Sage Journals: Discover world-class research

Abstract

Stress causes intestinal inflammation and barrier dysfunction. Corticotrophin-releasing factor (CRF)/CRF receptor (CRFR) signaling pathway has been shown to be important for stress-induced intestinal mucosal alteration. L-Asparagine (ASN) is a powerful stimulator of ornithine decarboxylase and cell proliferation in a variety of cell types, including colonic cells. In the present study, we investigated whether dietary ASN supplementation could alleviate the damage of intestinal barrier function caused by LPS through modulation of CRF/CRFR signaling pathway. Twenty-four weaned pigs were randomly divided into one of four treatments: (1) non-challenged control; (2) Escherichia coli LPS challenged control; (3) LPS + 0.5% ASN; (4) LPS + 1.0% ASN. LPS stress induced villous atrophy, intestinal morphology disruption and decreased claudin-1 expression. ASN supplementation increased intestinal claudin-1 protein expression and alleviated villous atrophy and intestinal morphology impairment caused by LPS stress. In addition, ASN supplementation increased the number of intestinal intraepithelial lymphocytes and reversed the elevations of intestinal mast cell number and neutrophil number induced by LPS stress. Moreover, ASN decreased the mRNA expression of intestinal CRF, glucocorticoid receptors and tryptase. These results indicate that ASN attenuates intestinal barrier dysfunction induced by LPS stress, and regulates CRF/CRFR1 signaling pathway and mast cell activation.

Keywords

Asparagine intestinal barrier function CRF/CRFR1 signaling pathway lipopolysaccharide weaned pigs

Introduction

Intestinal mucosa plays a vital role in the digestion and absorption of nutrients. It also provides a physical barrier to prevent the diffusion of pathogens, toxins and allergens from the external environment into tissues.¹ Dysfunction of intestinal mucosal barrier may lead to an increase in intestinal mucosal permeability, bacterial translocation and mucosal inflammation.²

Various types of stresses, such as nutrient and growth factor deprivation, hemorrhagic shock, pathogenic bacteria toxins (e.g. endotoxin) and psychological stress, can cause damage to the intestinal barrier.³ The precise mechanisms of stress-related disturbances in intestinal barrier have not been fully elucidated. They involve complex brain–gut interactions.^4,5 The hypothalamus–pituitary–adrenal (HPA) has been extensively studied in the maintenance of stress-related behavioral mood change (anxiety and depression) and gastrointestinal parameters.⁶ Several studies have demonstrated that corticotrophin-releasing factor (CRF) and adrenal glucocorticoid play a critical role in stress-induced intestinal disorders.^7,8 Moreover, CRF mediates its effects via mast cell activation.⁶ Activated mast cells release a variety of pro-inflammatory mediators such as prostaglandins, cytokines, tryptase and histamine, which influence intestinal barrier function.⁷

Nutrients such as amino acids and fatty acids have been proposed as regulators to restore the intestinal barrier.^9,10 It is well known that L-glutamine is essential for supporting intestinal mucosa integrity.¹¹ L-Asparagine (ASN), a non-essential amino acid, which has a similar chemical structure to glutamine (with one less methylene group), is an alternative to glutamine.¹² Moreover, ASN is a powerful stimulator of ornithine decarboxylase and cell proliferation in a variety of cell types, including colonic cells.¹³ However, there has been less exploration of its protective role on small intestinal barrier in weaned pigs.

LPS, a component of the cell wall of Gram-negative bacteria, is one of the most commonly used endotoxins in immunological challenge and intestinal damage in weanling piglets.¹⁴ Peripheral administration of LPS can activate the HPA axis.¹⁵ Furthermore, a well-characterized response to stress is activation of the HPA axis resulting in adrenal cortisol release.¹⁶ Therefore, LPS is also a common tool used for inducing acute stress response and studying the effects of dietary regimes.¹⁷

In this study, we hypothesized that ASN could maintain intestinal barrier function by regulating CRF/CRF receptor (CRFR) signaling pathway. We used a well-established piglet model to induce intestinal damage in weanling piglets by administering Escherichia coli LPS. The piglet model was considered one of the best animal models for studying nutritional and intestinal development because of their similarities to human in anatomy and digestive physiology.¹⁸ Our objective was to determine whether dietary ASN supplementation could alleviate the damage of intestinal barrier function caused by LPS through modulation of CRF/CRFR signaling pathway.

Material and methods

Animals, diets, and experimental design

All procedures involving animal use and care were approved by the Animal Care and Use Committee of Wuhan Polytechnic University.

A total of 24 crossbred barrows [Duroc × Large White × Landrace; initial body mass (BM) of 7.37 ± 0.04 kg, weaned at 21 ± 1 d of age] were used in this study. Pigs were randomly allotted to four treatment groups with six replicates (pen) of one pig per replicate. The treatments were as follows: (1) non-challenged control (CONTR; pigs fed a control diet and injected with sterile saline); (2) LPS-challenged control [LPS, pigs fed control diet and challenged by injection with E. coli LPS, (E. coli serotype O55: B5; Sigma Chemical, St. Louis, MO, USA)]; (3) LPS + 0.5% ASN treatment (pigs fed a 0.5% ASN diet and challenged by injection with E. coli LPS); (4) LPS + 1.0% ASN treatment (pigs fed a 1.0% ASN diet and challenged by injection with E. coli LPS). The doses of ASN (L-ASN; purity > 99%; Amino Acid Bio-Chemical Company, Wuhan, China) were chosen according to our previous study.¹⁹ Alanine [1.35%, 0.68% and 0%; L-alanine, purity > 99% (Amino Acid Bio-Chemical Company)] were supplemented to the control, 0.5% ASN and 1.0% ASN diets, respectively, to obtain isonitrogenous diets.

