Sage Journals: Discover world-class research

Abstract

Living on a high-fat, high-calorie, and high-protein diet for a long period may compromise human immunity due to the long-term accumulation of free radicals and plasma lipids. The antioxidant and lipid-lowering compounds (ie polyphenols and vitamin E) in Camellia oil help to decrease the risk of numerous ailments, including cardiovascular disease (CVD), and obesity.

The aims of this study were to study the hypolipidemic and antioxidant effects of Camellia oil in high-fat-fed rats and to promote the high-value use of camellia resources. The high-fat-fed rats were administrated with 2.5, 7.5, and 15 mL/kg BW Camellia oil (Camellia oil group), and 10 mg/kg BW atorvastatin (atorvastatin group), respectively, and compared with a model group (only fed with high fat) and a control group (fed with basal diet). Several parameters were measured, including (1) body weight (BW), liver-to-BW ratio; (2) plasma total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C); and (3) alanine aminotransferase (ALT), alanine aminotransferase (AST), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) activity, model driven architecture (MDA) content, lipid metabolism-related genes, and antioxidant-related genes in liver tissue.

Compared with the model group, the high-fat-fed rats in the Camellia oil and atorvastatin group had significantly lower BW and liver-to-BW ratio (P < .01), plasma TC, TG, and LDL-C levels and ALT and AST activities, but higher HDL-C levels. The relative expressions of ACAT1, DGAT2, FAS, and SREBP genes were significantly reduced in the Camellia oil and atorvastatin groups, while the relative expressions of LCAT, UCP2, MCD, and CPT-1 genes were significantly increased. The rats in the Camellia oil group showed significantly higher SOD and GSH-Px activities, significantly lower MDA content, and significantly higher relative expression of antioxidant genes (eg SOD1, GPx1, CAT, and Gclm). Thus, atorvastatin and Camellia oil exhibited significant hypolipidemic and antioxidant effects, which were better at a dose of 7.5 mL/kg (BW) of Camellia oil. Therefore, Camellia oil becomes a potential new natural resource for future research and development of antioxidant and hypolipidemic drugs, nutraceuticals, and additives.

Keywords

camellia oil rat hypolipidemic antioxidant liver protection

Introduction

Camellia oleifera Abel, family Theaceae, which is found in mountainous and hilly areas around the world, is one of the 4 major woody oil species in the world and one of the oldest woody edible vegetable oils in China.^1,2 The oil of C oleifera, which is extracted from the seeds, was the first hygienic vegetable edible oil promoted by Food and Agriculture Organization (FAO). It contains a variety of substances, such as camellia saponins, polyphenols, squalene, VE, and unsaturated fatty acids,^3–6 which have health benefits, including improving blood circulation, softening blood vessels, lowering blood lipids, and scavenging oxygen free radicals.^7–9

With the improvement in people's living standards, the consumption of high-fat, high-calorie, and high-protein food in large quantities promotes a rapid increase in oxygen free radicals and blood lipid levels in the human body.^10–12 Free radicals have a strong oxidizing ability that breaks down cells, producing a series of irreversible damage and affecting normal cell metabolism, accelerating the aging of the body.¹³ Meanwhile, hyperlipidemia promotes the deposition of fat in the blood vessels, decreasing the speed of blood flow through the arteries and increasing the risk of CVD and related mortality.^14,15 Previous studies have shown that a 70% ethanol extract of C oleifera has antioxidant and antimelanogenic activities.¹⁶ Moreover, water-soluble polysaccharides of C oleifera have antitumor and antioxidant activities.¹⁷ However, references to the antioxidation and hypolipidemic effect of C oleifera fruit oil remain unavailable. Therefore, in this study, the effects of the oil on hypolipidemic and antioxidant capacity in rats fed a high-fat diet were analyzed and the related mechanisms of action were explored.

This study had three aims: (1) to evaluate the hypolipidemic and antioxidant capacity of Camellia oil in rats; (2) to provide a theoretical basis for the future development of health foods and pharmaceutical products using Camellia oil, and to enrich the research base, both nationally and internationally; and (3) to improve the comprehensive benefits of Camellia oil, promote the sustainable and efficient development of the camellia industry and promote its economic value.

Methods

Chemicals

TC, triglyceride (TG), HDL-C, LDL-C, ALT, and AST kits were purchased from Mairui Medical Procedure Electronics Co. Ltd, Shenzhen, China, MDA, SOD, and GSH-Px kits from Nanjing Jiancheng Institute of Bioengineering, Changsha, China, Atorvastatin from Beida Weixin Biotechnology Co. Ltd, Beijing, China, DEPC and Trizo land RNA reverse transcription kits from Full-style Gold Biotechnology Co. Ltd, Beijing, China, Real-time Quantitative PCR Detecting System (qPCR) primers from Bioengineering Technology Co. Ltd, Shanghai, China, and basal and high-fat diets from Slake Jingda Laboratory Animal Co. Ltd, Changsha, China. The detailed ingredients of the diet are shown in Table 1.

