Macleaya cordata Extract Inhibits LPS-Induced IPEC-J2 Inflammation Through TLR4-Mediated NF-κB and MAPK Signaling Pathways

Abstract

Objectives: The Macleaya cordata has long been utilized as a traditional medicinal remedy for treating inflammation in certain countries, and it is also being considered as a potential alternative to antibiotic growth promoters in livestock breeding. However, the molecular mechanisms underlying its anti-inflammatory characteristics have not been thoroughly investigated. In this study, we assessed the anti-inflammatory effects of the Macleaya cordata extract (MCE) and elucidated the molecular mechanism in the porcine intestinal epithelial cell line J2 (IPEC-J2) stimulated by lipopolysaccharide (LPS). Methods: The IPEC-J2 cells were pretreated with various concentrations of MCE (50 ng/mL, 100 ng/mL, and 150 ng/mL) prior to stimulation with LPS to induce of inflammation. Subsequently, the secretion levels and mRNA expression of the inflammatory cytokines IL-6, TNF-α, IFN-γ, and IL-10 were assessed. The impact of MCE on the activation of nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways was investigated. Results: The results demonstrated that MCE significantly suppressed the production and mRNA expression levels of pro-inflammatory cytokines in LPS-induced IPEC-J2 cells, while promoting the expression of anti-inflammatory cytokines. Moreover, it down-regulated the phosphorylation of NF-κB (p65) and attenuated the expression of phosphorylated JNK, ERK, and p38 MAPKs in a concentration-dependent manner. Furthermore, MCE downregulated the expression of TLR4 and MyD88, which serve as crucial upstream signaling molecules. The findings of this study suggest that the anti-inflammatory effect of MCE is attributed to its ability to regulate inflammatory cytokines and mediators by inhibiting the TLR4-mediated NF-κB and MAPK signaling pathways. Conclusions: Therefore, MCE holds promise as a potential therapeutic and preventive agent for managing inflammatory reactions and diseases in livestock and poultry breeding, warranting further investigation.

Keywords

IPEC-J2 cells inflammation NF-κB MAPK TLR4

Introduction

The process of inflammation is recognized as a crucial component in various pathophysiological mechanisms during tissue damage and the defense of the host against invading microorganisms. Inflammation fulfills its physiological role by safeguarding hosts from pathogen invasion or tissue damage through a cascade of mechanisms that support cellular immunity and biological regulatory pathways.¹ The inflammatory response is commonly acknowledged as a self-regulating mechanism that sustains an ever-changing equilibrium between pro- and anti-inflammatory cues. An appropriate inflammatory response can provide protection against severe tissue damage in both humans and animals, while excessive inflammation poses potential risks to the host organisms.² Accordingly, the control of inflammatory responses is important to the host to avoid tissue damage and maintain the immune homeostasis.

The intestinal epithelium is responsible for the absorption of water and nutrients, as well as playing a crucial role in the defense against microbial invasion by inducing and modulating immune responses.³ The noncancerous porcine intestinal epithelial cell line J2 (IPEC-J2), derived from the jejunum, serves as a valuable in vitro alternative and suitable model for preliminary research.⁴ The IPEC-J2 model exhibits significant similarities to the native tissue, rendering it an ideal candidate for in vitro studies on intestinal function.⁵ Lipopolysaccharide (LPS) is an endotoxin generated by gram-negative bacteria and it can activate various host cells to respond to inflammation.⁶ The use of LPS in experiments is common for inducing inflammatory responses, as it possesses the capability to activate multiple signaling pathways and thereby induce immune disorders.⁷ The Toll-like receptors (TLRs) are innate immune system defense receptors encoded in the germline, and they play a pivotal role in initiating both the innate and adaptive arms of the immune response.^8,9 TLRs play a crucial role in the recognition of diverse pathogens, including bacteria, viruses, parasites, and fungi. Different TLRs recognize components of microorganisms, triggering intracellular signaling pathways and cytokine production by leukocytes and other cells essential for the elimination of pathogenic microorganisms.^10,11

LPS interacts with toll-like receptor 4 (TLR4), leading to the activation of diverse inflammatory pathways mediated by mitogen-activated protein kinases (MAPKs) and nuclear factor kappa B (NF-κB).¹² These pathways subsequently induce the expression of pro-inflammatory and anti-inflammatory mediators, such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), interleukin-6 (IL-6), interferon gamma (IFN-γ), among others.^13,14 The persistent elevation of inflammatory mediators can result in the impairment of intestinal signaling pathways, thereby facilitating pathogen invasion and the emergence of diseases.¹⁵ The suppression of the activation of these pivotal inflammatory mediators may potentially mitigate a range of inflammatory disorders.

The discovery and introduction of penicillin into clinical practice have subsequently led to the discovery of numerous new antibiotics, which serve as invaluable weapons against bacterial infections.¹⁶ The extensive utilization of antibiotics in livestock diets has significantly contributed to the enhancement of health and growth performance. However, the excessive use of antibiotics has resulted in bacterial resistance among both livestock animals and humans, as well as the presence of antibiotic residues in animal products, which may have implications for human health.^17,18 The advent of the antibiotic era coincided with the emergence and characterization of strains resistant to antibiotics, thereby ushering in our current post-antibiotic era characterized by a diminishing discovery rate of antibiotics alongside a high prevalence of multidrug-resistant (MDR) infections.¹⁹ The issue of antibiotic resistance is now recognized as a global public health concern. In recent years, various strategies have been recommended to combat antibiotic resistance. In this context, phytochemicals have demonstrated potent activities, leading many researchers to explore natural products as potential agents against bacterial resistance.^20-23 There is a growing trend towards exploring the biological activities of plant extracts, such as Macleaya cordata extract (MCE). Within the genus Macleaya, both Macleaya cordata and Macleaya microcarpa are predominantly found in China, North America, and Europe. These plants have long been recognized as traditional herbs with a rich history of medicinal usage.^24,25 Related research have shown that the main bioactive substances in Macleaya cordata are isoquinoline alkaloids, such as sanguinarine (SA), chelerythrine (CHE), protopine (PRO), allocryptopine (ALL), and berberine (BER), which possess antimicrobial, anti-inflammatory, antiviral, antitumor, antifungal, and pesticidal properties.^26-31 The anti-inflammatory properties of the compound found in Macleaya species have been demonstrated by several studies.^32-34 Nevertheless, the precise molecular mechanisms responsible for the anti-inflammatory effects of MCE have yet to be elucidated. Therefore, our objective was to investigate the effects and underlying mechanisms of MCE on its anti-inflammatory properties in LPS-stimulated IPEC-J2 cells.

