Combination of Umbelliprenin and Arsenic Trioxide Acts as an Effective Modality Against T-Cell Leukemia/Lymphoma Cells

Abstract

Adult T-cell leukemia/lymphoma (ATLL) is a serious blood malignancy with distinct geographical distribution. ATLL patients have a short survival time because of intrinsic chemoresistance and severe immunosuppression. To introduce a novel treatment, we investigated whether umbelliprenin (UMB), a natural coumarin derivative, could improve the toxicity of arsenic trioxide (ATO) on ATLL cells. To determine the viability of MT-2 cells upon treatment with different concentrations of UMB and ATO, alamarBlue assay was applied. Cell cycle analysis was carried out by propidium iodide staining and the expression of candidate genes was assessed by quantitative reverse transcription-polymerase chain reaction. Our findings revealed that combination of UMB and ATO induced considerable cytotoxic effects on ATLL cells. Flow cytometry analysis indicated accumulation of MT-2 cells in the sub G₁ phase of the cell cycle after combinatorial treatment. In addition, significant downregulation in BMI-1, CD44, c-MYC, and nuclear factor-κB (REL-A) expression was observed after UMB + ATO administration. Agents with low side effects are potential candidates for novel cancer treatments. We demonstrated, for the first time, that combination of UMB and ATO might be regarded as an effective regimen for ATLL treatment.

Keywords

adult T-cell leukemia/lymphoma umbelliprenin arsenic trioxide combination

Introduction

Human cancers are major health concerns worldwide, as more than 18 million new cases and 9.6 million related deaths were reported globally in 2018.¹ Adult T-cell leukemia/lymphoma (ATLL) is a non-Hodgkin lymphoma caused by human T-cell leukemia virus type 1 (HTLV-1). This peripheral T-cell neoplasm shows distinct geographical distribution, as the main HTLV-1 endemic regions include Japan, sub-Saharan Africa, South America, the Caribbean area, and foci in the Middle East and Melanesia.² Current treatments for ATLL depend on the disease subtypes that are acute, lymphoma, chronic, and smoldering. Among chemotherapeutic regimens, interferon-α/zidovudine (IFN/AZT) is an antiviral drug that is used in the treatment of acute, chronic, and smoldering types.^3,4 Arsenic trioxide (ATO) is a chemical agent that is more effective when used in combination with IFN/AZT.⁵ Despite the use of various anticancer drugs, ATLL has a poor prognosis because of intrinsic chemoresistance and severe immunosuppression. In addition, ATLL affects multiorgans such as lymph nodes, bone marrow, liver, and the central nervous system that all make the management and therapy of this malignancy more challenging.^3,6

The viral regulatory protein, Tax, is thought to play indispensable roles in the oncogenic process of ATLL, such as activation of nuclear factor-κB (NF-κB) and Akt signaling pathways, induction of several anti-apoptotic proteins, and inhibition of P53 expression.^7-9 In addition, Tax-mediated NF-κB activation induces the expression of cell migration factors, resulting in the infiltration of infected T-lymphocytes.^10,11 Elevated expression of CD44 and c-MYC, which was determined in HTLV-1-infected cells, has been correlated with the poor prognosis and severity of ATLL.^12,13 Moreover, upregulation of BMI-1 has been associated with drug resistance of hematologic malignancies such as chronic myeloid leukemia, acute myeloid leukemia, and lymphoma.¹⁴

Umbelliprenin (C₂₄H₃₀O₃, UMB) is a natural 7-prenyloxycoumarin mainly found in Ferula species (Apiaceae).¹⁵ Beside anti-inflammatory, immunomodulatory, antioxidant, and antileishmanial effects of UMB, the great anticancer activity of this agent has been shown in gastric, colorectal, and breast carcinomas.^16-18 Specifically, inhibitory effects on matrix metalloproteinases, signaling pathways, pro-inflammatory enzymes, and drug efflux pumps, as well as induction of apoptosis and cell cycle arrest, are main proved mechanisms of UMB anticancer actions.^16-18 Nevertheless, there are no reports on the toxic effects of UMB, either alone or in combination with other agents, on HTLV-1-infected human lymphocytes. Hence, this study was aimed to determine whether UMB has the potential to improve ATO efficacy in vitro. In this regard, the viability of MT-2 cells, a human ATLL cell line, was determined upon administration of UMB and ATO, alone and in combination. Moreover, changes induced in the cell cycle were analyzed by flow cytometry, and the expression of candidate genes was assessed by quantitative polymerase chain reaction (qPCR).