The pigs were housed individually in stainless steel pens (1.80 × 1.10 m²). Pens contained a single-hole feeder and a nipple waterer to allow ad libitum access to feed and water. The basal diet (Table 1) was formulated to meet or exceed National Research Council²⁰ requirements for all nutrients.

Table 1.

Ingredient composition of diets (as fed basis).

Items	Content
Ingredients	g/kg
Corn	570.5
Soybean meal (44% CP)	224
Wheat middling	50
Fish meal	36
Soy protein concentrate	14
Fat powder^a	20
Defatted milk-replacer powder	30
Limestone	9.4
Dicalcium phosphate	12.2
Salt	3.4
Alanine^b	13.5
Acidifier^c	2.0
L-Lysine. HCl (78.8% lysine)	2.7
D,L-Methionine (99% methionine)	1.0
L-Threonine (98% threonine)	0.8
Butylated hydroquinone	0.5
Vitamin and mineral premix^d	10
Nutrient composition	g/kg
Digestible energy^e (MJ/kg)	13.6
Crude protein^f	203
Crude fat^f	44
Calcium^f	8.0
Total phosphorus^f	7.0
Amino acid concentrations^f	g/kg
Total aspartate + asparagine	16.9
Total glutamate + glutamine	30
Arginine	9.8
Lysine	11.1
Serine	9.1
Threonine	7.3
Proline	11.2
Glycine	7.5
Alanine	26
Histidine	4.9
Leucine	15
Isoleucine	5.6
Tyrosine	4.5
Phenylalanine	7.1
Valine	6.4

A rumen-stable fat powder, purchased from Berg + Schmidt (Hamburg, Germany). ^bIn the 0.5% ASN diet, 1.35% alanine was replaced with 0.5% ASN, 0.68% alanine and 0.17% cornstarch. In the 1.0% ASN diet, 1.35% alanine was replaced with 1.0% ASN and 0.35% cornstarch. All diets were isonitrogenous. ^cA compound acidifier including lactic acid and phosphoric acid, provided by Wuhan Fanhua Biotechnology Company (Wuhan, China). ^dThe vitamin and mineral premix provided the following amounts per kg of complete diet: retinol acetate, 2700 µg; cholecalciferol, 62.5 µg; dl-α-tocopheryl acetate, 20 mg; menadione, 3 mg; vitamin B₁₂, 18 µg; riboflavin, 4 mg; niacin, 40 mg; pantothenic acid, 15 mg; choline chloride, 400 mg; folic acid, 700 µg; thiamin, 1.5 mg; pyridoxine, 3 mg; biotin, 100 µg; Zn, 80 mg (ZnSO₄·7H₂O); Mn, 20 mg (MnSO₄·5H₂O); Fe, 83 mg (FeSO₄·H₂O); Cu, 25 mg (CuSO₄·5H₂O); I, 0.48 mg (KI); Se, 0.36 mg (Na₂SeO₃·5H₂O). ^eCalculated. ^fAnalyzed.

On d 19 of the trial, the challenged groups were injected i.p. with E. coli LPS at 100 µg/kg BM and the unchallenged group was injected with the same amount of 0.9% (wt/vol) saline. The LPS was dissolved in sterile 0.9% saline. The dose of LPS was selected in accordance with our previous experiment.²¹

Sample collection

Four h after administration of LPS or sterile solution, all pigs were anesthetized by injection of sodium pentobarbital (80 mg/kg BM). The abdomen was opened through a midline incision and mesenteric lymph nodes (MLN), liver and spleen were harvested for determination of bacterial translocation. The jejunum and ileum were separated and flushed with ice-cold 0.9% NaCl solution. A 1–3-cm-long cross section of intestinal tissue was obtained from the mid-jejunum and mid-ileum, and placed in 4% paraformaldehyde in PBS for histological analysis. About 12 cm middle portions of jejunum and ileum were cut longitudinally and washed with ice-cold PBS. Mucosal samples were gently scraped with sterile glass slides from the connective tissue, immediately frozen in liquid nitrogen and then stored at −80℃ until further analysis.

Bacterial translocation

Bacterial translocation, which is associated with the failure of intestinal barrier function, has been described in detail previously.²² Briefly, the collected MLN, spleen and liver were separately weighed and homogenized in 10 volumes of ice-cold sterile 0.9% saline. Fifty μl of tissue homogenates from different organs were uniformly smeared onto blood and MacConkey agar plates. The plates were examined after 48 h of incubation at 37℃ under aerobic conditions. The colony counting was performed in a blind manner. The viable bacterial counts were expressed as log 10 colony-forming units (CFU)/g of tissue mass. For each tissue, bacterial translocation was considered positive when the CFU was >100 per g of tissue.

Intestinal morphology

Fixed intestinal samples were dehydrated, cleared and embedded in paraffin. Three cross-sections (4 µm thick) for each intestinal sample were stained with hematoxylin and eosin. For quantification of mast cells, intestinal sections were stained with toluidine blue (pH 4.0). A total of 10 intact, well-oriented villi and their associated crypts from each segment were selected to determine the villus height and crypt depth. Villus:crypt ratio was calculated by dividing villus height by crypt depth. The same villus and crypt were used to measure the number of intraepithelial lymphocytes (IEL), goblet cells and intravillus lamina propria cell density. These variables were expressed per 100 enterocytes (IEL and goblet cells) and number of cells/mm² (intravillus lamina propria cell density).