Table 1.

Composition of the Experimental Diets (%).

Ingredient	Basal diet	High fat diet
Corn starch	43%	30%
Fiber	7%	5%
Mineral mix	6%	4%
Casein	29%	20%
Vitamin mix	1%	0.8%
Canola	7%	5%
Sucrose	7%	15%
Cholesterol	0	4%
Yolk powder	0	6%
Lard	0	10%
Bile salt	0	0.2%
Total	100%	100%

Preparation of Camellia oil

30 g C oleifera powder and 300 mL distilled water were added in a 500 mL conical bottle, and ultrasonicallyextracted under 400 W and a pH of 9 for 30 minutes. Enzyme hydrolysis was achieved with 2% alkaline procamelliase at 53 °C for 2.5 h. The enzymes were then inactivated by heating in a water bath at 90 °C for 10 min. The mixture was then centrifuged for 20 min at 5000 r/min. The supernatant, in a separating funnel, was extracted with 25 mL light petroleum, and the extract was evaporated under vacuum to remove the solvent. The composition of the oil is shown in Table 2.

Table 2.

Composition of Camellia oleifera.

Camellia Seeds composition	Protein	Cellulose	Starch	Water	Fatty acid	Ash	Other	Selenium
Camellia Seeds composition	13.0%	11.3%	14.5%	6.7%	35.1%	5.1%	14.2%	0.08 mg/kg
Camellia oil composition	Palmitic acid	Stearic acid	Oleic acid	Linoleic acid	α-linolenic acid	Squalene	Sterol	VE
Camellia oil composition	8.8%	2.1%	10.2%	8.0%	60.6%	0.6%	0.8%	0.1%

Animals

Male Sprague Dawley (SD) rats of SPF grade, BW about 125 g, were purchased from Slake Jingda Laboratory Animal Co. Ltd, Changsha, China. Sixty healthy male rats were randomly divided into 6 groups according to their BW after 1 week of adaptive feeding. Animals were grouped and treated as described by Chou et al (Table 3).^18,19 Rats were fed in individual cages on either a basal or high-fat diet. Feeding conditions were as followed: room temperature 22 to 25 °C (humidity: 40%-70%), 12-hour cycle alternating light and dark, free drinking water, good ventilation, change of bedding every other day, weekly cleaning, and disinfection of cages. The atorvastatin and Camellia oil groups were dosed orally once a day at 9:30 am. For the rest of the day, the animals could drink (water) and eat ad libitum for 6 weeks.²⁰ After the last administration, the animals were fasted for 12 h, but could drink freely. After that, blood and liver tissues were taken to determine their enzyme activity and gene expression level. All investigations were carried out with reference to the Technical Specification for the Inspection and Evaluation of Health Food issued by the National Health Commission of China in 2003 under license [2003] No. 42.

Table 3.

Design of Experimental Animal Groups.

Group	Number	Status	Feed	Dose
Control group	10	Normal	Basal diet	10 mL/kg^.BW Normal saline
Model group	10	Normal	High-fat diet	10 mL/kg^.BW Normal saline
Atorvastatin group	10	Normal	High-fat diet	10 mg/kg^.BW Atorvastatin
Low-dose group	10	Normal	High-fat diet	2.5 mL/kg^.BW Camellia oil
Medium-dose group	10	Normal	High-fat diet	7.5 mL/kg^.BW Camellia oil
High-dose group	10	Normal	High-fat diet	15 mL/kg^.BW Camellia oil

Determination of Body Condition

The SD rats were observed daily for hair color, activity, dietary status, and mental condition. Liver weight and BW were measured and recorded.

Determination of Serum Indicators

The levels of TG, TC, HDL-C, and LDL-C, and the activities of ALT and AST were measured in the blood of rats, according to the kit instructions.

Determination of Antioxidant Indicators

The liver homogenate was frozen, centrifuged at 4000 r/min for 10 min at 4 °C, and the supernatant was collected. The SOD and GSH-Px activities and MDA content were measured according to the kit instructions.

Real-Time Quantitative PCR Analysis

RNA was extracted using a trizol kit. RNA was reverse transcribed into cDNA and then PCR amplified using genomic DNA as the template (see Table 4 for primer sequences). RT-PCR reaction system: 10 µL SYBR Green qPCR SuperMix, 1 µL template, 1 µL upstream primer (10nM), 1 µL downstream primer (10nM), supplemented with double distilled water to 20 µL. Reaction conditions were as follows: pre-denaturation at 94 °C for 30 s, denaturation at 94 °C for 5 s, annealing at 60 °C for 15 s, fluorescence detection for 15 s, 40 cycles. Relative quantitative 2^ΔΔCt analysis (CT value comparison method) was performed using β-actin as an internal reference to calculate the relative expression of each gene in the samples.

Table 4.

Primer Sequences Used in qPCR Analysis.