Materials and Methods

Cell Culture

The IPEC-J2 cells were obtained from Beijing Beina Chuanglian Institute of Biotechnology (Beijing, China). These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin, both provided by Gibco (Grand Island, NY, USA). The MCE used in this study was extracted by our lab team in previous research, and the main components were SA and CHE. The monolayers were harvested after a 2-day incubation period and utilized in this experimental study. The experiment was categorized into the negative control group (CON), the LPS group (LPS), and the MCE groups (MCE). The negative control group was not treated with LPS or MCE, while the LPS group received treatment with LPS alone. The MCE groups were pretreated with varying concentrations of MCE before being treated with LPS.

Determination of Cell Viability

The cytotoxic effect of MCE was assessed by performing an MTT assay to determine cell viability. A total of 5 × 10⁴ IPEC-J2 cells were seeded and cultured in a 96-well plate. The cells were pre-treated with MCE at a final concentration of 50 ng/mL, 100 ng/mL, and 150 ng/mL for 4 hours each. Subsequently, the cells were incubated in culture medium containing LPS at a concentration of 1 μg/mL for 20 h. The MTT solution (10 μL, 5 mg/mL, Solarbio, Beijing, China) was added to each well and incubated for 4 hours in the dark. After adding DMSO (200 μL, Gibco) to dissolve the formazan blue, the optical density at a wavelength of 490 nm was measured using a multi-detection microplate reader (Biotek,Winooski,VT,USA).

Enzyme-Linked Immunosorbent Assay

The levels of inflammatory cytokines, including IL-6, TNF-α, IFN-γ and IL-10, in the cell culture medium were measured to investigate the anti-inflammatory effect of MCE. IPEC-J2 cells (2 × 10⁵) were seeded in a 6-well plate and treated with varying concentrations of MCE (50 ng/mL, 100 ng/mL,150 ng/mL), followed by stimulation with LPS (1 μg/mL) for 12 hours. The culture supernatants were collected for the quantification of IL-6, TNF-α, IFN-γ, and IL-10 secretion using an ELISA Kit (Meimian Biotechnology, Yancheng, Jiangsu, China).

RNA Isolation and Quantitative PCR

The effect of MCE on IL-6, TNF-α, IFN-γ, IL-10, TLR4 and MyD88 at the mRNA level was investigated using quantitative real-time RT‒PCR (qRT‒PCR). IPEC-J2 cells were seeded in a 6-well plate and treated with varying concentrations of MCE (50 ng/mL, 100 ng/mL, 150 ng/mL) for 12 hours. Subsequently, they were stimulated with LPS (1 μg/mL) for another 12 hours. The total RNA was isolated and purified using the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara, Dalian, China) following the manufacturer's protocols. Subsequently, the RNA samples were reverse transcribed into cDNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). The cDNA production was quantified using the TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) kit from Takara, and the qRT-PCR analysis was performed on a Step One Plus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The qRT-PCR procedure consisted of an initial denaturation step at 95 °C for 30 seconds, followed by 40 cycles of denaturation at 95 °C for 4 seconds and annealing/extension at 60 °C for 30 seconds. Finally, fluorescence signal acquisition was carried out with a final denaturation step at 95 °C for 15 seconds and annealing/extension at 60 °C for 60 seconds. GAPDH was utilized as an internal control. The quantification of mRNA was performed using the 2^−ΔΔCt method. The primer sequences are provided in Table 1.

Table 1.

Sequences and Parameters of the Primers Used for qRT-PCR.

Gene	Sequence (5′-3′)	Length of DNA products (bp)
GAPDH	F:ACATCAAGAAGGTGGTGAAG R:ATTGTCGTACCAGGAAATGAG	179
IL-6	F: TCACCTCTCCGGACAAAAC R:TCTGCCAGTACCTCCTTGCT	151
TNF-α	F: TTCCAGCTGGCCCCTTGAGC R:GAGGGCATTGGCATACCCAC	146
INF-γ	F :GAGCCAAATTGTCTCCTTCTAC R:CGAAGTCATTCAGTTTCCCAG	140
IL-10	F:TGAGAACAGCTGCATCCACTTC R:TCTGGTCCTTCGTTTGAAAGAA	104
TLR4	F:CAGATAAGCGAGGCCGTCATT R:TTGCAGCCCACAAAAAGCA	113
MyD88	F:GATGGTAGCGGTTGTCTCTGAT R:GATGCTGGGGAACTCTTTCTTC	148

