The Protective Effect of Lycium barbarum Betaine and Effervescent Tablet Against Carbon Tetrachloride-Induced Acute Liver Injury in Rats

Abstract

The liver is essential for animals and humans. Because of their low side effects and high safety, natural products have recently become a research hotspot for human health-related issues that can damage the liver. In this study, we investigated the protective effects in rats of Lycium barbarum betaine (LBB) and Lycium barbarum betaine Effervescent Tablet (LBBET) against liver injury caused by carbon tetrachloride (CCl₄). The results showed that LBB and LBBET pretreatment significantly reduced the serum levels of alanine aminotransferase, aspartate transaminase (AST), and alkaline phosphatase, as well as the liver tissue levels of malondialdehyde. Meanwhile, glutathione peroxidase, and superoxide dismutase levels were significantly increased in liver tissues. In addition, LBB and LBBET may effectively alleviate CCl₄-induced liver injury by a mechanism related to the activation of the Nrf2 signaling pathway. In conclusion, LBB and LBBET may serve as potential mitigators of CCl₄-induced liver injury. Effervescent Tablet can be used as either a new formulation or practical product for patients who have difficulty swallowing regular tablets or capsules. This study provides a basis and new ideas for the development of functional foods or drugs related to the field of liver protection.

Keywords

alkaloids acute liver injury carbon tetrachloride effervescent tablets

Introduction

The liver is an essential organ for immunity and nutrition in animals and humans.¹ However, various external chemicals can damage this organ and cause chronic and acute liver disease.² Acute liver damage from drugs, alcohol, and other substances is frequent, and severe liver damage often leads to liver failure and even death.³ The main features of acute liver injury are necrosis, inflammatory cell infiltration, and apoptosis.^4–7 Carbon tetrachloride (CCl₄) is a common industrial solvent, cleaning agent, and a potent hepatotoxin, widely used in the laboratory to induce liver injury and fibrosis.⁸ CCl₄ generates highly reactive CCl₃ through the mediation of cytochrome p450, which leads to lipid peroxidation by stress, which eventually leads to hepatocellular damage. It is thus commonly used to establish an acute liver injury mice model of acute liver injury.⁹ Several studies have demonstrated that CCl₄ can induce hepatocyte necrosis, apoptosis, and inflammatory responses.^10,12 Because of their low side effects and high safety, natural products have recently become a research hotspot for human health-related issues.¹³ Lycium barbarum, a traditional Chinese edible and medicinal plant,¹⁴ is also known as Goji berry and Chinese wolfberry.¹⁵ According to related studies, the main active components of the plant are polyphenols, pigments, polysaccharides, flavonoids, amino acids, alkaloids, vitamins, and trace minerals.¹⁶ One of the major alkaloids found in the leaves and stem of L barbarum is betaine, an N-trimethyl derivative of glycine.¹⁷ Its bipolar amphoteric shape helps maintain osmotic balance in cells.¹⁸ Betaine possesses hepatoprotective, anti-inflammatory, and antioxidant properties and is commonly present in plants, animals, and microorganisms.¹⁹ In addition to its strong antioxidant properties, betaine also has significant pharmacological effects. It may prevent hyperhomocysteinemia,²⁰ protect the liver,²¹ have a positive effect on cardiometabolic health,²² inhibit tumors, have anticancer effects, lower blood pressure, cause sedation, and relieve pain and fever.²³

Betaine has been found to have a positive effect on fatty liver disease by methionine choline deficiency by regulating oxidative stress, inflammation, and cell death.²⁴ Similarly, it has also been found that betaine can enhance the antioxidant activity of hepatocytes, promote the proliferation and regeneration of hepatocytes, and either maintain or protect mitochondrial and Golgi apparatus function in a CCl₄-induced liver injury model.^25–27 Experimental results suggest that betaine can effectively reduce CCl₄-induced liver injury²⁵ and its mechanism may be related to the reduction of inflammatory mediators and increased antioxidant activity.

The formulation is important in how well a drug works. As society develops and living standards improve, people want things that are simple to carry and transport, especially for drug formulations. A new type of pharmaceutical formulation called effervescent tablets has a quick onset of action and poses little risk to the stomach, making it ideal for people who have difficulty swallowing tablets or capsules.^28,29 Therefore, the effervescent tablet can be used as a functional food.