On basis of cellular and nuclear morphology and toluidine blue staining (for mast cell), the numbers of neutrophils and mast cells were counted at 40× magnification. Cell counts were conducted on six different fields per slides and six slides per treatment, and expressed as number of cells/mm². All cell counts and intestinal morphologic measurements were performed by a blinded reviewer.

Western blot analysis

Briefly, the intestinal tissues (100–150 mg, n = 6) were homogenized and lysed in chilled lysis buffer. The homogenates were centrifuged at 12,000 g for 15 min at 4℃, and the supernatant was collected for Western blot and protein assay. Protein concentration was determined using the bicinchoninic acid protein assay kit (Applygen Technologies, Beijing, China). Intestinal mucosa proteins were separated by PAGE and transferred to polyvinylidene difluoride membranes. Membranes were blocked for non-specific binding for 1 h (3% BSA in TBS–Tween-20 buffer) at room temperature (21–25℃), and incubated overnight (12–16 h) at 4℃ with rabbit anti-human claudin-1 Ab [1:1000; #51-9000 (Invitrogen Technology, Danvers, MA, USAame dietary fat level (5% corn oil vs, 5%)] or mouse anti-β-actin Ab [monoclonal; 1:10000; #A2228 (Sigma Aldrich, St. Louis, MO, USA)]. The membranes were subsequently incubated with goat anti-rabbit (#ANT020) or mouse (#ANT019) immunoglobulin G HRP-conjugated secondary Ab (1:5000; AntGene Biotech, Wuhan, China) for 120 min at room temperature. Chemiluminescence signal was detected with enhanced Chemiluminescence Western blotting kit (Amersham Biosciences, Uppsala, Sweden), visualized using a Gene Genome bioimaging system. The bands were quantified by densitometric analysis using GeneTools software (Syngene, Frederick, MD, USA). The result was expressed as the abundance of claudin-1 protein to β-actin protein.

mRNA expression analysis by real-time PCR

The mRNA expression was measured by quantitative real-time PCR (qPCR) as previously described.²³ Briefly, total RNA was isolated from small intestinal tissues using TRIzol Reagent [#9108; TaKaRa Biotechnology (Dalian), Dalian, China] according to the manufacturer’s protocols. The concentration and purity of isolated RNA were assessed by spectrophotometry based on the OD₂₆₀/OD₂₈₀ ratio. RNA integrity was confirmed by agarose gel electrophoresis. Then, total RNA (2 µg) was reverse transcribed into cDNA using PrimeScript RT reagent kit with gDNA eraser [#RR047A; TaKaRa Biotechnology (Dalian)]. Real-time PCR was performed on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Life Technologies, Waltham, MA, USA) using a SYBR® Premix Ex Taq™ (Tli RNase H Plus) qPCR kit [#RR420A; TaKaRa Biotechnology (Dalian)], according to the manufacturer’s instructions. The primer sequences and accession numbers are shown in Table 2. Primer specificity was verified by melting curve analysis, as well as by agarose gel electrophoresis for PCR products of targeted genes. The expression of the target genes relative to housekeeping gene (GAPDH) was analyzed by the 2^–ΔΔCT method of Livak and Schmittgen.²³ Our results demonstrated that there was no difference in GAPDH expression among treatments and tissues. Relative mRNA abundance of each target gene was normalized to the control group.

Table 2.

Primer sequences used for real-time PCR.

Gene	Forward (5′-3′)	Reverse (5′-3′)	Efficiency (%)	Product length (bp)	Accession numbers
CRFR1	CTCATCTCCGCCTTCATCCT	CCAAACCAGCACTTCTCATT	97	271	AF077185
CRF	CCGCCAGGAGGCACCCGAGAGG	GCCAAACGCACCGTTTCACTTC	98	178	NM_001113062.1
GR	CCAAACTCTGCCTTGTGTGTTC	TGTGCTGTCCTTCCACTGCT	100	108	AY779185
Tryptase	ACCGGCCTGGCATCTACAC	AGGAGGTGACTGGCTTTGCA	96	110	AB038652
GAPDH	CGTCCCTGAGACACGATGGT	GCCTTGACTGTGCCGTGGAAT	100	194	AF017079.1

Statistical analyses

Statistical analysis was carried out by ANOVA using the General Linear Model procedure in SAS (SAS Institute, Cary, NC, USA). Pig was the experimental unit. A post hoc LSD test was used to determine differences between treatments (CONTR vs. LPS, LPS vs. LPS + 0.5% ASN and LPS vs. LPS + 1.0% ASN) following ANOVA. Bacterial translocation (positive animals) data were analyzed by the one-way ANOVA and the Fisher’s exact test. Results were considered significantly different if P < 0.05. Instances in which 0.05 < P ≤ 0.10 were discussed as trends.

Results

Bacterial translocation

The bacterial translocation incidences and translocation of microorganisms in MLN, liver and spleen are summarized in Tables 3 and 4. Neither LPS nor ASN supplementation altered bacterial translocation incidence and translocation of microorganisms in MLN, liver and spleen.

Table 3.