Western Blotting Analysis

IPEC-J2 cells were cultured in a 6-well plate and treated with varying concentrations of MCE (50 ng/mL, 100 ng/mL, 150 ng/mL) for 12 h before being stimulated with LPS (1 μg/mL) for an additional 12 h. The cells were subsequently rinsed with ice-cold PBS and then subjected to lysis using RIPA buffer supplemented with a protease inhibitor cocktail and phosphatase inhibitors. Subsequently, the resulting cell lysates were collected. The protein contents were quantified using a BCA protein assay kit (Thermo Fisher Scientific, Waltham, US). Cell lysates with an equivalent concentration of total protein were resolved on a 10% SDS-polyacrylamide gel and subsequently transferred onto a PVDF membrane (Merck Millipore, Darmstadt, Germany). The membrane was subsequently blocked with 5% BSA blocking buffer for 1 h and incubated overnight at 4°C with specific primary antibodies. After that, it was hybridized with corresponding horseradish peroxidase-labelled secondary antibodies for 1 h. The information regarding primary antibodies is as follows: β-actin antibody (#MA5-15739) was obtained from Invitrogen (Carlsbad, CA, USA), antibodies specific for p-ERK1/2 (#4370), ERK1/2 (#4695), p-JNK (#9251), JNK (#9252), p-p38 (#4511), p38 (#8690), p-NF-κB p65 (#3033), and NF-κB p65 (#6956) were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). TLR4 antibody(#NB100-56566) was acquired from Novus Biologicals and MyD88 antibody(#23230) was obtained from Proteintech. The secondary antibodies (#31460 and #31430) were procured from Thermo Fisher Scientific-CN, Inc. (Shanghai, China), while the bands were visualized using the ECL system (Biosharp, Hefei, China).

Statistical Analysis

The mean ± SD of triplicate experiments were used to present the data. Image J software (National Institutes of Health, Bethesda, MD, USA) was employed for the analysis of western blotting grayscale results. Statistical analysis was performed using SPSS version 19.0 (SPSS, Inc., Chicago, IL, USA) with ANOVA followed by Duncan's test. The significance levels were set at p < 0.05 and p < 0.01 for statistically significant and highly significant results, respectively. The mapping software utilized in this study was GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA).

Results

The Impact of MCE on the Viability of IPEC-J2 Cells

The MTT assay was employed to assess the cytotoxic effects of MCE on IPEC-J2 cells, and relative cell viability remained unaffected even at a concentration as high as 150 ng/mL (p > 0.05). Figure 1 presents the results, which confirm that the observed effects of MCE on IPEC-J2 cells were not due to cytotoxicity in this study. Therefore, all three concentrations of MCE were selected for subsequent experiments.

Figure 1.

Effects of MCE on cell viability of IPEC-J2 cells. Cells viability was detected by MTT assay. Results were shown as mean ± SD from three independent experiments and five parallel samples were set up in each experiment. (MCE: Macleaya cordata extract; IPEC-J2: porcine intestinal epithelial cell line J2).

The Impact of MCE on the Synthesis Inflammatory Cytokines in LPS-Induced IPEC-J2 Cells

The anti-inflammatory effect of MCE was evaluated by quantifying the production of three major pro-inflammatory cytokines, namely IL-6, TNF-α, and IFN-γ. Additionally, the inhibitory effect on inflammatory activity was assessed by measuring IL-10 production. The expression levels in IPEC-J2 cells were assessed using ELISA. As depicted in Figure 2, the production of IL-6, TNF-α, IFN-γ, and IL-10 exhibited a significant increase following LPS treatment (p < 0.01). Conversely, cells treated with MCE displayed reduced synthesis of IL-6, TNF-α, and IFN-γ compared to those treated solely with LPS. Notably, MCE-treated cells exhibited a substantial promotion in the production of IL-10. Furthermore, the synthesis of IL-6, TNF-α, and IFN-γ demonstrated a concentration-dependent effect.

Figure 2.

Effects of MCE on the secretion of IL-6, TNF-α, IFN-γ and IL-10 in LPS-induced IPEC-J2 cells. Results were represented as means ± SD from three independent experiments and three parallel samples were set in each experiment. The symbol ^# or ^## represents the significant analysis between the negative control and LPS group (p < 0.05 or p < 0.01). The symbol * or ** represents the significant analysis between the LPS group and MCE groups (p < 0.05 or p < 0.01). (MCE: Macleaya cordata extract; IL-6: interleukin-6; TNF-α: tumor necrosis factor-alpha; IFN-γ: interferon gamma; IL-10: interleukin-10; LPS: lipopolysaccharide; IPEC-J2: porcine intestinal epithelial cell line J2).

The Impact of MCE on the Expression of Inflammatory Genes in LPS-Induced IPEC-J2 Cells

The impact of MCE on the mRNA expression levels of IL-6, TNF-α, IFN-γ, and IL-10 was assessed using qRT‒PCR. As depicted in Figure 3, LPS stimulation resulted in a significant upregulation of IL-6, TNF-α, IFN-γ, and IL-10 mRNA expression when compared to the control group (p < 0.01). The combined treatment of LPS and MCE yielded similar results, demonstrating a robust inhibition of IL-6, TNF-α, and IFN-γ mRNA expression levels (p < 0.01) by MCE. Conversely, MCE significantly improved the expression of IL-10 (p < 0.01). The production of pro-inflammatory cytokines was significantly increased by the inflammatory reaction induced by LPS, similar to the results obtained from the ELISA assay. However, treatment with MCE effectively suppressed this upregulation of secretion. The consistent alterations observed in cytokine production and mRNA expression levels suggest that MCE may exert its anti-inflammatory and immunoregulatory effects through modulation of gene transcription.

Figure 3.