The above studies showed that betaine has various functions, especially in hepatoprotection and as an antioxidant. However, the creation of similar functional foods for hepatoprotection has received relatively little attention in previous studies, particularly with respect to effervescent tablets with hepatoprotective properties. Therefore, in this study, betaine was first extracted from L barbarum to prepare Lycium barbarum betaine effervescent tablets (LBBET) and then the protective effect and mechanism of both the betaine and its effervescent tablets against CCl₄-induced liver damage were investigated in rats. In addition, Lycium barbarum betaine (LBB) pretreatment was used in this study. Pretreatment experiments are a common method to study the protective effects of substances.³⁰

Materials and Methods

Chemicals and Reagents

Sodium bicarbonate, sodium citrate, microcrystalline PEG 6000 and microcrystalline cellulose were purchased from Henan Wanbang Chemical Technology Co, CCl₄ (batch number: 56-23-5) and Bifendate (batch number: D25O10G100857) from Qinghai, China, Rhine Biotechnology Co, alanine aminotransferase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), and BCA protein assay kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), Trizol, SYBR GREEN SuperReal Color Fluorescence Quantitative from Tiangen Biochemical Technology Co, and nitrocellulose membrane, anti-Nrf2, anti-HO-1, anti-NQO1, and anti-β-actin from Wuhan Aipotec Biotechnology Co.

Extraction and Purification of L barbarum Betaine

To crushed L barbarum (10 kg) at −40 °C, double distilled water was added in a ratio of 1:5, heated in a water bath for 2 h, then filtered 3–5 times with a circulating water vacuum pump, and concentrated under reduced pressure. The polysaccharide was removed by the addition of 5 times the volume of anhydrous ethanol, followed by centrifugation. The supernatant was then concentrated in vacuo under reduced pressure and lyophilized to obtain a crude LBB extract. This was dissolved in 1 L of double-distilled water, and purified by passage through cation exchange resin and anion exchange resin columns, and lyophilized . The crude extract of LBB was washed with 5 times its volume of ethanol and centrifuged; the supernatant was concentrated under reduced pressure to obtain about 120 g LBB.

Preparation of LBBETs

LBBET is formulated with 35% LBB, 25% sodium bicarbonate, 25% sodium citrate, 2% PEG 6000, 13% microcrystalline cellulose, and moderate amounts of anhydrous ethanol. LBB, sodium bicarbonate, sodium citrate, and microcrystalline cellulose are first uniformly mixed, then dried and pulverized into powder form, and finally PEG 6000 is added, uniformly mixed, and compressed to make LBBET.

Animals and Experimental Design

Sixty-four healthy male Sprague-Dawley rats (SD rats), SPF grade, (license number SCXK 2019-0008), body weight 180 ± 10 g, were provided by Beijing Huafukang Biotechnology Co. All animal care and use procedures were approved by the Medical Ethics Committee of Qinghai University School of Medicine (2019-1), and were performed in accordance with the Guide for Care and Use of Laboratory Animals (National Institutes of Health Publication NO 85-23, raised 1996). Rats were randomized into 8 groups, including control group (CON), CCl₄ group, bifendate control (BC) group, 2 LBB intervention groups at low and high dosages (LBB-L, LBB-H), and 3 LBBET intervention groups at low, medium, and high dosages (LBBET-L, LBBET-M, LBBET-H); each group contained 8 animals. Table 1 depicts these groups. After 1 week of acclimated feeding, rats in the BC, LBB, and LBBET administration groups were gavaged with the corresponding doses of either LBB or LBBET for 7 days, and rats in the CON and CCl₄ groups were gavaged with normal saline. On day 7, 2 h after the last oral administration, 50% CCl₄ dissolved in olive oil (2 mL/kg) was orally administered to all animal groups except the CON group, and the same amount of oral saline was administered to the CON group. CCl₄ dose settings were obtained from the related literature.³¹

Table 1.

Grouping and Design of Animal Experiments.

Groups	0-7d Treatment	After 2 h from the last oral administration
CON	Normal saline (20 mL/kg/d)	Normal saline (2 mL/kg)
CCl₄	Normal saline (20 mL/kg/d)	CCl₄ (2 mL/kg)
BC	Bifendate (100 mg/kg/d)	CCl₄ (2 mL/kg)
LBB-L	LBB (50 mg/kg/d)	CCl₄ (2 mL/kg)
LBB-H	LBB (200 mg/kg/d)	CCl₄ (2 mL/kg)
LBBET-L	LBBET (50 mg/kg/d)	CCl₄ (2 mL/kg)
LBBET-M	LBBET (100 mg/kg/d)	CCl₄ (2 mL/kg)
LBBET-H	LBBET (200 mg/kg/d)	CCl₄ (2 mL/kg)

Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control groupLBBET, Lycium barbarum betaine effervescent tablet; LBB, Lycium barbarum betaine; LBB-H, Lycium barbarum betaine in high dosage; LBB-L, Lycium barbarum betaine in low dosage; LBB-M, Lycium barbarum betaine in medium dosage.

Sample Collection

At the end of the experiment, the rats were anesthetized until the rolled-over reflex was not seen, fixed in a supine position on the operating table, and the rat's abdominal aorta was separated. Blood was quickly transferred to an ice box for temporary storage in nonanticoagulation tubes. The supernatant serum was obtained using a benchtop high-speed centrifuge, put into EP tubes, and stored at −80 °C.

Histopathological Studies

Samples were fixed in 10% neutral formaldehyde for dehydration, trimming, embedding, sectioning, staining, and sealing; histopathological changes in rat liver were observed under a light microscope.