Effects of ASN supplementation on the incidences of bacterial translocation in weaned pigs challenged by E. coli LPS.^a

Item	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN
MLN	2	4	2	3
Spleen	2	3	3	2
Liver	3	4	3	2

For each tissue, bacterial translocation was considered positive when the CFU were greater than 100 per g of tissue. n = 6 (one pig/pen). CONTR (non-challenged control): pigs fed a control diet and injected with sterile saline; LPS (LPS challenged control): pigs fed the same control diet and challenged with E. coli LPS; LPS + 0.5% ASN: pigs fed a 0.5% ASN diet and challenged with LPS; LPS + 1.0% ASN: pigs fed a 1.0% ASN diet and challenged with LPS.

Table 4.

Effects of ASN supplementation on translocation microorganisms of weaned pigs challenge by E. coli LPS.^a

Item	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	Contrast^b
Item	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	1	2	3
MLN	4.76	4.91	3.96	3.92	0.30	0.860	0.278	0.281
Spleen	3.81	4.75	4.16	3.86	0.35	0.373	0.572	0.416
Liver	4.74	4.91	4.03	3.91	0.31	0.858	0.323	0.286

Values are means and combined SEM, n = 6 (1 pig/pen). The values were expressed in log10 (CFU)/g of the organ’s mass. CONTR (non-challenged control): pigs fed a control diet and injected with sterile saline; LPS (LPS challenged control): pigs fed the same control diet and challenged with E. coli LPS; LPS + 0.5% ASN: pigs fed a 0.5% ASN diet and challenged with LPS; LPS + 1.0% ASN: pigs fed a 1.0% ASN diet and challenged with LPS. ^bContrast: (1) CONTR vs. LPS; (2) LPS vs. LPS + 0.5% ASN; (3) LPS vs. LPS + 1.0% ASN.

Intestinal histology

The mucosal structure of intestine was analyzed by light microscopy. The intestinal mucosa in CONTR appeared intact and was in good condition (Figure 1a). Pigs challenged with LPS exhibited intestinal mucosal damage, including lifting of epithelium at the tip of the villus and villous atrophy (Figure 1b). ASN supplementation mitigated intestinal mucosal injury caused by LPS (Figure 1c, d). Pigs challenged with LPS had lower villus height in jejunum (P = 0.045) and ileum (P = 0.048) than those injected with saline (Table 5). Pigs fed ASN diets had an increased villus height in jejunum (1% ASN; P = 0.006) and ileum (0.5% ASN; P = 0.001) vs. pigs challenged with LPS. However, pigs challenged with LPS had lower crypt depth in ileum (P = 0.003) than pigs in the CONTR group. Supplementation of 0.5% ASN increased crypt depth in ileum (P < 0.001) vs. LPS-challenged pigs. Furthermore, pigs challenged with LPS had lower villus height/crypt depth in jejunum (P = 0.014) and ileum (P = 0.029) than pigs in the CONTR group. Supplementation of 1.0% ASN tended to increase villus height/crypt depth in jejunum (P = 0.093) and ileum (P = 0.062) compared with LPS-challenged pigs

Figure 1.

Intestinal mucosal histological appearance of jejunum (hematoxylin and eosin). (a) Pigs fed a control diet and injected with sterile saline. No obvious damage was found. (b) Pigs fed control diet and injected with LPS. Intestinal mucosa was seriously damaged by LPS. Arrows represent the lifting of epithelium at the tip of the villus (a) and villous atrophy (b). (c) Pigs fed a 0.5% ASN diet and challenged with LPS. Intestinal mucosal damage was alleviated. (d) Pigs fed a 1.0% ASN diet and challenged with LPS. Intestinal mucosal damage was alleviated. Original magnification 100×. Scale bars = 82.6 µm.

Table 5.

Effects of ASN supplementation on the intestinal morphology and tight junction protein expression in weaned pigs challenged by E. coli LPS.^a

Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	Contrast^b
Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	1	2	3
Villus height (µm)	Jejunum	262	234	252	278	5.21	0.045	0.185	0.006
Villus height (µm)	Ileum	263	232	289	226	7.03	0.048	0.001	0.657
Crypt depth (µm)	Jejunum	105	98	97	103	2.69	0.399	0.932	0.533
Crypt depth (µm)	Ileum	112	92	118	90	3.27	0.003	<0.001	0.799
Villus height/crypt depth	Jejunum	2.63	2.41	2.53	2.57	0.0304	0.014	0.149	0.093
Villus height/crypt depth	Ileum	2.57	2.38	2.48	2.54	0.030	0.029	0.228	0.062

Values are means and combined SEM, n = 6 (one pig/pen). CONTR (non-challenged control): pigs fed a control diet and injected with sterile saline; LPS (LPS challenged control): pigs fed the same control diet and challenged with E. coli LPS; LPS + 0.5% ASN: pigs fed a 0.5% ASN diet and challenged with LPS; LPS + 1.0% ASN: pigs fed a 1.0% ASN diet and challenged with LPS. ^bContrast: (1) CONTR vs. LPS; (2) LPS vs. LPS + 0.5% ASN; (3) LPS vs. LPS + 1.0% ASN.

Intestinal tight junction protein claudin-1 expression

Western blotting analysis showed that pigs challenged with LPS had lower claudin-1 expression in the jejunal mucosa than pigs in CONTR group (P = 0.015) (Figure 2). However, 0.5% ASN supplementation increased claudin-1 expression in jejunal mucosa (P = 0.006) vs. LPS pigs. Neither LPS nor ASN supplementation affected claudin-1 expression in ileal mucosa.