Effects of MCE on the mRNA expression of IL-6, TNF-α, IFN-γ and IL-10 in LPS-induced IPEC-J2 cells. Results were represented as means ± SD from three independent experiments and three parallel samples were set in each experiment. The symbol ^# or ^## represents the significant analysis between the negative control and LPS group (p < 0.05 or p < 0.01). The symbol * or ** represents the significant analysis between the LPS group and MCE groups. (MCE: Macleaya cordata extract; IL-6: interleukin-6; TNF-α: tumor necrosis factor-alpha; IFN-γ: interferon gamma; IL-10: interleukin-10; LPS: lipopolysaccharide; IPEC-J2: porcine intestinal epithelial cell line J2).

Effects of MCE on the Phosphorylation of the NF-κB Pathway in LPS-Induced IPEC-J2 Cells

To investigate whether MCE exerts its anti-inflammatory effects through modulation of NF-κB activation, the impact of MCE on NF-κB signaling proteins in LPS-stimulated IPEC-J2 cells was assessed to elucidate the underlying mechanism by which MCE attenuates IL-6, TNF-α, and IFN-γ production. The protein p65 was selected and analyzed by western blotting to investigate the impact of MCE on the NF-κB pathway in LPS-stimulated IPEC-J2 cells. Treatment with LPS induced significant phosphorylation of NF-κB p65 (p < 0.01), whereas pretreatment with MCE effectively suppressed LPS-induced phosphorylation of NF-κB p65 (p < 0.01) (Figure 4). These findings suggest that the anti-inflammatory activity of MCE is, to some extent, attributed to its inhibition of NF-κB-dependent proteins.

Figure 4.

Effects of MCE on NF-κB activation. β-actin was used as a control; p indicates phosphorylation. Protein samples from three independent experiments were quantified by densitometry and the levels were presented as the means ± SD from three independent experiments and five parallel samples were set in each experiment. The symbol # or ## represents the significant analysis between the negative control and LPS group (p < 0.05 or p < 0.01). The symbol * or ** represents the significant analysis between the LPS group and MCE groups. (MCE: Macleaya cordata extract; NF-κB: nuclear factor kappa B; CON: control group; LPS: LPS group).

Effects of MCE on the Phosphorylation of the MAPK Pathway in LPS-Induced IPEC-J2 Cells

To further elucidate the mechanism underlying the inhibitory effect of MCE, western blotting analysis was employed to detect protein phosphorylation in the MAPK pathway. The expression of ERK1/2, JNK, and P38 along with their phosphorylated forms were assessed. The phosphorylation of proteins, including ERK1/2, JNK, and p38 in the MAPK pathway (p < 0.01), was significantly increased upon LPS stimulation as depicted in Figure 5. However, pre-incubation of cells with MCE effectively blocked this increase (p < 0.01). Notably, the total protein content of each kinase remained constant throughout the experiment. Consequently, MCE exerts its anti-inflammatory effects by inactivating MAPKs in LPS-induced IPEC-J2 cells.

Figure 5.

Effects of MCE on MAPK activation. Protein samples from three independent experiments were quantified by densitometry and the levels were presented as the means ± SD from three independent experiments and five parallel samples were set in each experiment. The symbol ^# or ^## represents the significant analysis between the negative control and LPS group (p < 0.05 or p < 0.01). The symbol * or ** represents the significant analysis between the LPS group and MCE groups. (MCE: Macleaya cordata extract; MAPK: mitogen-activated protein kinase; CON: control group; LPS: LPS group).

Effects of MCE on MyD88 and TLR4 Expression in LPS-Induced IPEC-J2 Cells

TLR4 and MyD88 are considered as the primary molecular targets of NF-κB and MAPK pathways, directly regulating their activation in LPS-induced inflammation. To further investigate the anti-inflammatory activity of MCE, we examined the mRNA expression and secretion of MyD88 and TLR4 in LPS-induced IPEC-J2 cells. The mRNA expression levels of TLR4 and MyD88 were significantly upregulated upon LPS challenge, as depicted in Figure 6A, compared to the control group (p < 0.01). However, pretreatment with MCE for 12 hours attenuated the upregulation of TLR4 and MyD88 expression levels (p < 0.01). The results depicted in Figure 6B demonstrate that MCE effectively reduced the protein expression of TLR4 and MyD88 in LPS-induced IPEC-J2 cells (p < 0.01). Notably, significant suppression of upstream signaling molecules by MCE was observed at concentrations of 50 ng/mL, 100 ng/mL, and 150 ng/mL (p < 0.01).

Figure 6.

Effects of MCE on the mRNA and protein expression of TLR4 and MyD88. (A) The mRNA expression level of TLR4 and MyD88; (B) The protein expression level of TLR4 and MyD88. The results were obtained from three independent experiments. The data are presented as the mean ± SD (n = 5 in each group).The symbol ^# or ^## represents the significant analysis between the negative control and LPS group (p < 0.05 or p < 0.01). The symbol * or ** represents the significant analysis between the LPS group and MCE groups. (MCE: Macleaya cordata extract; TLR4: toll-like receptor 4; MyD88: myeloid differentiation factor 88; CON: control group; LPS: LPS group).