Transmission Electron Microscopy

Three rats were randomly selected from each group, anesthetized, and the left lobe of the liver was collected after laparotomy and placed in 3% glutaraldehyde for electron microscopy. After staining with uranyl acetate, with lead citrate staining, the sections were observed under a transmission electron microscope.

Measurement of the AST, ALT, and ALP Indexes in Serum

The activity of ALT, AST, and ALP in serum was determined according to the manufacturer's instructions.³²

Assessment of Oxidative Stress in the Liver

The liver tissue was mixed with saline at a ratio of 1:9 and then homogenized to prepare a liver tissue homogenate. The supernatant was removed, and then the levels of SOD, GSH-PX, MDA, and total protein in the liver tissue homogenate were measured according to the instructions given with the kit.

Real-Time Polymerase Chain Reaction

After tissue RNA had been extracted using the Trizol method, the RNA concentration was determined, and the extracted total RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit. Real-time fluorescence quantitative polymerase chain reaction (PCR) analysis was performed according to the operation of the SYBR GREEN SuperReal Color Fluorescence Quantitative Premix Kit. Relative gene expression was normalized to β-actin and calculated using the 2^−ΔΔCt method. Table 2 shows the primer sequences that were used in the study.

Table 2.

Real-Time Fluorescent Quantitative Polymerase Chain Reaction (PCR) Primer Sequences.

Genes	Forward primer	Reverse primer
Nrf2	CCTTCCTCTGCTGCCATTAGTC	GAACTCCACCGTGCCTTCAG
NQO1	GCCTACACGTATGCCACCAT	TGGACACCCTGCAGAGAGTA
HO-1	CTAAGACCGCCTTCCTGCTC	GCCTCTGGCGAAGAAACTCT
β-actin	GCGCAAGTACTCTGTGTGGA	CATCGTACTCCTGCTTGCTG

Western Blot Analysis

Liver tissues were harvested to determine the total protein concentration. Each sample was denatured by boiling, and then electrophoresed on SDS-PAGE gels, after which they were transferred to nitrocellulose membranes using a transfer blotting device. They were then incubated overnight at 4 °C with rabbit primary antibodies Nrf2, Keap-1, HO-1, NQO1, and β-actin. After washing with PBST, they were incubated for 1 h at room temperature with either rabbit or mouse horseradish peroxidase conjugated anti-IgG-conjugated. Finally, Alliance Image J software was used to perform protein density analysis after development exposure of the protein bands. All protein bands were normalized to β-actin.

Statistical Analysis

Results were expressed as mean ± SD. All statistical comparisons were performed with a one-way analysis of variance test, followed by a least significant difference test. SPSS (version 17, IBM Corporation) was used for data analysis and GraphPad Prism 8.0 was used for drawing. P < .05 was considered significant.

Results

Effects of LBB and LBBET on the Serum Levels of ALT, AST, and ALP in Rats With CCl₄-Induced Liver Injury

Compared to the CON group, the serum levels of ALT, AST, and ALP were significantly increased in the CCl₄ group (P < .05). Supplementation with BC, LBB, and LBBET at different doses in the CCl₄-intoxication group significantly reduced (P < .05) the serum levels of ALT, AST, and ALP compared to the CCl₄ group (P < .05) (Figure 1).

Figure 1.

Effects of LBB and LBBET on the serum levels of ALT (A), AST (B) and ALP (C) in rats with CCl₄-induced liver injury. Data are expressed as mean ± SD (n = 8). #P < .05 in comparison to the CON group; *P < .05 in comparison to the CCl₄ group. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-L, Lycium barbarum betaine in low dosage; LBB-H, Lycium barbarum betaine in high dosage; LBBET-L, Lycium barbarum betaine effervescent tablets in low dosage; LBBET-M, Lycium barbarum betaine effervescent tablets in medium dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage.

Effects of LBB and LBBET on MDA, SOD, and GSH-PX in Liver Tissues

As shown in Figure 2, compared to the CON group, the MDA level in the liver tissue was significantly increased (P < .05) after injection of CCl₄ (2 mL/kg), and the SOD and GSH-PX levels significantly decreased. In contrast, different doses of LBB and LBBET inhibited oxidative damage in liver tissues. MDA levels in liver tissues were significantly lower in the BC, LBB (50, 200 mg/kg), and LBBET (50, 100, 200 mg/kg) groups compared to the CCl₄ group (P < .05). SOD levels in liver tissues were significantly higher in the LBB (100, 200 mg/kg) and LBBET (50, 100, 200 mg/kg) dose groups than in the CCl₄ group (P < .05). Similarly, the level of GSH-PX in liver tissues was significantly higher in the high-dose LBB group, medium-dose LBBET group and high-dose LBBET group (P < .05).

Figure 2.