Materials and Methods

Preparation of UMB

UMB (M_W: 366.5 g/mol) was extracted from Ferula szowitsiana, as previously described.¹⁹ Briefly, the roots were powdered and extracted thoroughly by maceration with acetone at room temperature. Then, the obtained extract was concentrated under vacuum and UMB was separated by silica gel layer chromatography. To prepare different concentrations of UMB, 2 mg of the crystal powder was dissolved in 100 µL of dimethyl sulfoxide (DMSO; Merck) and immediately diluted with complete culture medium before use. To note, equal amounts of DMSO in all UMB concentrations (0.2% and 0.1%, v/v) were considered as control treatments to eliminate the toxic effects of the solvent.

Cell Culture, Treatment, and Viability Assessment

MT-2 cells were obtained from the Pasteur Institute of Iran. The cells were grown in Rosewell Park Memorial Institute 1640 medium (Biosera) supplemented with 10% fetal bovine serum (Gibco) and incubated in a 5% CO₂ humidified atmosphere at 37 °C. To determine the half-maximal inhibitory concentration (IC₅₀) of UMB and ATO, cells were seeded at a density of 5 × 10⁴ cells/well in 96-well cell culture plates (SPL) and treated with different concentrations of either UMB (54, 82, 110, and 136 µM) or ATO (Sigma; 2, 4, 8, and 16 µM) for 24, 48, and 72 h. Then, to investigate combinatorial effects, the cells were treated with non-toxic UMB (68 µM) + ATO (2 µM) for 72 h, while 0.1% DMSO + ATO was considered as a control.

For quantitative analysis of cell viability, alamarBlue assay was performed. In summary, alamarBlue dye (Sigma) was dissolved in phosphate-buffered saline (PBS; 0.1 mg/mL) and added to each well (20 µL/well) at the end of each time point. Afterwards, plates were incubated for 2 h at 37 °C in the dark, and optical density (OD) was measured at 600 nm using a microplate reader (Epoch). For calculation of cell viability (%), the following formula was used: 100 × (100 − [OD_T − OD_U]/[OD_B − OD_U]), in which OD_T, OD_U, and OD_B were the OD of treated cells, untreated cells, and blank control, respectively.

Cell Cycle Analysis

To study the cell cycle changes induced by our treatments, MT-2 cells were stained with propidium iodide (PI; Sigma). Briefly, treated cells and their relevant controls were harvested and washed with PBS twice. Then, cells were incubated in a hypotonic buffer containing 100 μg/mL PI in 0.1% sodium citrate and 0.1% Triton X-100 for 30 min at 37 °C in the dark, and finally analyzed by flow cytometry (BD FACSCalibur) using an FL2 filter.

Gene Expression Analysis

To determine whether the combination of UMB and ATO altered the expression pattern of our candidate genes, qPCR was applied. In summary, the total cellular RNA was extracted from treated cells, and the relevant controls using TriPure (Roche), and complementary DNAs (cDNAs) were synthesized by a RevertAid first-strand cDNA synthesis kit, according to the manufacturer's protocol (Thermo Scientific). The fidelity of amplified cDNAs was then confirmed by polymerase chain reaction (PCR) using hose-keeping primers, and amplicons were separated and viewed on 2% agarose gel (Invitrogen). qPCR was conducted in a Rotor-Gene Q real-time PCR machine (Qiagen) using either specific primers or probes for each gene (Table 1). The expression level of BMI-1, CD44, and c-MYC was assessed using SYBR green master mix (Takara) and PCR conditions were 94 °C for 2 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s For analysis of NF-κB (REL-A) expression, TaqMan probe (Takara) was used and PCR conditions were 95 °C for 2 min, followed by 45 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. To note, β2-microglobulin was used as internal control, and data were analyzed by a standard curve relative method.

Table 1.

The Sequences of Primers and Probes Used in This Study.

Genes	Sequence (5′→3′)	Products size (bp)
BMI-1	Forward: CTGCAGCTCGCTTCAAGATG Reverse: CACACACATCAGGTGGGGAT	192
c-MYC	Forward: ACTCTGAGGAGGAACAAGAA Reverse: TGGAGACGTGGCACCTCTT	159
CD44	Forward: CGGACACCATGGACAAGTTT Reverse: GAAAGCCTTGCAGAGGTCAG	176
NF-κB (REL-A)	Forward: ACCCCTTCCAAGTTCCTATAGAAGAG Reverse: CGATTGTCAAAGATGGGATGAGAAAG Probe: FAM-ACTACGACCTGAATGCTGTGCGGCTCT-BHQ-1	145
β2M	Forward: CTTGTCTTTCAGCAAGGACTGG Reverse: CCACTTAACTATCTTGGGCTGTG Probe: FAM-TCACATGGTTCACACGGCAGGCAT-BHQ-1	127

Abbreviations: NF-κB, nuclear factor-κB; β2M, β2-microglobulin.