Figure 2.

Tight junction protein expression in the jejunum and ileum. The bands are representative Western blot images of claudin-1 and β-actin. Values are means and pooled SEM, n = 6 (one pig/pen). CONTR (non-challenged control) = pigs fed a control diet and injected with sterile saline (); LPS (LPS challenged control) = pigs fed the same control diet and challenged with E. coli LPS (); LPS + 0.5% ASN = pigs fed a 0.5% ASN diet and challenged with LPS (); LPS + 1.0% ASN = pigs fed a 1.0% ASN diet and challenged with LPS (). Pigs challenged with LPS had lower claudin-1 expression in the jejunal mucosa than pigs in the CONTR group (P = 0.015). Supplementation of 0.5% ASN increased claudin-1 expression in jejunal mucosa (P = 0.006) vs. LPS pigs. Neither LPS nor ASN supplementation affected claudin-1 expression in ileal mucosa.

Intestinal immune cells and lamina propria cells

Pigs challenged with LPS tended to have lower jejunal IEL numbers than pigs in the CONTR group (P = 0.054) (Table 6). Compared with LPS pigs, pigs fed with ASN diets tended to have an increased jejunal IEL number (0.5% ASN, P = 0.088; 1.0% ASN, P = 0.082). The number of mast cells in jejunum (P = 0.002) and ileum (P = 0.023) was higher in LPS pigs than in CONTR pigs. ASN 0.5% or 1.0% supplementation decreased mast cell number in jejunum (0.5% ASN, P = 0.002; 1.0% ASN, P = 0.008) and ileum (1.0% ASN, P = 0.027) vs. LPS pigs (Figure 3). Similarly, pigs challenged with LPS had higher jejunal neutrophil number (P = 0.003) than CONTR pigs. However, 0.5% or 1.0% ASN supplementation decreased jejunal neutrophil number (0.5% ASN, P = 0.03) or tended to decrease jejunal neutrophil number (1.0% ASN, P = 0.078) vs. LPS pigs (Figure 4). LPS treatment did not affect the numbers of goblet cells and lamina propria cells. However, 0.5% ASN supplementation decreased the number of lamina propria cells in jejunum (P = 0.03) and tended to decrease the number of lamina propria cells in ileum (P = 0.087) compared with LPS pigs.

Table 6.

Effects of ASN supplementation on immune cells and lamina propria cells in the intestine of weaned pigs challenged by E. coli LPS.^a

Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	Contrast^b
Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	1	2	3
IEL/100 enterocytes	Jejunum	18.73	16.63	18.47	18.58	0.36	0.054	0.088	0.082
IEL/100 enterocytes	Ileum	15.78	15.70	17.72	18.57	0.51	0.954	0.170	0.057
Goblet cells/100 enterocytes	Jejunum	0.97	1.15	1.20	0.90	0.08	0.451	0.836	0.326
Goblet cells/100 enterocytes	Ileum	1.80	2.07	1.55	2.13	0.13	0.491	0.145	0.846
Mast cells (mm²)	Jejunum	913	1616	844	967	97	0.002	0.002	0.008
Mast cells (mm²)	Ileum	924	1389	1112	909	77	0.023	0.153	0.027
Lamina propria cells (×10³mm²)	Jejunum	20.31	21.60	19.39	21.57	0.35	0.187	0.030	0.981
Lamina propria cells (×10³mm²)	Ileum	22.81	20.09	24.60	21.02	0.90	0.290	0.087	0.713
Neutrophils (mm²)	Jejunum	193	293	224	236	13	0.003	0.03	0.078
Neutrophils (mm²)	Ileum	342	383	324	368	17	0.413	0.248	0.790

Figure 3.

Photomicrographs of pig jejunal mucosa showing mast cells stained with toluidine blue. (a) Pigs fed a control diet and injected with sterile saline. (b) Pigs fed control diet and injected with LPS. (c) Pigs fed a 0.5% ASN diet and challenged with LPS. (d) Pigs fed a 1.0% ASN diet and challenged with LPS. Arrows indicate toluidine blue-positive mast cells. The numbers of mast cell in intestine were higher in LPS pigs (P < 0.05) than in CONTR pigs. Supplementation with 0.5% or 1.0% ASN decreased mast cell numbers compared with LPS pigs (P < 0.05). Original magnifications 400×. Scale bars = 22.4 µm.

Figure 4.

Representative photomicrographs of pig jejunal mucosa showing neutrophils (hematoxylin and eosin). (a) Pigs fed a control diet and injected with sterile saline. (b) Pigs fed control diet and injected with LPS. (c) Pigs fed a 0.5% ASN diet and challenged with LPS. (d) Pigs fed a 1.0% ASN diet and challenged with LPS. Arrows indicate neutrophils. Pig challenged with LPS had higher jejunal neutrophils numbers (P < 0.05) than CONTR pigs. Supplementation with 0.5% ASN decreased jejunal neutrophils numbers (P < 0.05) compared with LPS pigs. Original magnifications 400×. Scale bars = 22.4 µm.