Effect of LBB and LBBET on liver tissues levels of MDA (A), SOD (B) and GSH-px (C) in rats with CCl₄-induced liver injury. Data are expressed as mean ± SD (n = 6). #P < .05 in comparison to the CON group; *P < .05 in comparison to the CCl₄ group. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-L, Lycium barbarum betaine in low dosage; LBB-H, Lycium barbarum betaine in high dosage; LBBET-L, Lycium barbarum betaine effervescent tablets in low dosage; LBBET-M, Lycium barbarum betaine effervescent tablets in medium dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage.

Light Microscopic Observations of Liver Tissue

Hepatocytes of the CON group were structurally normal. Compared to the CON group, some of the hepatocytes were damaged after CCl₄ administration. There was local inflammatory cell infiltration, a portion of the hepatocytes were damaged and ballooning degeneration occurred. After pretreatment with BC, LBB-L, LBB-M, LBB-H, and LBBET-L, LBBET-M, and LBBET-H, the CCl₄-induced histopathological morphology was mildly improved. BC group, LBB-L group, and LBB-H group had good results, and the effect of the BC group was better than that of the LBB-L group (Figure 3).

Figure 3.

Effects of LBB and LBBET on histopathological changes induced by CCl₄ (H&E, 200×, n = 3). CON, CCl₄, BC, LBB-L, LBB-H, LBBET-L, LBBET-M, and LBBET-H groups are expressed as A-H. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-L, Lycium barbarum betaine in low dosage; LBB-H, Lycium barbarum betaine in high dosage; LBBET-L, Lycium barbarum betaine effervescent tablets in low dosage; LBBET-M, Lycium barbarum betaine effervescent tablets in medium dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage; H&E, hematoxylin and eosin. Ballooning degeneration is shown by red arrows，and inflammatory cell infiltration by black arrows.

Electron Microscopic Observations of Liver Tissue

Transmission electron microscopy showed that the hepatocytes of the CON group were structurally intact, had round nuclei, and an essentially uniform distribution of chromatin in the nuclei. Compared with the CON group, hepatocytes of the CCl₄ group exhibited organelle destruction, poorer hepatocyte structure, obvious cell swelling, sparse chromatin in the nucleus, and smaller nucleoli. After pretreatment with BC, LBB-L, LBB-M, LBB-H, LBBET-L, LBBET-M, and LBBET-H, both cellular structure and chromatin were improved, with the BC, LBB-H, and LBBET-H groups almost restored to a state close to that of the CON group (Figure 4).

Figure 4.

Effects of LLBB and LBBET on ultrastructure of CCl₄-induced hepatic tissue in SD rats (10000×). (n = 3). CON, CCl₄, BC, LBB-L, LBB-H, LBBET-L, LBBET-M, and LBBET-H groups are expressed as A-H. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-L, Lycium barbarum betaine in low dosage; LBB-H, Lycium barbarum betaine in high dosage; LBBET-L, Lycium barbarum betaine effervescent tablets in low dosage; LBBET-M, Lycium barbarum betaine effervescent tablets in medium dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage; SD rats, Sprague-Dawley rats. Cell nucleus is shown by red arrows, and chromatin by yellow arrows.

Effects of LBB and LBBET on Nrf2 Signaling Pathway-Related mRNA Expression in Liver Tissues

Real-time PCR was used to detect the mRNA expression of related transcripts of the Nrf2 signaling pathway. As shown in Figure 5, compared with the CON group, the transcript levels of Nrf2, HO-1 and NQO1 mRNA in the CCl₄ group were significantly reduced (P < .05). In contrast, Nrf2 mRNA expression was significantly increased in the LBB-H group compared to the CCl₄ group (P < .05), but the differences were not statistically significant in the BC group and the other different dose groups of LBB and LBBET. HO-1 mRNA expression was significantly elevated in the LBB-H and the LBBET-H groups compared to the CCl₄ group (P < .05), but the differences were not statistically significant in the BC group and the other different dose groups of LBB and LBBET. NQO1 mRNA expression was significantly increased in the LBB-H group compared to the CCl₄ group (P < .05); the differences were not statistically significant in the BC group and the other different dose groups of LBB and LBBET.

Figure 5.

Effects of LBB and LBBET on the expression of Nrf2 (A), HO-1 (B) and NQO1 (C) mRNA in the liver. Data are expressed as mean ± SD (n = 3). #P < .05 in comparison to the CON group; *P < .05 in comparison to the CCl₄ group. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-H, Lycium barbarum betaine in high dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage.

Effects of LBB and LBBET on Nrf2 Signaling Pathway Related Protein Expression in CCl₄-Induced Liver Tissues

We investigated the expression of Nrf2 signaling pathway-related proteins (Figure 6). As a result, the expression of Nrf2, NQO1, and HO-1 protein was significantly lower in the CCl₄ group than in the CON group (P < .05). Also, Keap1 protein expression was significantly increased (P < .05). In contrast, the expression levels of antioxidant proteins such as Nrf2, NQO1, and HO-1 in the Nrf2 pathway were increased, and the expression levels of Keap1 protein were significantly decreased after pretreatment with BC and high doses of LBB and high doses of LBBET compared with the CCl₄ group (P < .05). These results suggest that CCl₄ can disrupt the antioxidant system by depleting Nrf2 in vivo, whereas LBB and LBBET can exert their antioxidant effects by regulating the expression of Nrf2 pathway antioxidant proteins.

