4 expression by JDHY is associated with other factors, we used WB to detect Peroxidase (POR) and Solute Carrier Family 7 Member 11 (SLC7A11), as both are related to the generation of GPX4 and the occurrence of ferroptosis. The WB results showed that compared to the D-GalN + LPS group (b), the D-GalN + LPS + JDHY group (c) exhibited a significantly reduction in POR expression and an increase in SLC7A11 expression (P < .05). Furthermore, the D-GalN + LPS + JDHY + si-GPX4 group (e) showed a significantly reduction in POR compared to the D-GalN + LPS + si-GPX4 group (d) (P < .05, Figure 4K-M). These findings suggest that JDHY can enhance cell antioxidant capacity by promoting GPX4 expression, thereby reducing the lipid peroxidation and inhibiting ferroptosis. Additionally, the mechanism by which JDHY enhances antioxidant capacity may be multifaceted, as changes in POR and SLC7A11 expression were observed after siGPX4 treatment.

Discussion

In summary, this experiment demonstrates that JDHY-containing serum can alleviate liver toxicity induced by D-GalN/LPS by inhibiting hepatocyte ferroptosis, lipid peroxidation, and inflammatory response associated with D-GalN/LPS-induced ALF. The mechanism may involve independent promotion of GSH/GPX4 expression by JDHY, enhancing cellular antioxidant capacity and thereby suppressing LOX/PTGS signaling and the subsequent inflammatory response. The D-GalN/LPS co-induction of ALF in mice is a widely accepted global model for studying ALF. However, discrepancies exist regarding the dosages of D-GalN/LPS used for in vitro ALF models. This experiment followed the internationally recognized method of inducing hepatocyte damage with 1 μg/mL LPS and screened for the optimal concentrations of fixed ALF: LPS (1 μg/mL) + D-GalN (5-20 mg/mL) for ALF modeling. Using the CCK8 assay, we determined that the appropriate concentration for the D-GalN/LPS-induced ALF hepatotoxicity model was 10 mg/mL D-GalN combined with 1 μg/mL LPS. For over two decades, controversy has surrounded the hepatotoxicity of TCM or its extracts. ¹⁵ However, various herbs and their extracts, including medicated serum used as adjunct therapy, have been shown to exhibit synergistic effects and safety. ¹⁶ The benefits and risks of TCM depend on dosage and duration, and standardized studies can effectively help mitigate adverse side effects. ¹⁶ JDHY met TCM quality standards and active ingredient analysis criteria in 2014.^10,17 In this experiment, D-GalN/LPS-induced ALF hepatocytes were co-cultured with five different concentrations of JDHY (2.5%-20%) for 12, 24, and 48 h. Based on the ALT and AST values, as well as CCK8 assay results, the optimal JDHY intervention dosage was determined to be 15% for 48 h. During this process, JDHY effectively promoted hepatocyte proliferation and viability at different intervention times (12, 24, and 48 h), reducing ALT and AST levels in ALF hepatocytes, which demonstrates their protective effect on D-GalN/LPS-induced ALF.

In 2012, ferroptosis was introduced as a new form of cell death driven by free iron (Fe²⁺), resulting in iron overload, disrupted lipid metabolism, and GSH depletion. This process strictly regulates and interferes with cellular iron balance. The liver is the primary storage site for iron and controls iron homeostasis. Elevated iron levels in the liver may contribute to hepatocyte damage. ¹⁸ Additionally, GSH depletion inactivates antioxidant defenses, allowing lipid peroxides to accumulate and mediate ferroptosis. ¹⁹ GPX4, with the help of GSH, reduces toxic lipid hydroperoxides to lipid alcohols. ²⁰ Inactivation of GPX4 leads to the formation of toxic lipid free radicals, catalyzed by iron, which triggers inflammatory responses and cell death in liver failure. In previous experiments, it was found that JDHY intervention in mouse ALF was associated with the promotion of GSH expression and the inhibition of oxidative stress. ²¹ These findings are consistent with the results of this study, where JDHY inhibited MDA levels, increased FTH1 levels, and reduced TFR1 levels in vitro. This indicates that JDHY increase the conversion of Fe²⁺ to stable Fe³⁺ for storage via FTH1 and decrease the uptake of Fe²⁺ via TFR1. Furthermore, JDHY reversed the depletion of GSH/GPX4 in D-GalN/LPS-induced ALF, suggesting that JDHY can eliminate lipid peroxides by promoting GSH/GPX4 expression, thereby regulating ferroptosis-related proteins and preventing ferroptosis in ALF.