Discussion

The overuse of antibiotics has heightened the risk of antibiotic-resistant bacteria, prompting global concern due to the rapid progression and emergence of microbial resistance against traditional antibiotics. As a result, many countries and regions, including member nations of the European Union, Japan, South Korea, and China, have prohibited the use of antibiotics in animal feed. The efficacy of substances as potential replacements for antibiotics in animal feed is increasingly being investigated by researchers, with a focus on identifying properties that can enhance animal health without promoting the development of resistance. The utilization of plant extracts offers the advantages of inherent natural properties, a favorable safety profile, and absence of drug residue. Macleaya cordata has long been utilized as a traditional medicinal remedy for treating inflammation in certain countries. It is distributed in North America, East Asia and Europe, and it can be cultivated artificially. Macleaya cordata is a promising herbal resource with therapeutic potential against various diseases due to the presence of numerous active alkaloids. It has exhibited anti-microbial, insecticidal, antiviral, anti-inflammatory, and anti-tumor activities in multiple studies. The primary chemical constituents of MCE consist of sanguinarine and CHE, which showed complete growth inhibition of all strains of Staphylococcus aureus at concentrations ranging from 3 to 10 µg/mL, and were equal in activity or were more potent than the reference compound chloramphenicol.³⁵ Macleaya cordata exhibits advantageous characteristics as a feed additive, including naturality, beneficial biological activities, low dosage requirement, low cost-effectiveness, and no drug resistance.^36,37 Despite previous evidence demonstrating the anti-inflammatory activity of MCE, the underlying mechanisms remain incompletely understood. Therefore, this study aimed to investigate the in vitro effects of MCE using LPS-induced IPEC-J2 cells as an inflammatory model.

The pro-inflammatory cytokines IL-6, TNF-α, and IFN-γ play a crucial role in the pathogenesis of chronic inflammatory diseases. TNF-α, as an endogenous pyrogen, enhances macrophage sensitivity, stimulates neutrophils and lymphocytes, and modulates the synthesis and release of other inflammatory cytokines.³⁸ The regulation of the majority of acute-phase proteins, which are produced through non-specific inflammatory reactions, involves the participation of IL-6.³⁹ The cytokine IFN-γ plays a pivotal role as a proinflammatory mediator in autoimmune processes, exerting regulatory functions to mitigate tissue damage associated with inflammation.⁴⁰ In this study, MCE effectively suppressed the excessive expression of IL-6, TNF-α, and IFN-γ at both mRNA and protein levels in response to LPS stimulation. These findings demonstrate that MCE exerts anti-inflammatory effects by modulating the transcription of proinflammatory cytokines. Importantly, we observed a concentration-dependent manner in which MCE significantly inhibited the production of pro-inflammatory cytokines in LPS-stimulated IPEC-J2 cells.

The cytokine IL-10 functions as a fundamental anti-inflammatory factor and serves as a negative regulator of immune responses to microbial antigens.⁴¹ The suppressive effects of IL-10 extend to both the innate and adaptive arms of the immune system, primarily functioning to restrict inflammatory responses in order to maintain homeostasis with commensal microbes in the intestine and facilitate resolution during pathogenic infections.^40,42,43 In this study, pretreatment of IPEC-J2 cells with MCE significantly suppressed the mRNA expression and secretion of proinflammatory mediators induced by LPS. Meanwhile, MCE-pretreated cells exhibited a substantial increase in the production and mRNA expression of the anti-inflammatory mediator IL-10. These findings suggest that MCE exhibits potent anti-inflammatory and immunoregulatory properties.

The NF-κB and MAPK signaling pathways have long been recognized as the prototypical mechanisms involved in the regulation of inflammatory responses.^44,45 Following stimulation by LPS, these intracellular cascades are activated to induce the production of inflammatory cytokines and orchestrate the inflammatory response.⁴⁶ The MAPK signaling pathway is recognized as an integral component of the eukaryotic signal transduction network involved in the regulation of inflammatory mediators.⁴⁷ MAPKs proteins, including ERK, JNK, and p38 protein kinases, are activated to modulate the inflammatory response in LPS-stimulated macrophage cells by functioning on their respective substrates. In this study, treatment with LPS significantly enhanced the phosphorylation of p38, JNK and Erk1/2; however, the MCE treatment effectively attenuated the phosphorylation levels induced by LPS. Thus, the anti-inflammatory effects of MCE were found to be interconnected with the p38, JNK, and ERK1/2 signaling pathways, which may lead to a reduction in the levels of inflammatory mediators and cytokines within cells. NF-κB, a crucial downstream pathway in the LPS-mediated signal response, is directly associated with tumor growth, inflammation, and apoptosis.⁴⁸ The activation of the MAPK signaling pathway by LPS has been suggested to indirectly trigger the downstream NF-κB pathway, thereby initiating protein expression and eliciting complex physiological responses.⁴⁹ The inactive form of NF-κB is typically localized in the cytoplasm as a heterodimer complex bound to IκBα.⁵⁰ Upon stimulation, IκBα undergoes phosphorylation and subsequent rapid degradation, thereby facilitating the activation and phosphorylation of the NF-κB p65 subunit.⁵¹ The activated NF-κB translocates into the nucleus for binding to target DNAs and initiating gene expression.⁵² The expression of IκBα protein and the activation of p65 transcription factor are pivotal indicators for inflammatory response.⁵³ In the current study, MCE effectively suppressed the phosphorylation of p65 in total cell lysates within LPS-induced IPEC-J2 cells. These findings demonstrate that MCE exerts a downregulatory effect on the production of inflammatory cytokines induced by LPS through inhibition of the NF-κB signaling pathway.

The inflammatory response of LPS-induced cells has been demonstrated to occur through a series of intracellular and extracellular protein interactions, including TLR4 and other proteins that bind to LPS.^46,53 The stimulation of TLR4 by LPS subsequently triggers the recruitment of the cytoplasmic adaptor protein MyD88 and the activation of TAK1, which in turn activates downstream signaling pathways such as MAPKs and NF-κB. Our investigation demonstrates that MCE significantly inhibits LPS-stimulated expression of TLR4 and MyD88 in IPEC-J2 cells. These results indicate that both TLR4 and MyD88 are involved in the inhibitory effect of MCE on pro-inflammatory cytokine production induced by LPS.