Statistical Analysis

One-way analysis of variance and Tukey test were performed using SPSS software to assess the statistical difference between groups. The results are expressed as mean ± standard error of the mean (SEM), and p-values <.05, <.01, <.001, and <.0001 were considered to be statistically significant.

Results

To investigate the combinatorial effects of UMB and ATO, at first, the IC₅₀ of each agent was determined after 72 h. As shown in Figure 1A and B, the IC₅₀ of UMB and ATO was > 136 and >16 µM on MT-2 cells, respectively. Then, viability assessment of cells revealed that upon treatment with 68 µM UMB + 2 µM ATO, concentrations lower than their IC₅₀, UMB improved cytotoxicity of ATO up to 37.1% (Figure 1C).

Figure 1.

Viability assessment of MT-2 cells after single and combinatorial treatments with UMB and ATO. Effects of UMB (A) and ATO (B) were time- and dose-dependent; the IC₅₀ of UMB and ATO was >136 µM and > 16 µM after 72 h, respectively. After cells were treated with 68 µM UMB, 2 μM ATO, and their combination for 72 h (C), the calculated viability of each treatment was 97.6%, 100%, and 62.8%, respectively. All values are represented as mean ± SEM and differences are shown as *p < .05, **p < .01, and ***p < .001.

To determine whether the observed effects of UMB + ATO were associated with cell cycle changes, the DNA content of cells was assessed by flow cytometry. As presented in Figure 2, 21.5%, 6.27%, and 20.4% of MT-2 cells were detected in the sub G₁ phase of the cell cycle after 72 h treatment with DMSO, ATO, or UMB alone, respectively. In DMSO + ATO treatment, 13.5%, 62.68%, and 22.17% of cells were present in the sub G₁, G₁, and G₂/M phases, respectively. Intriguingly, the combination of UMB + ATO led to the accumulation of cells in the sub G₁ phase, as 58.24%, 28.38%, and 11.31% of cells were detected in the sub G_1, G₁, and G₂/M peaks on DNA content histograms, respectively.

Figure 2.

Effects of UMB, ATO, and their combination on MT-2 cell cycle progression after PI staining. Percentage of cells in the sub G₁, G₁, S, and G₂/M phases of the cell cycle with no treatment (A) and upon 72 h treatment with 2 μM ATO (B), 0.2% DMSO (C), 68 µM UMB (D), 0.1% DMSO + 2 μM ATO (E), and 68 µM UMB + 2 μM ATO (F).

To elucidate the molecular mechanism of our combinatorial approach, the expression pattern of candidate genes was examined after UMB + ATO treatment. Figure 3A to D shows relative quantitation in BMI-1, CD44, c-MYC, and NF-κB (REL-A) expression compared to the corresponding control groups. As indicated, UMB alone and in combination with ATO induced a significant (p < .0001) decrease in BMI-1 expression when compared with relevant controls. Meanwhile, single-use of UMB and ATO significantly (p < 0.0001) down-regulated CD44 expression and such decrease was also observed when both agents were used in combination. In addition, c-MYC expression significantly (p < .0001) decreased after treatment with ATO and UMB + ATO in comparison with their relevant controls, while UMB alone did not induce significant effects. Finally, significant (p < .0001) downregulation in NF-κB (REL-A) expression was detected upon single and combinatorial use of UMB, but not ATO alone.

Figure 3.

The expression pattern of BMI-1, CD44, c-MYC, and NF-κB (REL-A) upon single and combinatorial treatments with UMB (68 µM) and ATO (2 μM) for 72 h. UMB and UMB + ATO treatments significantly decreased BMI-1 expression compared to their relevant controls (A). UMB, ATO, and UMB + ATO treatments significantly down-regulated CD44 expression compared to their relevant controls (B). Treatment of MT-2 cells with ATO and UMB + ATO significantly decreased c-MYC expression compared to their relevant controls (C). NF-κB (REL-A) expression in UMB and UMB + ATO treated groups was significantly lower than that of their relevant controls (D). All gene expression values are represented as mean ± SEM and differences are shown as **p < .01 and ****p < .0001.