Gene name	Upstream primers (5’-3’)	Downstream primers (5’-3’)
β-actin	CCACCATGTACCCAGGCATT	AGGGTGTAAAACGCAGCTCA
ACAT1	CAGGTCTACCCATTGCCACT	ACCGTATGGTGTTGCTCCTC
DGAT2	CCTAAGGTGGTGGCTGACAT	CTGACCAGCAGTCACGTGTT
LCAT	CTGGCTTTGGCAAGACCTAC	TACCAGTCCTGCCAGCTTCT
UCP2	CGGAGATACCAGAGCACTGTC	TGGCATTTCGGGCAACATTGG
MCD	CGGCACCTTCCTCATAAAGC	TGGAAAAGGCCCCCAGAT
CPT-1	CACTGGCCGCATGTCAAG	CCCAGAGCCCTGTACCAAAG
FAS	AGGCTGAGGCTGAAGCTGAA	GATGAGGTCCACAGCAGCAG
SREBP	GCTTCTCTTCTGCTTCTCTGG	CAGGCTGTAGGATGGTGAGTG
SOD1	CCACTGCAGGACCTCATTTTAAT	TCTCCAACATGCCTCTCTTCATC
GPx1	CATCAGGAGAATGGCAAGAA	TCACCTCGCACTTCTCAAAC
CAT	CCCGAGTCCAGGCTCTTCT	CGGCCTGTACGTAGGTGTGA
Gclm	TGTGTGATGCCACCAGATTT	GCTTTTCACGATGACCGAGT

Statistical Analysis

Data were analyzed by SPSS 16.0. All data are presented as mean values with SD (mean ± SD, n = 3). Statistical analyses were performed using Student's t-test, ANOVA, and LSD multiple comparison tests at the 95% confidence level. Statistical differences were considered to be *P < .01 and ^#P < .01.

Results

Effect of Camellia oil on BW of Rats Fed With High-fat Diet

The effects of Camellia oil and atorvastatin on the BW and liver weight of rats are shown in Table 5. The initial body mass of rats was 159 to 166 g in each group. The BW of rats was significantly increased in each group when they were treated with feed for 6 weeks. The BW and liver to BW ratio of rats were highest in the model group, reaching 402.6g and 4.4%, respectively. There was no significant difference in the liver-to-BW ratio between the model group and low-dose group, but a significant difference was shown between the model group and medium and high-dose groups (P< .01). Compared to the model group, the BW of rats fed with a high-fat diet was significantly decreased in the Camellia oil and atorvastatin groups, with the effect of the Camellia oil group being slightly better than that of the atorvastatin group. The medium dose (7.5 mL/kg.BW) of Camellia oil produced the best effect.

Table 5.

Effect on BW of Rats.

Group	Initial weight (g)	Final weight (g)	Weight gain (g)	Liver body ratio (%)
Control group	163.3 ± 5.2	361.6 ± 7.83	198.3 ± 8.5	3.6 ± 0.5
Model group	159.6 ± 4.3	402.6 ± 6.7	243.1 ± 9.4	4.4 ± 0.9
Atorvastatin group	166.8 ± 3.7*	369.5 ± 10.5*#	202.7 ± 7.0*	3.9 ± 0.7*
Low-dose group	160.9 ± 5.4	359.7 ± 14.0*	198.9 ± 8.0*	4.1 ± 0.5#
Medium-dose group	162.8 ± 4.2	354.4 ± 10.4*#	191.6 ± 11.1*#	3.7 ± 0.5*
High-dose group	161.5 ± 4.8	366.8 ± 14.2*	205.3 ± 10.6*#	3.9 ± 0.6*

Note: Compared with model group, *P < .01; Compared with control group, #P < .01.

Histopathological Evaluation

Representative images of the liver tissue pathology of each group are shown in Figure 1. Figure 1B and D clearly depict the accumulation of lipid droplets in the hepatocytes. Moreover, a mild dysregulation of liver structure appeared to be evident in the rats. Interestingly, the weight loss treatment appeared to reverse the aforementioned steatosis. Little difference was observed in the histopathological specimens of the control (Figure 1A), medium dose (Figure 1E), and atorvastatin groups of rats (Figure 1C).

Figure 1.

Histopathological analysis of liver. The photos were made at 100 magnifications. (A) Represents the control group, (B) the model group (lipid droplets accumulating in the hepatocytes, arrows), (C) the atorvastatin group, (D) the low-dose group, (E) the medium-dose group, and (F) the high-dose group.