Conclusion

In summary, our findings demonstrate that MCE effectively attenuated the production of pro-inflammatory cytokines IL-6, IFN-γ, and TNF-α at both mRNA and protein levels in LPS-induced IPEC-J2 cells. Conversely, MCE significantly increased the expression of anti-inflammatory cytokine IL-10. These results unequivocally establish the potent anti-inflammatory and immunoregulatory properties of MCE. Furthermore, our data strongly suggest that the inhibitory effects of MCE on TLR4-mediated NF-κB and MAPK signaling pathways are responsible for its remarkable anti-inflammatory activity in LPS-induced IPEC-J2 cells. Overall, these findings provide valuable insights into the mechanisms underlying the therapeutic potential of MCE as an effective agent against inflammation.

Supplemental Material

sj-docx-1-npx-10.1177_1934578X241237657 - Supplemental material for Macleaya cordata Extract Inhibits LPS-Induced IPEC-J2 Inflammation Through TLR4-Mediated NF-κB and MAPK Signaling Pathways

Supplemental material, sj-docx-1-npx-10.1177_1934578X241237657 for Macleaya cordata Extract Inhibits LPS-Induced IPEC-J2 Inflammation Through TLR4-Mediated NF-κB and MAPK Signaling Pathways by Diangang Han, Hongqing Yang, Litao Che, Chong Zhang, Jing Li, Lingling Ye, Chunyong Zhang, Rongfu Guo and Jige Xin in Natural Product Communications

Footnotes

Acknowledgements

The authors would like to thank Mr Fang Su for the kind assistance during this experimental work.

Authors’ Contributions

RG and JX conceived the concept of the study. DH and HY performed the experiments. JL, LY and Chong Zhang collected the data. LC and Chunyong Zhang did the statistical analysis. JX drafted the manuscript. RG edited the manuscript. All authors contributed to the article and approved the final version.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval

Ethical Approval is not applicable to this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Talent Plans for Young Topnotch Talents of Yunnan (YNWR-QNBJ-2020-154), the Academician Workstation of Yunnan Province (2018IC078), the Scientific Research Project of Yunnan Province (2017EH193), the Key Program from Science and Technology Department of Yunnan Province (202302AE090016).

Statement of Human and Animal Rights

This article does not contain any studies with human or animal subjects.

Statement of Informed Consent

There are no human subjects in this article and informed consent is not applicable.

ORCID iD

Jige Xin

Supplemental Material

Supplemental material for this article is available online.

References

Chiou

Chao

, et al.

Ligustilide prevents LPS-induced iNOS expression in RAW 264.7 macrophages by preventing ROS production and down-regulating the MAPK, NF-kappaB and AP-1 signaling pathways.

Int Immunopharmacol. 2011;11(9):1166–1172. doi:https://doi.org/10.1016/j.intimp.2011.03.014

Huang

, et al. Ginkgo biloba sarcotesta polysaccharide inhibits inflammatory responses through suppressing both NF-κB and MAPK signaling pathway. J Sci Food Agric. 2019;99(5):2329-2339. doi:https://doi.org/10.1002/jsfa.9431

Negroni

Cucchiara

Stronati

. Apoptosis, necrosis, and necroptosis in the gut and intestinal homeostasis. Mediators Inflamm. 2015;2015(September):250762. doi:https://doi.org/10.1155/2015/250762

Langerholc

Maragkoudakis

Wollgast

, et al. Novel and established intestinal cell line models - an indispensable tool in food science and nutrition. Trends Food Sci Technol. 2011;22(November):S11-S20. doi:https://doi.org/10.1016/j.tifs.2011.03.010

Schierack

Nordhoff

Pollmann

, et al. Characterization of a porcine intestinal epithelial cell line for in vitro studies of microbial pathogenesis in swine. Histochem Cell Biol. 2006;125(3):293-305. doi:https://doi.org/10.1007/s00418-005-0067-z

Hong

Zheng

. β-Carotene attenuates lipopolysaccharide-induced inflammation via inhibition of the NF-κB, JAK2/STAT3 and JNK/p38 MAPK signaling pathways in macrophages. Anim Sci J. 2019;90(1):140-148. doi:https://doi.org/10.1111/asj.13108

Ren

Zheng

, et al. Tenuigenin exhibits anti-inflammatory activity via inhibiting MAPK and NF-κB and inducing Nrf2/HO-1 signaling in macrophages. Food Funct. 2016;7(1):355-363. doi:https://doi.org/10.1039/c5fo00807g

Jia

Wang

Zhang

, et al. TLR2/TLR4 Activation induces Tregs and suppresses intestinal inflammation caused by Fusobacterium nucleatum in vivo. PLoS One. 2017;12(10):e0186179. doi:https://doi.org/10.1371/journal.pone.0186179

Akira

Takeda

Kaisho

. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. 2001;2(8):675-680. doi:https://doi.org/10.1038/90609

10.

Gong

, et al. Trichomonas vaginalis induces production of proinflammatory cytokines in mouse macrophages through activation of MAPK and NF-κB pathways partially mediated by TLR2. Front Microbiol. 2018;9(April):712. doi:https://doi.org/10.3389/fmicb.2018.00712

11.

Kawai

Shizuo

. TLR signaling. Semin Immunol. 2007;19(1):24-32. doi:https://doi.org/10.1016/j.smim.2006.12.004

12.

Nyati

Masuda

Zaman

MMU

, et al. TLR4-induced NF-κB and MAPK signaling regulate the IL-6 mRNA stabilizing protein Arid5a. Nucleic Acids Res. 2017;45(5):2687-2703. doi:https://doi.org/10.1093/nar/gkx064

13.

Huang

. Anti-inflammatory activities of mogrosides from Momordica grosvenori in murine macrophages and a murine ear edema model. J Agric Food Chem. 2011;59(13):7474-7481. doi:https://doi.org/10.1021/jf201207m

14.