Figure 6.

Effects of LBB and LBBET on the expression of Nrf2 (B), Keap1 (C), Keap1 (D) and NQO1 (E) in the liver. Data are expressed as mean ± SD (n = 3). #P < .05 in comparison to the CON group; *P < .05 in comparison to the CCl₄ group. Abbreviations: CON, control; CCl₄, carbon tetrachloride; BC, bifendate control group; LBB-H, Lycium barbarum betaine in high dosage; LBBET-H, Lycium barbarum betaine effervescent tablets in high dosage.

Discussion

CCl₄ is a well-known toxic substance and a commonly used compound in the dry cleaning industry. CCl₄ contamination in the environment can be absorbed by the body.³³ The purpose of this study was to investigate the protective effect of LBB and LBBET against CCl₄-induced liver injury. In this study, it was confirmed that liver damage caused by CCl₄ can be remarkably alleviated by using LBB and LBBET as raw materials. CCl₄ causes hepatocyte damage and alters membrane integrity, resulting in enzyme leakage from hepatocytes.³⁴ The cytochrome P450 system metabolizes CCl₄ to trichloromethyl radical (CCl₃⁻) and trichloromethyl peroxyl radical (CCl₃OO⁻), accumulating lipid-derived oxidation products and thiobarbituric acid reactive substances, which damage cell membranes, and eventually lead to liver disease.³⁵ Concomitantly, the levels of SOD, MDA, and other relevant lipid peroxidation indices were altered in liver tissue,³⁶ promoting the release of various enzymes from hepatocytes into the bloodstream, including ALT, AST, ALP.³⁷ One study showed that the serum levels of ALT, AST, ALP were significantly higher in the CCl₄ group of rats compared to the CON group, indicating that the injection of CCl₄ could cause acute liver function damage, while after the treatment with gooseberry and black mulberry extracts, the levels of ALT, AST, and ALP in liver were significantly reduced.³⁸ Our results are consistent with the above. The levels of SOD and GSH-PX were significantly decreased and the levels of MDA were significantly increased in the liver tissue of rats with acute liver injury by CCl₄. After LBB and LBBET pretreatment, the levels of SOD and GSH-PX were significantly increased and the levels of MDA were significantly decreased, which is consistent with previous reports,³⁹ after pretreatment with LBB and LBBET. The levels of SOD and GSH-PX were much higher, whereas the levels of MDA were significantly lower.

CCl₄ administration in rats has been shown to induce severe hepatic portal fibrosis, inflammatory cell infiltration, ballooning degeneration, and local hepatocellular necrosis.^38,39 In this study, localized inflammatory cell infiltration, balloon-like degeneration, and a significant degree of damage were observed in the liver of the CCl₄ group. To further observe some of the changes occurring in the liver, we also used transmission electron microscopy to investigate the liver ultrastructure. The results showed that the nuclear structure of rat hepatocytes injected with CCl₄ was damaged, resulting in visible cell swelling and sparse chromatin in the nucleus. The above changes in hepatic ultrastructure indicated that the injection of CCl₄ caused liver injury in rats.⁴⁰ It is known from this study that LBB and LBBET can help restore hepatocyte nuclear structure, after CCl₄-induced liver injury in rats.

The Nrf2 signaling pathway plays a key role in combating oxidative stress, inflammation, and cell death.⁴¹ Exposure to CCl₄ is known to weaken the Nrf2 antioxidant defense system and exacerbate oxidative damage in the liver.^12,42 However, when cells are attacked by ROS, Nrf2 is dissociated from Keap1 and rapidly translocated to the nucleus, where it binds to the nucleus ***antioxidant response element (ARE), forms heterodimers with small maf proteins, and then binds to the ARE to activate transcriptionally the expression of antioxidant factor genes regulated by Nrf2, such as NQO1 and HO-1.⁴¹ Under normal circumstances, Keap1 anchors Nrf2 in the cytoplasm and prevents Nrf2 from transferring allosterically to the nucleus.⁴³ One study showed that L barbarum polysaccharide had a protective effect against lead-induced kidney injury in rats by activating the Nrf2 pathway,⁴⁴ and another study showed that baicalin activated the Nrf2 pathway to have a protective effect against CCl₄-induced acute liver damage in mice.⁴⁵ Our results showed that compared with the CON group, CCl₄ induced a decrease in the expression of Nrf2 mRNA, HO-1 mRNA, NQO1 mRNA, Nrf2 protein, HO-1 protein, and NQO1 protein and increased expression of Keap1 protein in rat liver. LBB and LBBET treatment significantly increased the expression of Nrf2 mRNA, HO-1 mRNA, and NQO1 mRNA, but significantly down-regulated the expression of Keap1 protein, suggesting that LBB can also rescue rats from CCl₄-induced acute liver damage by stimulating the Nrf2 signaling pathway.