Effect of Camellia oil on Blood Lipid in Rats Fed with High-fat Diet

The effects of Camellia oil and atorvastatin on blood lipids in rats fed with a high-fat diet are shown in Table 6. When compared to the model groups, the TC levels in the Camellia oil and atorvastatin groups decreased to some extent (P < .01), while there was no significant difference between the low-dose Camellia oil group and the model group (3.11 mmol·L⁻¹). Atorvastatin and medium-dose Camellia oil treatments were the most effective and were not significantly different from the control group (P > .01). Compared to the model group, TG levels decreased to some extent in both the Camellia oil and atorvastatin groups, but both were higher than the control group (P < .01). Although Camellia oil and atorvastatin had some effect on reducing TG levels, they were still higher than those of the control. HDL-C levels were significantly higher in the medium-dose Camellia oil group (1.69 mmol·L⁻¹) than in the model group, with no significant differences between other doses of Camellia oil and atorvastatin. The LDL-C level in the Camellia oil and atorvastatin groups was significantly lower than that in the model group (P < .01).

Table 6.

Effects on Serum Lipid Levels of Rats.

Group	TC (mmol·L⁻¹)	TG (mmol·L⁻¹)	HDL-C (mmol·L⁻¹)	LDL-C (mmol·L⁻¹)
Control group	2.06 ± 0.23	1.07 ± 0.26	1.64 ± 0.08	0.61 ± 0.11
Model group	3.11 ± 0.21	2.58 ± 0.21	1.42 ± 0.14	1.26 ± 0.10
Atorvastatin group	2.29 ± 0.26*	1.91 ± 0.34*#	1.57 ± 0.13	0.72 ± 0.14*
Low-dose group	2.79 ± 0.31#	2.02 ± 0.28#	1.51 ± 0.12	0.76 ± 0.13*
Medium-dose group	2.38 ± 0.33*	1.69 ± 0.46#	1.69 ± 0.21*	0.66 ± 0.08*
High-dose group	2.60 ± 0.18*#	1.98 ± 0.23*#	1.49 ± 0.10	0.79 ± 0.12*

Abbreviation: TG: triglyceride.

Effect of Camellia oil on serum Enzyme Activity in Rats Fed With High-fat Diet

The effects of Camellia oil and atorvastatin on ALT and AST activities in high-fat-fed rats are shown in Table 7. The highest activities of the two enzymes in the model group reached 81.6 U^.L⁻¹ and 125.7 U^.L⁻¹, respectively. The activities of the two enzymes in the Camellia oil and atorvastatin groups were significantly decreased and were significantly different from those in the model group (P < .01). The ALT activity of the medium-dose Camellia oil group was not significantly different from that of the control group, but was much higher than that of the control group in the other doses of Camellia oil and atorvastatin groups. AST activity was much higher in the Camellia oil and atorvastatin groups than in the control group. These results suggest that Camellia oil and atorvastatin can alleviate and repair liver damage in rats fed a high-fat diet, but cannot completely prevent the damage from occurring.

Table 7.

Effect on ALT and AST in Serum of Rats.

Group	Animals number (n)	ALT (U·L⁻¹)	AST (U·L⁻¹)
Control group	10	57.4 ± 7.7	84.6 ± 10.4
Model group	10	81.6 ± 10.3	125.7 ± 12.6
Atorvastatin group	10	63.2 ± 5.9*#	101.3 ± 17.1*#
Low-dose group	10	67.7 ± 6.8*#	107.5 ± 9.2*#
Medium-dose group	10	60.3 ± 11.2*	98.2 ± 8.3*#
High-dose group	10	67.8 ± 8.2*#	112.5 ± 11.1*#

Effect of Camellia oil on Lipid Metabolism Gene Expression in Rats Fed With High-fat Diet

The effects of Camellia oil and atorvastatin on the expression of lipid metabolism-related genes in liver tissues of rats fed with high-fat diet are shown in Figure 2. The relative expression of ACAT1 gene was very high (1.57) in the model group and lowest in the atorvastatin group at only 61.8% of the model group and also lower than the Camellia oil group. The relative expression of DGAT2 gene was the highest (1.48) in the model group and lowest in the atorvastatin and medium-dose Camellia oil groups (1.13 and 1.15, respectively). The relative expression of LCAT gene was the lowest (0.46) in the model group and increased significantly in the Camellia oil and atorvastatin groups (P < .01), with the atorvastatin group showing the best effect. The relative expression of UCP2 gene was the lowest (0.53) in the model group and increased significantly in the Camellia oil and atorvastatin groups (P <.01), with the medium-dose Camellia oil group showing the best effects. Compared to the model group, the relative expression of MCD gene was significantly increased in the Camellia oil and atorvastatin groups. Upregulation of the MCD gene would help to reduce free fatty acid (FFA) in vivo and TG in the liver. The relative expression of CPT-1 gene was lowest (0.58) in the model group and significantly increased in the Camellia oil and atorvastatin groups (P < .01). CPT-1 plays a regulatory role in the whole process of lipid oxidation. The relative expression of FAS gene was highest (2.41) in the model group and significantly decreased in the Camellia oil and atorvastatin groups (P < .01). The expression of FAS gene in the medium-dose Camellia oil group was only 55.6% of that in model group, and the downregulation of FAS gene expression could reduce fat synthesis. The relative expression of SREBP gene was highest (1.90) in the model group and significantly decreased in the Camellia oil and atorvastatin groups (P< .01). The expression of SREBP gene in the medium-dose Camellia oil group was only 61.1% of that in the model group; reducing SREBP gene expression would effectively reduce the total cholesterol level in cells.