Chen

Pan

, et al. Dachengqi decoction attenuates inflammatory response via inhibiting HMGB1 mediated NF-κB and P38 MAPK signaling pathways in severe acute pancreatitis. Cell Physiol Biochem. 2015;37(4):1379-1389. doi:https://doi.org/10.1159/000430403

15.

Zanello

Berri

Dupont

, et al. Saccharomyces cerevisiae modulates immune gene expressions and inhibits ETEC-mediated ERK1/2 and p38 signaling pathways in intestinal epithelial cells. PLoS One. 2011;6(4):e18573. doi:https://doi.org/10.1371/journal.pone.0018573

16.

Casciaro

Mangiardi

Cappiello

, et al. Naturally-occurring alkaloids of plant origin as potential antimicrobials against antibiotic-resistant infections. Molecules. 2020;25(16):3619. doi:https://doi.org/10.3390/molecules25163619

17.

Schwarz

Kehrenberg

Walsh

. Use of antimicrobial agents in veterinary medicine and food animal production. Int J Antimicrob Agents. 2001;17(6):431-437. doi:https://doi.org/10.1016/s0924-8579(01)00297-7

18.

Kolpin

Furlong

Meyer

, et al. Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams, 1999-2000: a national reconnaissance. Environ Sci Technol. 2002;36(6):1202-1211. doi:https://doi.org/10.1021/es011055j

19.

Read

Woods

. Antibiotic resistance management. Evol Med Public Hlth. 2014;2014(1):147. doi:https://doi.org/10.1093/emph/eou024

20.

Khameneh

Iranshahy

Soheili

, et al. Review on plant antimicrobials: a mechanistic viewpoint. Antimicrob Resist Infect Control. 2019;8(July):118. doi:https://doi.org/10.1186/s13756-019-0559-6

21.

Khameneh

Diab

Ghazvini

, et al. Breakthroughs in bacterial resistance mechanisms and the potential ways to combat them. Microb Pathog. 2016;95(June):32-42. doi:https://doi.org/10.1016/j.micpath.2016.02.009

22.

Bibi

SFB

Khameneh

Ostad

MRZ

, et al. In vitro evaluation of antibacterial activity of verbascoside, lemon verbena extract and caffeine in combination with gentamicin against drug-resistant Staphylococcus aureus and Escherichia coli clinical isolates. Avicenna J Phytomed. 2018;8(3):246-253.

23.

Cowan

. Plant products as antimicrobial agents. Clin Microbiol Rev. 1999;12(4):564-582. doi:https://doi.org/10.1128/CMR.12.4.564

24.

Liu

Huang

, et al. Medicinal plants of the genus Macleaya (Macleaya cordata, Macleaya microcarpa): a review of their phytochemistry, pharmacology, and toxicology. Phytother Res. 2018;32(1):19-48. doi:https://doi.org/10.1002/ptr.5952

25.

Psotová

Klejdus

Vecera

, et al. A liquid chromatographic–mass spectrometric evidence of dihydrosanguinarine as a first metabolite of sanguinarine transformation in rat. J Chromatogr B Analyt Technol Biomed Life Sci. 2006;830(1):165-172. doi:https://doi.org/10.1016/j.jchromb.2005.10.030

26.

Kosina

Walterová

Ulrichová

, et al. Sanguinarine and chelerythrine: assessment of safety on pigs in ninety days feeding experiment. Food Chem Toxicol. 2004;42(1):85-91. doi:https://doi.org/10.1016/j.fct.2003.08.007

27.

Kosina

Gregorova

Gruz

, et al. Phytochemical and antimicrobial characterization of Macleaya cordata herb. Fitoterapia. 2010;81(8):1006-1012. doi:https://doi.org/10.1016/j.fitote.2010.06.020

28.

Kantas

Papatsiros

Tassis

, et al. Effect of a natural feed additive (Macleaya cordata), containing sanguinarine, on the performance and health status of weaning pigs. Anim Sci J. 2015;86(1):92-98. doi:https://doi.org/10.1111/asj.12240

29.

Jiang

Yang

Chen

, et al. Macleaya cordata extracts exert antiviral effects in newborn mice with rotavirus-induced diarrhea via inhibiting the JAK2/STAT3 signaling pathway. Exp Ther Med. 2020;20(2):1137-1144. doi:https://doi.org/10.3892/etm.2020.8766

30.

Cao

, et al. Molluscicidal activity and physiological toxicity of quaternary benzo[c]phenanthridine alkaloids (QBAs) from Macleaya cordata fruits on oncomelania hupensis. PLoS Negl Trop Dis. 2019;13(10):e0007740. doi:https://doi.org/10.1371/journal.pntd.0007740

31.

Petruczynik

Plech

Tuzimski

, et al. Determination of selected isoquinoline alkaloids from mahonia aquifolia; meconopsis cambrica; corydalis lutea; dicentra spectabilis; fumaria officinalis; Macleaya cordata extracts by HPLC-DAD and comparison of their cytotoxic activity. Toxins (Basel) 2019;11(10):575. doi:https://doi.org/10.3390/toxins11100575

32.

Park

Bergeron

Senta

, et al. Sanguinarine induces apoptosis of human osteosarcoma cells through the extrinsic and intrinsic pathways. Biochem Biophys Res Commun. 2010;399(3):446-451. doi:https://doi.org/10.1016/j.bbrc.2010.07.114

33.

Zhao

Wang

, et al. Effects of GABA supplementation on intestinal SIgA secretion and gut microbiota in the healthy and ETEC-infected weanling piglets. Mediators Inflamm. 2020;2020(May):7368483. doi:https://doi.org/10.1155/2020/7368483

34.