Furthermore, PTGS and LOX are enzymes derived from arachidonic acid that produce prostaglandins, leukotrienes, and other compounds, triggering immune inflammatory reactions. Since these enzymes require lipid peroxides for activation, overexpression of GPX4 decreases cellular lipid hydroperoxide levels, effectively deactivating PTGS and LOX, ultimately inhibiting prostaglandin synthesis. ²² Moreover, the activity of LOX and PTGS is regulated by intracellular lipid peroxide levels. The antioxidant enzyme GPX4 alleviates inflammatory responses by eliminating oxidants produced during metabolism and reducing the activity of LOX and PTGS during the ferroptosis process.^8,23 GPX4 alleviates inflammatory responses, such as the production of TNF-α and interleukins by eliminating oxidants produced during arachidonic acid metabolism and regulating the activity of LOX and PTGS during ferroptosis. High levels of peroxides can activate TNF-α, ²⁴ and GPX4 reduces TNF-α production, thereby weakening inflammatory responses and inhibiting the expression of inflammatory cytokines. ²⁵ In this study, JDHY were shown to reduce LOX/PTGS activity in vitro, inhibit the inflammatory factors TNF-α and IL-6, and increase IL-10 expression. Based on the above research results, we speculate that JDHY promote GPX4 (GSH) expression, enhance liver cell antioxidant activity, and reduce lipid peroxidation in ALF, thereby inhibiting the LOX/PTGS pathway, suppressing ferroptosis, and mitigating inflammatory responses. To validate this hypothesis, we conducted si-GPX4 transfection experiments and found that GPX4 knockdown exacerbated liver damage and lipid peroxidation induced by D-GalN/LPS, while JDHY improve liver function and lipid peroxidation in ALF by promoting GPX4 expression. In addition, POR is involved in the electron transfer of the cytochrome P450 enzyme system by providing electrons to these enzymes, which in turn inhibits antioxidant activity of GPX4, leading to lipid peroxidation and iron toxicity. SLC7A11 is a key protein responsible for cystine-cysteine exchange transport in the system Xc^‐, regulating intracellular cysteine levels. This regulation affects intracellular GSH levels, thus influencing GPX4 activity and the redox balance within the cell. Our experiment showed that JDHY intervention can significantly reduce POR expression and increase SLC7A11 expression. This suggests that JDHY can inhibit ferroptosis in ALF by improving cell antioxidant capacity may be multifaceted.

In this study, we explored the direct effects of JDHY on D-GalN/LPS-induced ALF ferroptosis in vitro, but several limitations should be noted. For example, although the D-GalN/LPS-induced ALF hepatocyte injury model closely mirrors the mortality rates observed in clinical studies and animal models, making it more comparable, it cannot entirely replace the advantages of other ALF cell models (such as those induced by acetaminophen and thioacetamide). In terms of specific results, our experiment shows that JDHY have a certain hepatoprotective effect at a dosage of 15% after 48 h. However, no comparisons were made with positive control drugs, nor were relevant inhibitors (such as fer-1, N-acetylcysteine, or corticosteroids) used for verification, which may limit the persuasiveness of the findings. Overall, this study provides evidence for the therapeutic effects of JDHY on ALF by promoting GPX4 expression and identifies mechanisms by which JDHY alleviate ferroptosis and inhibit inflammation. Moreover, the effects of JDHY may be multifaceted. For instance, in terms of antioxidant action, JDHY not only promote the expression of GPX4/GSH but may also influence the expression of POR and SLC7A11, which aligns with the multi-target treatment characteristics of TCM formulations.