Figure 2.

Effect on relative expression of lipid metabolism-related genes in liver of rat.

Effect of Camellia oil on Oxidative Indicator of Rats Fed With High-fat Diet

The effects of Camellia oil and atorvastatin on antioxidants in liver tissues of rats fed a high-fat diet are shown in Table 8. The lowest activities of SOD and GSH-Px were shown in the model group, with only 290.2 U/mg and 520.7 U/mg, respectively. When compared to the model group, the activity of SOD was increased the most in the medium-dose Camellia oil group, and the activity of GSH-Px was increased the most in the atorvastatin group (P < .01). However, the activity of SOD and GSH-Px in both the Camellia oil and atorvastatin groups were lower than those of the control group. The highest MDA level of 3.2 nmol/mg was reported in the model group, but the atorvastatin and medium-dose Camellia oil groups had lower levels. The MDA content of the medium-dose Camellia oil group was close to that of the control, which could largely reduce the oxidative damage of membrane lipids.

Table 8.

Effect on Antioxidant Indicators in Liver of Rats.

Group	SOD (U/mg）	GSH-Px [U/mg]	MDA [nmol/mg]
Control group	411.6 ± 17.4	712.3 ± 22.7	1.7 ± 0.3
Model group	290.2 ± 17.8	520.7 ± 19.3	3.2 ± 0.7
Atorvastatin group	371.4 ± 21.9*#	658.9 ± 18.3*#	2.1 ± 0.4*
Low-dose group	360.3 ± 14.0*#	617.2 ± 26.2*#	2.7 ± 0.5*#
Medium-dose group	391.1 ± 13.5*#	624.3 ± 17.0*#	2.2 ± 0.5*
High-dose group	372.2 ± 19.2*#	616.6 ± 15.2*#	2.5 ± 0.2*#

Effect of Camellia oil on Antioxidant Gene Expression in Rats Fed With High-fat Diet

The effects of Camellia oil and atorvastatin on the expression of antioxidant genes in liver tissues of rats fed with a high-fat diet are shown in Figure 3. The relative expression of SOD1 gene was lowest (only 0.52) in the model group and increased significantly in liver tissues after treatment with either Camellia oil or atorvastatin (P < .01). The best effect was observed in the medium-dose Camellia oil group compared to the model group, with a 2.09-fold increase. The relative expression of CAT gene in the model group was also very low (only 0.43), and the atorvastatin group had the best effect with a 2.88-fold increase compared to the model group. GPx1 can regulate the activity of GSH-Px and attenuate further damage caused by ROS. The relative expression of GPx1 gene in the model group was very low (only 0.68), and the effect in the medium-dose Camellia oil group was the best, with a 1.37 fold increase compared to the model group. Glutamyl cysteine ligase is the rate-limiting enzyme for GSH-Px biosynthesis. The relative expression of Gclm gene was very high in the Camellia oil and atorvastatin groups, much higher than that in the model and control groups. The atorvastatin group showed the best effect (1.79), which was 0.79 times higher than that of the control group.

Figure 3.

Effects on the antioxidant-related genes expression in rat livers.

Discussion

Camellia oil and atorvastatin had strong hypolipidemic and antioxidant effects on high-fat diet-induced obesity in rats, while medium doses of Camellia oil (7.5 ml/kg.BW) were generally more effective. Compared to the model group, rats given Camellia oil orally showed a decrease in BW and liver weight ratio, and the activities of AST and ALT were significantly decreased (P < .01), indicating that Camellia oil has some protective effect on the liver, which was consistent with the findings of Li X et al²¹ Meanwhile, the levels of TC, TG, and LDL-C in the Camellia oil group were significantly lower than those in the model group (P < .01), while the level of HDL-C was increased, which is in good agreement with the results of Komprda et al²² Camellia oil is rich in linoleic acid, other unsaturated fatty acids, and many substances with hypolipidemic effects (ie sterols, squalene).^3–6 Oleic acid can reduce LDL-C level, increase HDL-C level, reduce the extent of platelet aggregation and improve blood circulation.²³ Linoleic acid plays a role in softening blood vessels and has a strong effect on reducing TG, LDL, and very low density lipoprotein (VLDL).²⁴ Squalene can neutralize H⁺, reduce acidity, and enhance blood circulation. Sterols lower blood cholesterol levels and prevent cardiovascular and cerebrovascular diseases.^25,26