Betaine has been demonstrated to have a protective effect against several types of liver injury in numerous previous investigations. A recent study showed that betaine reduces the disruption of hepatic lipid and iron homeostasis caused by a high-fat diet in mice.⁴⁶ Another study showed that betaine could alleviate liver damage caused by ionizing radiation.⁴⁷ As a functional food or pharmaceutical formulation, effervescent tablets can be used as a new formulation for patients who have difficulty swallowing ordinary tablets or capsules, and can also be improved by adding sweeteners to improve the taste. Previous research showed that effervescent red algal sulfated polysaccharide tablets reduced ovalbumin-induced anaphylaxis by increasing regulatory T cells.⁴⁸ In addition, Solenostemma argel effervescent tablets have been shown to inhibit CCl₄-induced hepatic lipid peroxidation in mice.⁴⁹ Our study also demonstrated the protective effect of LBB effervescent tablets against CCl₄-induced acute liver injury in rats. This study has several limitations in that it did not explore the effect of the effervescent tablets excipients on rats and did not investigate the effect of these excipients on the hepatoprotective effect of LBBET in animal experiments. Yet, this study provides a new perspective on the improvement of liver damage caused by CCl₄ intake by LBB, and provides a basis and new ideas for the development of functional foods or drugs related to the field of liver protection.

Conclusion

In conclusion, this study demonstrates that CCl₄ can cause liver damage through oxidative stress. LBB and LBBET ameliorated CCl₄-induced acute liver injury in rats by up-regulating antioxidant defenses (SOD, GSH-PX) and down-regulating oxidative stress (MDA) through a mechanism that may be related to activation of the Nrf2 pathway (Figure 7). This implies that LBB and LBBET may be promising hepatoprotective agents against CCl₄ and can be candidates for the development of functional foods or medicine.

Figure 7.

Potential mechanism of LBB and LBBET-mediated alleviation of CCl₄-induced liver injury. Abbreviations: LBBET, Lycium barbarum betaine effervescent tablet; LBB, Lycium barbarum betaine.

Footnotes

Acknowledgments

This research is supported by the Qinghai Provincial Science and Technology Innovation and Entrepreneurship Talent Project (Qingke Fazheng [2019] No. 191).

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Qinghai Provincial Science and Technology Innovation and Entrepreneurship Talent Project (grant number: Qingke Fazheng [2019] No. 191).

Ethical Approval

All animal care and use procedures were approved by the Medical Ethics Committee of Qinghai University School of Medicine (2019-1), and were performed in accordance with the Guide for Care and Use of Laboratory Animals (National Institutes of Health Publication NO 85-23, raised 1996).

ORCID iD

Yuqing Zhai

References

Ahmed

Eldemardash

Ali

. Antioxidant and hepatoprotective effects of ethanolic extracts of Faidherbia albida fruits and stem bark against carbon tetrachloride induced liver damage in rats. JAVS. 2019;20(1):1‐8.

Derakhshesh

Salamat

Movahedinia

Hashemitabar

Bayati

. Corrigendum to “exposure of liver cell culture from the orange-spotted grouper, Epinephelus coioides, to benzo[a]pyrene and light results in oxidative damage as measured by antioxidant enzymes”. Chemosphere. 2019;226:534‐544.

Liu

Tan

Long

, et al. Improvement effect of lotus leaf flavonoids on carbon tetrachloride-induced liver injury in mice. Biomedicines. 2020;8:41.

Niu

Cui

, et al. Involvement of TGF-β1/Smad3 signaling in carbon tetrachloride-induced acute liver injury in mice. PLoS One. 2016;11:e0156090.

Cong

Zhao

Liu

, et al. Protective effect of human serum amyloid p on CCl₄-induced acute liver injury in mice. Int J Mol Med. 2017;40:454‐464.

Zhang

Wang

, et al. Obeticholic acid protects against carbon tetrachloride-induced acute liver injury and inflammation. Toxicol Appl Pharmacol. 2017;314:39‐47.

Xiao

Liong

Huang

, et al. Cyclooxygenase-1 serves a vital hepato-protective function in chemically induced acute liver injury. Toxicol Sci. 2015;143:430‐440.

Wang

Luo

, et al. Investigation of the therapeutic effect of total alkaloids of Corydalis saxicola bunting on CCl₄-induced liver fibrosis in rats by LC/MS-based metabolomics analysis and network pharmacology. Metabolites. 2023;13(1):9.

Paulpriya

Tresina

Mohan

. Hepatoprotective effect of Crotalaria longipes Wight and Arn, ethanol extract in CCl₄ induced hepatotoxicity in Wistar rats. Int J Toxicol Pharmacol Res. 2016;8:45‐52.

10.

Wang

Niu

Deng

Wang

. Zerumbone protects against carbon tetrachloride (CCl₄)-induced acute liver injury in mice via inhibiting oxidative stress and the inflammatory response: involving the TLR4/NFκB/COX-2 pathway. Molecules. 2019;24:1964.