Palócz

Szita

Csikó

. Alteration in inflammatory responses and cytochrome P450 expression of porcine jejunal cells by drinking water supplements. Mediators Inflamm. 2019;2019(January):5420381. doi:https://doi.org/10.1155/2019/5420381

35.

Khin

Jones

Cech

, et al. Phytochemical analysis and antimicrobial efficacy of Macleaya cordata against extensively drug-resistant Staphylococcus aureus. Nat Prod Commun. 2018;13(11):10.1177/1934578X1801301117. https://doi.org/10.1177/1934578X1801301117

36.

Tong

, et al. Effects of Macleaya cordata extract on small intestinal morphology and gastrointestinal microbiota diversity of weaned pigs. Livest Sci. 2020;237(July):104040. doi.org/10.1016/j.livsci.2020.104040.

37.

Chu

, et al. Macleaya cordata extracts suppressed the increase of a part of antibiotic resistance genes in fecal microorganism of weaned pigs. Can J Anim Sci. 2018;98(4):884-887.

38.

Yang

Ham

Choi

. Anti-inflammatory effect of prunetin via the suppression of NF-κB pathway. Food Chem Toxicol. 2013;58(August):124-132. doi:https://doi.org/10.1016/j.fct.2013.03.039

39.

Bode

Albrecht

Häussinger

, et al. Hepatic acute phase proteins–regulation by IL-6- and IL-1-type cytokines involving STAT3 and its crosstalk with NF-κB dependent signaling. Eur J Cell Biol. 2012;91(6-7):496-505. doi:https://doi.org/10.1016/j.ejcb.2011.09.008

40.

Miyake

. Innate immune sensing of pathogens and danger signals by cell surface toll-like receptors. Semin Immunol. 2007;19(1):3-10. doi:https://doi.org/10.1016/j.smim.2006.12.002

41.

Engelhardt

Grimbacher

. IL-10 in humans: lessons from the gut, IL-10/IL-10 receptor deficiencies, and IL-10 polymorphisms. Curr Top Microbiol Immunol. 2014;380(January):1-18. doi:https://doi.org/10.1007/978-3-662-43492-5_1

42.

Ouyang

Rutz

Crellin

, et al. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol. 2011;29(April):71-109. doi:https://doi.org/10.1146/annurev-immunol-031210-101312

43.

Saraiva

O'Garra

. The regulation of IL-10 production by immune cells. Nat Rev Immunol. 2010;10(3):170-181. doi:https://doi.org/10.1038/nri2711

44.

Liu

Chao

, et al. Stevioside improves antioxidant capacity and intestinal barrier function while attenuating inflammation and apoptosis by regulating the NF-κB/MAPK pathways in diquat-induced oxidative stress of IPEC-J2 cells. Antioxidants. 2023;12(5):1070. doi: https://doi.org/10.3390/antiox12051070

45.

Liu

Chao

, et al. Acidifiers attenuate diquat-induced oxidative stress and inflammatory responses by regulating NF-κB/MAPK/COX-2 pathways in IPEC-J2 cells. Antioxidants. 2022;11(10):2002. doi: https://doi.org/10.3390/antiox11102002

46.

Huang

Yang

, et al. Hyperin attenuates inflammation by activating PPAR-gamma in mice with acute liver injury (ALI) and LPS-induced RAW264.7 cells. Int Immunopharmacol. 2015;29(2):440-447. doi:https://doi.org/10.1016/j.intimp.2015.10.017

47.

Aly

Abdel-Galil Ahmed

Abdel-Aziz Ghareeb

, et al. Studies on Bacillus subtilis and Lactobacillus acidophilus, as potential probiotics, on the immune response and resistance of Tilapia nilotica (Oreochromis niloticus) to challenge infections. Fish Shellfish Immunol. 2008;25(1-2):128-136. doi:https://doi.org/10.1016/j.fsi.2008.03.013

48.

Guha

Mackman

. LPS Induction of gene expression in human monocytes. Cell Signal. 2001;13(2):85-94. doi:https://doi.org/10.1016/s0898-6568(00)00149-2

49.

Boots

Haenen

GRMM

Bast

. Health effects of quercetin: from antioxidant to nutraceutical. Eur J Pharmacol. 2008;585(2-3):325-337. doi:https://doi.org/10.1016/j.ejphar.2008.03.008

50.

Kamarudin

MNA

Hamdi

OAA

, et al. Curcumenol isolated from curcuma zedoaria suppresses Akt-mediated NF-κB activation and p38 MAPK signaling pathway in LPS-stimulated BV-2 microglial cells. Food Funct. 2015;6(11):3550-3559. doi:https://doi.org/10.1039/c5fo00607d

51.

Endale

Park

Kim

, et al. Quercetin disrupts tyrosine-phosphorylated phosphatidylinositol 3-kinase and myeloid differentiation factor-88 association, and inhibits MAPK/AP-1 and IKK/NF-kappaB-induced inflammatory mediators production in RAW 264.7 cells. Immunobiology. 2013;218(12):1452-1467. doi:https://doi.org/10.1016/j.imbio.2013.04.019

52.

Wang

Zhang

, et al. Surface-layer protein from Lactobacillus acidophilus NCFM inhibits lipopolysaccharide-induced inflammation through MAPK and NF-kappaB signaling pathways in RAW264.7 cells. J Agric Food Chem. 2018;66(29):7655-7662. doi:https://doi.org/10.1021/acs.jafc.8b02012

53.

Sherman

Xie

Taylor

, et al. Lipopolysaccharide is transported to the cell surface by a membrane-to-membrane protein bridge. Science. 2018;359(6377):798-801. doi:https://doi.org/10.1126/science.aar1886

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.49 MB