Compared with the model group, the relative expressions of ACAT1, DGAT2, FAS, and SREBP genes in the liver of rats were significantly decreased after treatment with Camellia oil. ACAT1 is a catalytic polymer allosteric enzyme, which is the only key enzyme for cholesterol esters formation. The downregulation of ACAT1 gene is beneficial for reducing TC level.²⁷ DGAT2 promotes fat absorption in the intestine, catalyzes the synthesis of TG from glycerol diester, and promotes the formation of LDs. The formation and accumulation of TGs and cholesterol in the liver are avoided by downregulating the DGAT2 gene expressions.²⁸ SREBP is an important transcriptional regulator leading to the TG biosynthesis pathway and also regulates lipid metabolism. By reducing SREBP gene expression, intracellular cholesterol levels should be effectively reduced.²⁹ Furthermore, by reducing the expression of FAS gene, the synthesis of fatty acids in liver should be inhibited and the accumulation of lipids should be reduced.³⁰

The relative expression levels of LCAT, UCP2, MCD, and CPT-1 genes were significantly increased after treatment with Camellia oil. LCAT gene expression promotes the esterification of free cholesterol on the surface of HDL. The upregulation of LCAT gene expression enhances the ability of HDL to remove cholesterol from peripheral tissues and reduce the cholesterol level.³¹ Excessive accumulation of white fat and obesity should be avoided by increasing the expression of the UCP2 genes to increase energy expenditure, which explains why UCP2 gene expression enhanced the effect of weight loss.³² MCD is an important factor in regulating fatty acid oxidation since it can catalyze the conversion of coenzyme A to acetyl coenzyme A and carbon dioxide. Upregulation of MCD gene expression is beneficial to reduce the accumulation of FFA and TG in the liver.³³ CPT-1 is the rate-limiting enzyme of mitochondrial-mediated fatty acids β-oxidation, which facilitates the mitochondrial uptake of long-chain fatty acids. Upregulation of the CPT-1 gene expression increases the oxidation of fat in hepatocytes and reduces the accumulation of lipid in cells.³⁴

Liver, the main metabolic organ of food, drugs, and even toxins, contains abundant antioxidant enzymes with comprehensive functions. Compared with the model group, the antioxidant enzyme activity was significantly increased in the liver of the rats after treatments with Camellia oil (P < .01). Camellia oil contains many antioxidants, such as selenium, squalene, and polyphenols (Table 2), which improve the activity of antioxidant enzymes in vivo and enhance the antioxidant capacity of the body. For example, selenium is an important component of the glutathione peroxidase system (GPx), whose activity is closely related to selenium level. Selenium scavenges lipid peroxides, free radicals and other harmful substances deposited on the vascular wall, keeping them open and ensuring the normal circulation of blood lipids.^35,36 Furthermore, the relative expression of SOD1, GPx1, CAT, and Gclm genes in the liver of rats were significantly increased after being treated with Camellia oil (P < .01). SOD rapidly decomposes O₂⁻to H₂O₂ and scavenges superoxide radicals, while H₂O₂ is reduced to H₂O by GSH-Px and CAT.³⁷ Moreover, Gclm and Gclc are important antioxidant proteases, and upregulation of Gclm expression facilitates free radical scavenging.³⁸

Conclusion

Camellia oil regulated lipid and free radical metabolism in rats fed a high-fat diet. This study provides a theoretical basis for the future development of lipid-lowering and antioxidant-related products and further promotes the development and utilization of oil tea resources.

Footnotes

Acknowledgments

The authors would like to thank all colleagues who have worked on lipase metabolism, plant extract technology, and related fields. We would like to thank anonymous reviewers for helpful comments.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was supported by PhD introduction of scientific research projects (2021HYBS03), Hunan Province Education Project of China (19B409), Hunan Province Key R&D Program of China (2018NK2013).

Ethical Approval

Not applicable, because this article does not contain any studies with human or animal subjects.

Informed Consent

Not applicable, because this article does not contain any studies with human or animal subjects.

ORCID iD

Hao Shi

Trial Registration

Not applicable, because this article does not contain any clinical trials.

References

Gao

Yang

Yuan

. Structural characteristics of the mature embryo sac of Camellia oleifera. Nord J Bot. 2017;36(6):1-22. doi:10.1111/njb.01673

Liu

Chen

, et al. Soil quality assessment of different Camellia oleifera stands in mid-subtropical China. Appl Soil Ecol. 2017;113:29-35. doi:10.1016/j.apsoil.2017.01.010

Zhu

Zhong

Sun

, et al. Development of quantitative analysis of fatty acid for monitoring changes of fatty acid profile of camellia oil. Adv Mater Res. 2012;554-556(2012):1202-1210. doi:10.4028/www.scientific.net/amr.554-556.1202

Wang

Zeng

Del Mar Contreras

, et al. Profiling and quantification of phenolic compounds in camellia seed oils: natural tea polyphenols in vegetable oil. Food Res Int. 2017;102(1):184-194. doi:10.1016/j.foodres.2017.09.089

Zhang

Han

Bao

. A new saponin from tea seed pomace (Camellia oleifera Abel) and its protective effect on PC12 cells. Molecules. 2012;17(10):11721-11728. doi:10.3390/molecules171011721