Discussion and Conclusion

ATLL is a malignancy of adult T lymphocytes with a weaker prognosis compared to other non-Hodgkin's invasive lymphomas. Excessive expression of drug efflux pumps and anti-apoptotic proteins in ATLL cells are among the reasons that impair the efficacy of chemotherapy.³

Although anti-neoplastic and differentiation-inducing effects of natural agents have been reported on human leukemia and lymphoma cells,^20,21 finding new and more effective therapeutic approaches that could improve clinical outcomes is still a critical demand. ATO is a routine chemotherapy drug prescribed for ATLL, and UMB is a natural coumarin with valuable pharmaceutical effects. In the present attempt, we examined whether combination of UMB and ATO could enhance cytotoxicity against HTLV-1 transformed human T-cell leukemia cells. The obtained findings revealed that treatment of MT-2 cells with 68 µM UMB + 2 µM ATO significantly decreased cell viability, which was confirmed by the accumulation of cells in the sub G₁ phase of the cell cycle. Similarly, it has been previously reported that 12.5 µM UMB inhibited the growth of M4Beu cells via G₁ arrest, and at higher concentrations (≥25 μM), UMB-induced accumulation of cells in the sub G₁ phase.²²

Examining the expression of BMI-1, CD44, c-MYC, and NF-κB (REL-A) revealed, to some extent, mechanisms underlying the observed combinatorial effects. The overexpression of BMI-1, a member of the polycomb transcription repressors, has been reported in different types of human cancers, such as leukemia, lung, gastric, and breast carcinomas.²³ In addition, upregulation of BMI-1 has been associated with drug resistance and treatment failure, and thus, BMI-1 is considered as a useful biomarker for the prognosis of cancer patients.²⁴ CD44 expression, which is linked to malignant cellular activities such as metastasis and drug resistance, has also been detected on the surface of T-cell acute lymphoblastic leukaemia cells.²⁵ The present study indicated significant downregulation of BMI-1 and CD44 by UMB alone and in combination with ATO. Upregulation of c-MYC, a transcriptional factor that plays key roles in cell proliferation and apoptosis, was demonstrated in lymphoma and acute ATLL.²⁶ NF-κB (REL-A) interferes with cellular functions that promote oncogenesis and chemoresistance.²⁷ Since HTLV-1-Tax protein is a potent activator of NF-κB, expression of this gene is altered in HTLV-1-infected patients.²⁸ In this regard, several agents that can inhibit NF-κB function are used as chemotherapeutic drugs, including ATO.²⁷ The current study, which revealed significant downregulation of c-MYC and NF-κB (REL-A) by UMB + ATO, demonstrates that UMB could be considered as a potent natural coumarin to combat drug resistance of ATLL cells.

In conclusion, our study indicated, for the first time, that UMB has the potential to improve the effectiveness of ATO in ATLL cells. Future investigations, however, are necessary to define more precisely the mechanisms of such combination in ATLL and other lymphomas.

Footnotes

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was financially supported by the Vice-Chancellor for Research and Technology, Mashhad University of Medical Sciences, Mashhad, Iran, under grant no. MUMS 940778.

ORCID iD

Fatemeh B. Rassouli

References

Ferlay

Colombet

Soerjomataram

. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int J Cancer. 2019;144(8):1941-1953.

Giam

Semmes

. HTLV-1 infection and adult T-cell leukemia/lymphoma-A tale of two proteins: tax and HBZ. Viruses. 2016;8(6):161.

Ishitsuka

Tamura

. Human T-cell leukaemia virus type I and adult T-cell leukaemia-lymphoma. Lancet Oncol. 2014;15(11):e517-ee26.

Bazarbachi

Suarez

Fields

Hermine

. How I treat adult T-cell leukemia/lymphoma. Blood. 2011;118(7):1736-1745.

Bazarbachi

Plumelle

Carlos Ramos

, et al. Meta-analysis on the use of zidovudine and interferon-alfa in adult T-cell leukemia/lymphoma showing improved survival in the leukemic subtypes. J Clinical Oncol. 2010;28(27):4177-4183.

Graham

Burch

Krause

. Adult T-cell leukemia/lymphoma. Proc Bayl Univ Med Cent. 2014;27(3):235-238.

Cherian

Baydoun

Al-Saleem

, et al. Akt pathway activation by human T-cell leukemia virus type 1 Tax oncoprotein. J Biol Chem. 2015;290(43):26270-26281.

Matsuoka

Yasunaga

. Human T-cell leukemia virus type 1: replication, proliferation and propagation by Tax and HTLV-1 bZIP factor. Curr Opin Virol. 2013;3(6):684-691.