CRFR1, CRF, glucocorticoid receptor and tryptase mRNA expression

Pigs challenged with LPS had higher mRNA abundance of CRFR1 in jejunum (P < 0.001) and ileum (P = 0.021) than pigs in the CONTR group (Table 7). However, 0.5% ASN supplementation did not prevent the increased expression of CRFR1 of pigs induced by LPS challenge (P = 0.005). LPS challenge did not affect mRNA abundance of CRF and glucocorticoid receptor (GR), whereas 0.5% or 1.0% ASN supplementation decreased mRNA abundance of ileal and jejunal CRF (P < 0.001), and jejunal (0.5% ASN, P = 0.044; 1.0% ASN, P = 0.014) and ileal (0.5% ASN, P = 0.016) GR. Similarly, there was no difference between CONTR pigs and LPS pigs with regard to mRNA abundance of tryptase. Pigs fed ASN had a lower abundance of tryptase mRNA (0.5% ASN, P = 0.047) or tended to have lower abundance of tryptase mRNA (1.0% ASN, P = 0.065) in jejunum than pigs challenged with LPS.

Table 7.

Effects of ASN supplementation on mRNA expression of CRF, GR, tryptase and CRFR1 in the intestine of weaned pigs challenged by E. coli LPS.^a

Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	Contrast^b
Item	Segment	CONTR	LPS	LPS + 0.5% ASN	LPS + 1.0% ASN	SEM	1	2	3
CRFR1	Jejunum	1.00	4.97	7.54	4.83	0.649	<0.001	0.005	0.880
CRFR1	Ileum	1.00	3.57	3.07	3.43	0.365	0.004	0.555	0.882
CRF	Jejunum	1.00	0.85	0.90	1.10	0.076	0.506	0.820	0.280
CRF	Ileum	1.00	1.15	0.52	0.62	0.069	0.251	<0.001	<0.001
GR	Jejunum	1.00	0.90	0.76	0.72	0.032	0.144	0.044	0.014
GR	Ileum	1.00	1.05	0.70	0.92	0.052	0.713	0.016	0.357
Tryptase	Jejunum	1.00	1.22	0.84	0.87	0.066	0.234	0.047	0.065
Tryptase	Ileum	1.00	0.87	1.13	1.11	0.070	0.526	0.214	0.247

Discussion

Stress, in various forms, such as infection and chronic inflammatory stimulation, has been reported to impair intestinal barrier function.³ In this study, we used a well-documented pig model to induce stress and intestinal damage by administering E. coli LPS. Our objective was to examine the protective effects and possible mechanisms of ASN on attenuating LPS stress-induced damage on intestinal barrier and function. In this study, we confirmed that LPS caused typical/classical morphologic changes, such as epithelium sloughing and villous atrophy, reduced villus height and villus height to crypt depth ratio. Generally, epithelium lifting and villous atrophy are accompanied by poor nutrient absorption and increased permeability on intestinal mucosa. Therefore, viable bacteria and their products in intestinal lumen pass through the intestinal wall to MLN and more distant sites, a process known as bacterial translocation.²⁴ Owing to individual animal variation, LPS only resulted in a numerical increase in bacterial translocation incidences and translocation microorganism. ASN supplementation mitigated the intestinal morphologic damage induced by LPS challenge, increased villus height and the ratio of villus height to crypt depth. Intestinal epithelial cell turnover and gut barrier functions are dynamic processes that are markedly affected by nutritional status, the route of feeding and the adequacy of specific nutrients in the diet.²⁵ Specifically, it needs adequate amounts of ‘fuel’, like amino acids and Glc to maintain and repair intestinal integrity and function under stress conditions.²⁶ In our study, dietary ASN might be converted to aspartate (ASP) and glutamate for the major fuels of the small intestinal mucosa. Furthermore, ASN is a powerful stimulator of ornithine decarboxylase and cell proliferation in a variety of cell types, including colonic cells.¹³ We also found that 0.5% ASN increased the crypt depth compared with the LPS group. A deeper crypt may indicate faster tissue turnover to permit renewal of the villus,²⁷ and the intestinal response is to try to compensate for lifting or atrophy of villus due to LPS challenge. Therefore, ASN protected and maintained the integrity of intestinal mucosa. It is critical for maintaining gut barrier function.

Tight junctions between intestinal epithelial cells play a critical role in intestinal barrier function. Tight junctions are organized by four types of transmembrane protein, occludin, claudin, tricellulin and junctional adhesion molecules, and many other regulatory proteins.^21,28,29 Of them, the valuable and essential ones are occludin, claudins and ZO-1, which participate in tight junction structural integrity.³⁰ In the present study, LPS reduced the expression of tight junctional protein claudin-1. ASN supplementation enhanced the expression of claudin-1 in jejunum of pigs challenged with LPS. Our results suggested that ASN supplementation might help to repair the tight junction damage of pigs challenged with LPS, and restore the intestinal barrier function.

The intestinal barrier includes physical diffusion barrier, physiological and enzymatic barriers, and immunological barriers.³ IELs are one of the components of the intestinal immunological barrier and might serve as a first line of defense against intestinal pathogens.³¹ It is well known that LPS can cause intestinal barrier dysfunction and induce inflammatory response.³² In the present study, LPS increased neutrophil infiltration and decreased IEL numbers in the intestine. However, ASN supplementation tended to increase IEL numbers and decrease neutrophil infiltration in jejunum. Currently, there are a few studies on the regulation of IEL through dietary ASN supplementation. Kandil et al.³³ reported that ASN could stimulate proliferation of a porcine jejunal cell line through the stimulation of ornithine decarboxylase. In addition, a previous study in mice showed that the decrease in IEL number was associated with decreasing tight junction integrity in intestine.³⁴ IELs play protective roles in defense against infection, repair of injury of mucosal barrier and maintenance of the barrier function in the intestine.³⁵ Our results indicated that ASN maintained intestinal barrier integrity by inducing the proliferation of IELs and alleviating the intestinal inflammatory response.