Xie

Jiang

, et al. Biomolecules in extractives of Camellia oleifera fruit shell by gc-ms. Saudi J Biol Sci. 2018;25(2):234-237. doi:10.1016/j.sjbs.2017.08.006

Vincent

Taylor

. Biomarkers and potential mechanisms of obesity-induced oxidant stress in humans. Int J Obes. 2006;30(3):400-418. doi:10.1038/sj.ijo.0803177

Xia

Jiang

Huang

, et al. Transcriptome analysis of the oil-rich tea plant, Camellia oleifera, reveals candidate genes related to lipid metabolism. PLoS ONE. 2014;9(8):1-16. https://doi.org/10.1371/journal.pone.0104150

Zeng

Chen

, et al. Sasanquasaponin from Camellia oleifera Abel. induces apoptosis via bcl-2, bax and caspase-3 activation in hepg2 cells. Mol Med Rep. 2015;12(2):1997-2002. doi:10.3892/mmr.2015.3666

10.

Bumrungpert

Pavadhgul

Kalpravidh

. Camellia oil-enriched diet attenuates oxidative stress and inflammatory markers in hypercholesterolemic subjects. J Med Food. 2016;19(9):895-901. doi:10.1089/jmf.2016.3659

11.

Oben

Enyegue

Fomekong

. The effect of Cissus quadrangularis (cqr-300) and a Cissus formulation (core) on obesity and obesity-induced oxidative stress. Lipids Health Dis. 2007;6(1):1-8. doi:10.1186/1476-511X-6-4

12.

Alhalaiqa

Al-Nawafleh

Batiha

. A descriptive study of adherence to lifestyle modification factors among hypertensive patients. Turk J Med Sci. 2017;47(1):273-281. doi:10.3906/sag-1508-18

13.

Floridajames

Simpson

Davison

, et al. Exercise, free radical metabolism, and aging: cellular and molecular processes. Oxid Med Cell Longev. 2016;2016:1-3. doi:10.1155/2016/3813680

14.

Raza

Babb

Movahed

. Optimal management of hyperlipidemia in primary prevention of cardiovascular disease. Int J Cardiol. 2004;97(3):355-366. doi:10.1016/j.ijcard.2003.07.039

15.

Moran

. Lipid studies for assessing the risk of cardiovascular disease and hyperlipidemia. Hum Pathol. 1971;2(1):153-164. doi:10.1016/s0046-8177(71)80024-2

16.

Zhu

Wang

, et al. Chemical constituents of the seed cake of Camellia oleifera and their antioxidant and antimelanogenic activities. Chem Biodivers. 2018;15(7):1-12. doi:10.1002/cbdv.201800137

17.

Jin

. Bioactivities of water-soluble polysaccharides from fruit shell of Camellia oleifera Abel: antitumor and antioxidant activities. Carbohydr Polym. 2012;87(3):2198-2201. doi:10.1016/j.carbpol.2011.10.047

18.

Chou

Inbaraj

, et al. Enhancement of antioxidative activity and cardiovascular protection in hamsters by Camellia oil and soybean–camellia blended oil. Nutrition. 2018;51-52:86-94. doi:10.1016/j.nut.2017.12.011

19.

Lei

Liu

Cao

, et al. Camellia oil (Camellia oleifera Abel.) attenuates CCl₄-induced liver fibrosis. via suppressing hepatocyte apoptosis in mice. Food Funct. 2020;11(5):4582-4590. doi:10.1039/c9fo02258a

20.

Yang

, et al. Anti-obesity and hypolipidemic effects of garlic oil and onion oil in rats fed a high-fat diet. Nutr Metab (Lond). 2018;15(1):43-51. doi:10.1186/s12986-018-0275-x

21.

, et al. Dietary feeding of flavokawain a, a kava chalcone, exhibits a satisfactory safety profile and its association with enhancement of phase ii enzymes in mice. Toxicol Rep. 2014;1:2-11. doi:10.1016/j.toxrep.2014.02.002

22.

Komprda

Zorníková

Knoll

, et al. Effect of dietary eicosapentaenoic and docosahexaenoic acid on expression of rat liver genes controlling cholesterol homeostasis and on plasma cholesterol level. Czech J Anim Sci. 2014;59(9):391-398. doi:10.17221/7650-CJAS

23.

Chang

Seo

Matsuzaki

, et al. N-3 fatty acids reduce arterial ldl-cholesterol delivery and arterial lipoprotein lipase levels and lipase distribution. Arterioscler, Thromb, Vasc Biol. 2009;29(4):555-561. doi:10.1161/atvbaha108.182287

24.

Fan

Jiang

, et al. Omega-3 fatty acid containing diet decrease plasma triglyceride concentrations in mice by reducing endogenous triglyceride synthesis and enhancing the blood clearance of triglyceride-rich particles. Clin Nutr. 2008;27(3):424-430. doi:10.1016/j.clnu.2008.02.001

25.