Nicot

. HTLV-I Tax-mediated inactivation of cell cycle checkpoints and DNA repair pathways contribute to cellular transformation: “A random mutagenesis model”. J Cancer Sci. 2015;2(2):6.

10.

Harakeh

Azar

Azhar

, et al. Specific nutrient combination effects on tax, NF- kappaB and MMP-9 in human T-cell lymphotropic virus-1 positive malignant T-lymphocytes. BMC Cancer. 2015;15(Suppl 1):S2.

11.

Harhaj

Giam

. NF-kappaB signaling mechanisms in HTLV-1-induced adult T-cell leukemia/lymphoma. FEBS J. 2018;285(18):3324-3336.

12.

Miyatake

Sheehy

Ikeshita

Hall

Kasahara

. Anchorage-dependent multicellular aggregate formation induces CD44 high cancer stem cell-like ATL cells in an NF-kappaB- and vimentin-dependent manner. Cancer Lett. 2015;357(1):355-363.

13.

Zhao

Zhang

. Stemness-related markers in cancer. Cancer Transl Med. 2017;3(3):87-95.

14.

Yang

Cai

Liang

, et al. Inhibition of c-Myc by let-7b mimic reverses mutidrug resistance in gastric cancer cells. Oncol Rep. 2015;33(4):1723-1730.

15.

Shakeri

Iranshahy

Iranshahi

. Biological properties and molecular targets of umbelliprenin-a mini-review. J Asian Nat Prod Res. 2014;16(8):884-889.

16.

Genovese

Taddeo

Epifano

, et al. Characterization of the degradation profile of umbelliprenin, a bioactive prenylated coumarin of a Ferulago species. J Nat Prod. 2017;80(9):2424-2431.

17.

Rashidi

Khalilnezhad

Amani

, et al. Umbelliprenin shows antitumor, antiangiogenesis, antimetastatic, anti-inflammatory, and immunostimulatory activities in 4T1 tumor-bearing BALB/c mice. J Cell Physiol. 2018;233(11):8908-8918.

18.

Kasaian

Mosaffa

Behravan

, et al. Reversal of P-glycoprotein-mediated multidrug resistance in MCF-7/Adr cancer cells by sesquiterpene coumarins. Fitoterapia. 2015;103:149-154.

19.

Iranshahi

Arfa

Ramezani

Jaafari

Sadeghian

Bassarello

. Sesquiterpene coumarins from Ferula szowitsiana and in vitro antileishmanial activity of 7-prenyloxycoumarins against promastigotes. Phytochemistry. 2007;68(4):554-561.

20.

Akalin

Fatma

Haznedaroglu

Sayinalp

Salih

. Acute in vitro effects of ABS (ankaferd hemostat) on the lymphoid neoplastic cells (B-CLL and RAJI tumor cell lines). Int J Hematol Oncol. 2014;24(4):253-259.

21.

Mumcuoglu

Akin

Ezer

Akar

. Ankaferd blood stopper induces apoptosis and regulates PAR1 and EPCR expression in human leukemia cells. Egypt J Med Human Genetics. 2015;16(1):19-27.

22.

Barthomeuf

Lim

Iranshahi

Chollet

. Umbelliprenin from Ferula szowitsiana inhibits the growth of human M4Beu metastatic pigmented malignant melanoma cells through cell-cycle arrest in G1 and induction of caspase-dependent apoptosis. Phytomedicine. 2008;15(1-2):103-111.

23.

Huang

Zou

, et al. Negative regulation of BMI-1 by AMPK and implication in cancer progression. Oncotarget. 2016;7(5):6188.

24.

Wang

Cui

, et al. BMI-1, a promising therapeutic target for human cancer. Oncol Letters. 2015;10(2):583-588.

25.

Hoofd

Wang

Lam

, et al. CD44 Promotes chemoresistance in T-ALL by increased drug efflux. Exp Hematol. 2016;44(3):166-171. e17.

26.

Mihashi

Mizoguchi

Takamatsu

, et al. C-MYC and its main ubiquitin ligase, FBXW7, influence cell proliferation and prognosis in adult T-cell leukemia/lymphoma. Am J Surg Pathol. 2017;41(8):1139-1149.

27.

Orlowski

Baldwin

Jr . NF-κB as a therapeutic target in cancer. Trends Mol Med. 2002;8(8):385-389.

28.

El-Sabban

Nasr

Dbaibo

, et al. Arsenic-interferon-α–triggered apoptosis in HTLV-I transformed cells is associated with Tax down-regulation and reversal of NF-κB activation. Blood. 2000;96(8):2849-2855.