11.

Peng

Dai

Liu

Qiu

. Curcumin attenuates on carbon tetrachloride-induced acute liver injury in mice via modulation of the Nrf2/HO-1 and TGF-β1/Smad3 pathway. Molecules. 2018;23:215.

12.

Dai

Xiao

, et al. Chloroquine ameliorates carbon tetrachloride-induced acute liver injury in mice via the concomitant inhibition of inflammation and induction of apoptosis. Cell Death Dis. 2018;9:1164.

13.

Guo

Yin

Liu

Wang

. Non-alcoholic fatty liver disease (NAFLD) pathogenesis and natural products for prevention and treatment. Int J Mol Sci. 2022;23(24):15489.

14.

Yao

Heinrich

Weckerle

. The genus Lycium as food and medicine: a botanical, ethnobotanical and historical review. J Ethnopharmacol. 2018;212:50‐66.

15.

Gao

Wei

Wang

Gao

Chen

. Lycium barbarum: a traditional Chinese herb and a promising anti-aging agent. Aging Dis. 2017;8:778.

16.

Guo

Zhang

, et al. Comparison of functional components and antioxidant activity of Lycium barbarum L. fruits from different regions in China. Molecules. 2019;24:2228.

17.

Christopher

Stephen

. Betaine chemistry, roles, and potential use in liver disease. Biochim Biophys Acta. 2016;1860(6):1098‐1106.

18.

Younossi

Koenig

Abdelatif

Fazel

Henry

Wymer

. Global epidemiology of nonalcoholic fatty liver disease-meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology. 2016;64:73‐84.

19.

Datz

Felder

Niederseer

Aigner

. Iron homeostasis in the metabolic syndrome. Eur J Clin Investig. 2013;43:215‐224.

20.

Yang

Wan

Yang

. Hyperhomocysteinemia induced by methionine excess is effectively suppressed by betaine in geese. Animals (Basel). 2020;10(9):1642.

21.

Liu

Song

, et al. Betaine promotes fat accumulation and reduces injury in Landes goose hepatocytes by regulating multiple lipid metabolism pathways. Animals (Basel). 2022;12(12):1530.

22.

Zawieja

Durkalec-Michalski

Muzsik-Kazimierska

Chmurzynska

. The effect of 3-week betaine supplementation on blood biomarkers of cardiometabolic health in young physically active males. Metabolites. 2022;12(8):731.

23.

Ying

Rahbar

Hallman

, et al. Associations between dietary intake of choline and betaine and lung cancer risk. Plos One. 2013;8(2):e54561.

24.

Veskovica

Mladenovica

Milenkovicb

, et al. Betaine modulates oxidative stress, inflammation, apoptosis, autophagy, and akt/mtor signaling in methionine-choline deficiency-induced fatty liver disease. Eur J Pharmaco. 2019;848:39‐48.

25.

Ahn

Park

Chae

, et al. Hepatoprotective effects of Lycium chinense Miller fruit and its constituent betaine in CCl₄-induced hepatic damage in rats. Acta Histochem. 2014;116(6):1104‐1112.

26.

Junnila

Rahko

Sukura

Lindberg

. Reduction of carbon tetrachloride-induced hepatotoxic effects by oral administration of betaine in male Han-Wistar rats: a morphometric histological study. Vet Pathol. 2000;37(3):231‐238.

27.

Murakami

Nagamura

Hirano

. The recovering effect of betaine on carbon tetrachloride-induced liver injury. J Nutr Sci Vitaminol. 1998;44(2):249‐255.

28.

Dai

Wei

Chen

. Tongluo Xingnao effervescent tablet reverses memory deficit and reduces plaque load in APPswe/PS1dE9 mice. Exp Ther Med. 2018;15:4005‐4013.

29.

Muñoz

Castan

Clares

Ruiz

. Obtaining fast dissolving disintegrating tablets with different doses of melatonin. Int J Pharm. 2014;467:84‐89.

30.

Jiang

Gao

Sun

, et al. Protective effect of L-theanine on carbon tetrachloride-induced acute liver injury in mice. Biochem Biophys Res Commun. 2012;422:344‐350.

31.

Sheng

Guo

, et al. Protective effects and mechanisms of sea buckthorn sterol against carbon tetrachloride-induced acute liver injury in rats. Molecules. 2022;27:2224.

32.

Donmez

Kacar

Bagci

Sahinturk

. Protective effect of carnosic acid on acrylamide-induced liver toxicity in rats: mechanistic approach over Nrf2-Keap1 pathway. Biochem Mol Toxicol. 2020;34:e22524.

33.

Jin

Huang

, et al. Shh-Yap signaling controls hepatic ductular reactions in CCl₄-induced liver injury. Environ Toxico. 2020:1‐10.

34.