Kim

Ahn

, et al. Dietary conjugated linoleic acid reduces lipid peroxidation by increasing oxidative stability in rats. J Nutr Sci Vitaminol. 2005;51(1):8-15. doi:10.3177/jnsv.51.8

26.

Nicolosi

Rogers

Kritchevsky

, et al. Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atherosclerosis in hypercholesterolemic hamsters. Artery. 1997;22(5):266-277. doi:10.1016/S0003-4975(96)01029-6

27.

Antalis

Arnold

Lee

, et al. Docosahexaenoic acid is a substrate for acat1 and inhibits cholesteryl ester formation from oleic acid in mcf-10a cells. Prostaglandins Leukot Essent Fatty Acids. 2009;80(2-3):165-171. doi:10.1016/j.plefa.2009.01.001

28.

Mclaren

Han

Murphy

. DGAT2 Inhibition alters aspects of triglyceride metabolism in rodents but not in non-human primates. Cell Metab. 2018;27(6):1236-1248. doi:10.1016/10.1016/j.cmet

29.

Vallianou

Hadzopoulou-Cladaras

. Camphene, a plant derived monoterpene, exerts its hypolipidemic action by affecting srebp-1 and mtp expression. Plos One. 2016;11(1):1-21. doi:10.1371/journal.pone.0147117

30.

Chen

Wang

Huang

, et al. Effects of individual and multiple fatty acids (palmitate, oleate and docosahexaenoic acid) on cell viability and lipid metabolism in lo2 human liver cells. Mol Med Rep. 2014;10(6):3254-3260. doi:10.3892/mmr.2014.2579

31.

Francone

Royer

Haghpassand

. Increased prebeta-HDL levels, cholesterol efflux, and LCAT-mediated esterification in mice expressing the human cholesteryl ester transfer protein (CETP) and human apolipoprotein A-I (apoA-I) transgenes. J Lipid Res. 1996;37(6):1268-1277. doi:10.1089/jir.1996.16.479

32.

Vidal-Puig

Rosenbaum

Considine

, et al. Effects of obesity and stable weight reduction on ucp2 and ucp3 gene expression in humans. Obes Res. 1999;7(2):133-140. doi:10.1002/j.1550-8528.1999.tb00694.x

33.

Chien

Dean

Saha

, et al. Malonyl-coa content and fatty acid oxidation in rat muscle and liver in vivo. AJP Endo Metab. 2000;279(2):259-265. doi:10.1152/ajpendo.2000.279.2.E259

34.

Iliopoulos

Drosatos

Hiyama

, et al. MicroRNA-370 controls the expression of MicroRNA-122 and Cpt1α and affects lipid metabolism. J Lipid Res. 2010;51(6):1513-1523. doi:10.1194/jlr.M004812

35.

Derbeneva

Bogdanov

Pogozheva

, et al. Effect of diet enriched with selenium on the psycho-emotional and adaptive capacity of patients with cardiovascular diseases and obesity. Vopr Pitan. 2012;81(4):35-38.

36.

Saied

Hamza

. Selenium ameliorates isotretinoin-induced liver injury and dyslipidemia via antioxidant effect in rats. Toxicol Mech Methods. 2014;24(6):433-437. doi:10.3109/15376516.2014.937514

37.

Sabaretnam

Kritharides

O’Reilly

, et al. The effect of aging on the response of isolated hepatocytes to hydrogen peroxide and tert-butyl hydroperoxide. Toxicol in Vitro. 2010;24(1):123-128. doi:10.1016/j.tiv.2009.08.018

38.

Toroser

Yarian

Orr

, et al. Mechanisms of γ-glutamylcysteine ligase regulation. Biochim Biophys Acta. 2006;1760(2):233-244. doi:10.1016/j.bbagen.2005.10.0102018.04.004

Camellia oil Enhances Plasma Antioxidant Metabolism and Improves Plasma Lipid Metabolism in High-fat Diet-fed Rats

Abstract

Keywords

Introduction

Methods

Chemicals

Preparation of Camellia oil

Animals

Determination of Body Condition

Determination of Serum Indicators

Determination of Antioxidant Indicators

Real-Time Quantitative PCR Analysis

Statistical Analysis

Results

Effect of Camellia oil on BW of Rats Fed With High-fat Diet

Histopathological Evaluation

Effect of Camellia oil on Blood Lipid in Rats Fed with High-fat Diet

Effect of Camellia oil on serum Enzyme Activity in Rats Fed With High-fat Diet

Effect of Camellia oil on Lipid Metabolism Gene Expression in Rats Fed With High-fat Diet

Effect of Camellia oil on Oxidative Indicator of Rats Fed With High-fat Diet

Effect of Camellia oil on Antioxidant Gene Expression in Rats Fed With High-fat Diet

Discussion

Conclusion

Footnotes

Acknowledgments

Declaration of Conflicting Interests

Funding

Ethical Approval

Informed Consent

ORCID iD

Trial Registration

References