Although it is known that stress impairs intestinal barrier function, the precise mechanism has not been fully elucidated. Several studies have demonstrated that stress-induced intestinal barrier dysfunction is due to the activation of CRF/CRFR pathway in the intestine.^7,8 CRF produced in the central nervous system and peripheral tissue in response to stress has been shown to play a central role in stress-induced intestinal pathophysiology. Wang et al.³⁶ found that weaning stress disrupted the epithelial barrier and increased mRNA and protein abundance of CRF in jejunum. Overman et al.⁷ reported that in vitro CRF exposure to ileal mucosa increased intestinal paracellular permeability. In fact, CRF activity is mediated by activation of seven specific transmembrane G-protein-coupled receptors known as CRFR1 and CRFR2.³⁷ Moeser et al.³⁸ showed that weaning-induced intestinal dysfunction was mediated by the activation of peripheral CRFR. Smith et al.⁸ demonstrated that CRFR1 likely mediated the damage of intestinal barrier function and hypersecretion in early-weaned pigs. In agreement with these findings, our study showed that LPS increased mRNA abundance of CRFR1 in intestine. In addition, GR is a downstream factor of the CRF/CRFR signaling pathway. Several studies have shown that dysfunction of the intestinal barrier induced by stress might be mediated by GR and adrenal corticosteroids.^39,40 However, we found that LPS did not affect mRNA the abundance of CRF and GR. It is a complex process for activation of the CRF/CRFR pathway. It needs more factors to participate. Interestingly, our data showed that ASN supplementation decreased mRNA abundance of CRF in ileum and mRNA abundance of GR in jejunum. Similarly, Erwan et al.⁴¹ reported that central injection of L- and D-ASP attenuated stress behavior induced by social isolation and CRF in neonatal chicks. ASN can be converted to L-ASP, which induces sedative effects under acutely stressful conditions. These findings supported the current results that ASN might inhibit stress response and protect intestinal barrier function by regulating CRF/CRFR1 signaling pathway.

In recent years, there has been increasing evidence that stress enhances gut mucosal permeability by a mast cell-dependent mechanism.^42,43 Our study showed that LPS stress increased mast cell number in intestinal mucosa. Similarly, Zhong et al.⁴⁴ found that the number of submucosal mast cells was increased after stress. Studies have shown that the inflammatory infiltrate is dominated by increasing populations of activated mast cells in patients with irritable bowel syndrome.^45,46 Activated mast cells release tryptase.⁴⁷ Tryptase is the most abundant secretory granule-derived serine proteinase contained in mast cells that leads to the activation of sensory neurons and the regulation of mucosal permeability.⁴⁸ In the present study, ASN ameliorated the increase in mast cell number and abundance of tryptase mRNA in jejunum and ileum, which were induced by LPS. It is possible that ASN inhibited the mast cell activation, which resulted in a decrease in mast cell number and abundance of tryptase mRNA in pigs challenged with LPS. The exact mechanisms are not understood. Further investigation is needed.

In conclusion, LPS stress impairs intestinal barrier function, which can be alleviated by ASN. Dietary supplementation with ASN helps maintain intestinal mucosa homeostasis, which is associated, in part, with regulation of the CRF/CRFR1 signaling pathway and mast cell activation.

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was financially supported by the National Natural Science Foundation of China (31372318 and 31422053) and the State’s Key Project of Research and Development (2016YFD0501210).

References

Suzuki

Hara

. Quercetin enhances intestinal barrier function through the assembly of zonnula occludens-2, occluding, and claudin-1 and the expression of claudin-4 in caco-2 cells. J Nutr 2009; 139: 965–974.

Zareie

Johnson-Henry

Jury

et al.

Probiotics prevent bacterial translocation and improve intestinal barrier function in rats following chronic psychological stress. Gut 2006; 55: 1553–1560.

Söderholm

Perdue

. Stress and the gastrointestinal tract II. Stress and intestinal barrier function. Am J Physiol Gastrointest Liver Physiol 2001; 280: G7–G13.

Kuge

Meerveld

BGV

Sokabe

. Stress-induced breakdown of intestinal barrier function in the rat: reversal by wood creosote. Life Sci 2006; 79: 913–918.

Wiley

Higgins

Athey

. Stress and glucocorticoid receptor transcriptional programming in time and space: implications for the brain-gut axis. Neurogastroenterol Motil 2016; 28: 12–25.

Teitelbaum

Gareau

Jury

et al.

Chronic peripheral administration of corticotrophin-releasing factor causes colonic barrier dysfunction similar to psychological stress. Am J Physiol Gastrointest Liver Physiol 2008; 295: G452–G459.

Overman

Rivier

Moeser

. CRF induces intestinal epithelial barrier injury via the release of mast cell proteases and TNF-α. PLOS ONE 2012; 7: 1–9.

Smith

Clark

Overman

et al.

Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastrointest Liver Physiol 2010; 298: G352–G363.

Viana

Santos

RGC

Generoso

et al.

The role of L-arginine-nitric oxide pathway in bacterial translocation. Amino Acids 2013; 45: 1089–1096.