Tao

Yue

, et al. Hepatoprotective effect of the Penthorum chinense Pursh extract against the CCl₄-induced acute liver injury via NF-κB and p38-MAPK pathways in dogs. Animals (Basel). 2022;12:569.

35.

Jaeschke

. Reactive oxygen and mechanisms of inflammatory liver injury: present concepts. Eur J Gastroen Hepat. 2011;26(1):173‐179.

36.

Liu

Wen

Zhang

Dai

. Breviscapine ameliorates CCl₄ induced liver injury in mice through inhibiting inflammatory apoptotic response and ROS generation. Int J Mol Med. 2018;42:755‐768.

37.

Xiong

Ren

Cui

Wang

Zhang

. Obeticholic acid protects mice against lipopolysaccharide-induced liver injury and inflammation. Biomed Pharmacother. 2017;96:1292‐1298.

38.

Elmasry

Moawad

. The hepatoprotective effect of gooseberry and black mulberry extracts against carbon tetrachloride-induced liver injury in rats. J Basic Appl Zoo. 2021;82(1):33.

39.

Zhang

Feng

Huang

. Hepatoprotective effects of Camellia nitidissima aqueous ethanol extract against CCl₄-induced acute liver injury in SD rats related to Nrf2 and NF-κB signalling. Pharm Bio. 2020;58(1):239‐246.

40.

Wang

Liu

Wei

Zhao

Zhu

Zhou

. Mitochondrial respiratory chain damage and mitochondrial fusion disorder are involved in liver dysfunction of fluoride-induced mice. Chemosphere. 2020;241:125099.

41.

Wang

Liu

Sha

. The anti-inflammatory and anti-oxidant mechanisms of the Keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging Dis. 2019;10:637‐651.

42.

Zhang

, et al. Hepatoprotective activity of ethanol extract of rice solid-state fermentation of Ganoderma tsugae against CCl₄-induced acute liver injury in mice. Molecules. 2022;27(16):5347.

43.

Zhang

Zhao

Jiang

, et al. Bacillus amyloliquefaciens lysate ameliorates photoaging of human skin fibroblasts through NRF2/KEAP1 and TGF-β/SMAD signaling pathways. Appl Sci. 2022;12:9151.

44.

Xie

Huang

Guo

Chen

Zhou

. Study on the efficacy and mechanism of Lycium barbarum polysaccharide against lead-induced renal injury in mice. Nutrients. 2021;13:2945.

45.

Dai

Wang

Tang

Velkov

Shen

. Inhibition of oxidative stress and ALOX12 and NF-κB pathways contribute to the protective effect of baicalein on carbon tetrachloride-induced acute liver injury. Antioxidants. 2021;10:976.

46.

Jiang

Feng

Jia

Zhao

. Betaine alleviates high-fat diet-induced disruption of hepatic lipid and iron homeostasis in mice. Int J Mol Sci. 2022;23:6263.

47.

Shedid

Abdel-Magied

Saada

. Role of betaine in liver injury induced by the exposure to ionizing radiation. Environ Toxico. 2018:1‐8.

48.

Han

Liu

, et al. Red algae sulfated polysaccharides effervescent tablets attenuated ovalbumin-induced anaphylaxis by upregulating regulatory T cells in mouse models. J Agr Food Chem. 2019;67(43):11911‐11921.

49.

Suliman

Ali

Alhelal

, et al. Antioxidant properties of Solenostemma argel effervescent tablets. Curr Pharm Biotechnol. 2019;20:679‐688.

The Protective Effect of Lycium barbarum Betaine and Effervescent Tablet Against Carbon Tetrachloride-Induced Acute Liver Injury in Rats

Abstract

Keywords

Introduction

Materials and Methods

Chemicals and Reagents

Extraction and Purification of L barbarum Betaine

Preparation of LBBETs

Animals and Experimental Design

Sample Collection

Histopathological Studies

Transmission Electron Microscopy

Measurement of the AST, ALT, and ALP Indexes in Serum

Assessment of Oxidative Stress in the Liver

Real-Time Polymerase Chain Reaction

Western Blot Analysis

Statistical Analysis

Results

Effects of LBB and LBBET on the Serum Levels of ALT, AST, and ALP in Rats With CCl4-Induced Liver Injury

Effects of LBB and LBBET on MDA, SOD, and GSH-PX in Liver Tissues

Light Microscopic Observations of Liver Tissue

Electron Microscopic Observations of Liver Tissue

Effects of LBB and LBBET on Nrf2 Signaling Pathway-Related mRNA Expression in Liver Tissues

Effects of LBB and LBBET on Nrf2 Signaling Pathway Related Protein Expression in CCl4-Induced Liver Tissues

Discussion

Conclusion

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

Ethical Approval

ORCID iD

References

Effects of LBB and LBBET on the Serum Levels of ALT, AST, and ALP in Rats With CCl₄-Induced Liver Injury

Effects of LBB and LBBET on Nrf2 Signaling Pathway Related Protein Expression in CCl₄-Induced Liver Tissues