10.

Ferreira

Leonel

Melo

et al.

Oral supplementation of butyrate reduces mucosal and intestinal permeability associated with 5-fluorouracil administration. Lipids 2012; 47: 669–678.

11.

Baumgart

Dignass

. Intestinal barrier function. Curr Opin Clin Nutr Metab Care 2002; 5: 685–694.

12.

Rhoads

Argenzio

Chen

Gomez

. Asparagin stimulates piglet intestinal Cl⁻ secretion by a mechanism requiring a submucosal glutamate receptor and nitric oxide. J Pharmacol Exp Ther 1995; 274: 404–412.

13.

McCormack

Tague

Cragoe

Johnson

. Regulation of ornithine decarboxylase activity in LoVo cells. Am J Physiol 1990; 258: G934–G941.

14.

Liu

Huang

Hou

et al.

Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br J Nutr 2008; 100: 552–560.

15.

Wieczorek

Dunn

. Noradrenergic and HPA responses to LPS following indomethacin or subdiaphragmatic vagotomy—a microdialysis study. Brain Behav Immun 2006; 20: e71–e81.

16.

Becker

Nienaber

Christenson

et al.

Peripheral concentrations of cortisol as an indicator of stress in the pig. Am J Vet Res 1985; 46: 1034–1038.

17.

Johnson

von Borell

. Lipopolysaccharide-induced sickness behavior in pigs is inhibited by pretreatment with indomethacin. J Anim Sci 1994; 72: 309–314.

18.

Moughan

Birtles

Cranwell

et al.

The piglet as a model animal for studying aspects of digestion and absorption in milk-fed human infants. World Rev Nutr Diet 1992; 67: 40–113.

19.

Wang

Liu

et al.

Asparagine attenuates intestinal injury, improves energy status and inhibits AMP-activated protein kinase signaling pathways in weaned piglets challenged with Escherichia coli lipopolysaccharide. Br J Nutr 2015; 114: 553–565.

20.

NRC. Nutrient requirements of swine, 10th ed. Washington, DC: National Academic Press, 1998.

21.

Liu

Chen

et al.

Fish oil alleviates activation of the hypothalamic-pituitary-adrenal axis associated with inhibition of TLR4 and NOD signaling pathways in weaned piglets after a lipopolysaccharide challenge. J Nutr 2013; 143: 1799–1807.

22.

Yang

Han

Uchiyama

et al.

IL-6 is essential for development of gut barrier dysfunction after hemorrhagic shock and resuscitation in mice. Am. J. Physiol Gastrointest Liver Physiol 2003; 285: G621–G629.

23.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and 2^–^ΔΔCT method. Methods 2001; 25: 402–408.

24.

Gatt

Reddy

MacFie

. Review article: bacterial translocation in the critically ill-evidence and methods of prevention. Aliment Pharmacol Ther 2007; 25: 741–757.

25.

Ziegler

Evans

Fernández-Estívariz

Jones

. Trophic and cytoprotetive nutrition for intestinal adaptation, mucosal repair, and barrier function. Annu Rev Nutr 2003; 23: 229–261.

26.

Corpeleijn

Riedijk

Zhou

et al.

Almost all enteral asparate is taken up in first-pass metabolism in enterally fed preterm infants. Clin Nutr 2010; 29: 341–346.

27.

Gao

Zhang

et al.

Effects of yeast culture in broiler diets on performance and immunomodulatory functions. Poult Sci 2008; 8: 233–241.

28.

Harhaj

Antonetti

. Regulation of tight junctions and loss of barrier function in pathophysiology. Int J Biochem Cell Biol 2004; 36: 1206–1237.

29.

Ruan

Zhou

et al.

Chlorogenic acid enhances intestinal barrier by decreasing MLCK expression and promoting dynamic distribution of tight junction proteins in colitic rats. J Funct Foods 2016; 26: 698–708.

30.

Liu

Guan

Fang

et al.

Macleaya cordata extract decreased diarrhea score and enhanced intestinal barrier function in growing piglets. Biomed Res Int 2016; 2016: 1069585–1069585.

31.

Xiong

Yang

Wang

et al.

Effect of low dosage of chito-oligosacchride supplementation on intestinal morphology, immune response, antioxidant capacity, and barrier function in weaned piglets. J Anim Sci 2015; 93: 1089–1097.

32.

Deventer

SJH

Cate

Tytgat

GNJ

. Intestinal endotoxemia. Clinical significance. Gastroenterology 1988; 94: 825–831.

33.

Kandil

Argenzio

Chen

et al.

L-glutamine and L-asparagine stimulate ODC activity and proliferation in a procine jejunal enterocyte line. Gastrointest Liver Physiol 1995; 32: G591–G599.

34.

Kudsk

. Current aspects of mucosal immunology and its influence by nutrition. Am J Surg 2002; 183: 390–398.

35.

Inagaki-Ohara

Dewi

Hisaeda

et al.

Intestinal intraepithelial lymphocytes sustain the epithelial barrier function against Eimeria vermiformis infection. Infec Immun 2006; 74: 5292–5301.

36.

Wang

Zhang

et al.

Glutamine enhances tight junction protein expression and modulates corticotrophin releasing factor signaling in the jejunum of weanling piglets. J Nutr 2015; 145: 25–31.

37.

Tache

Martinez

Wang

Million

. CRF1 receptor signaling pathways are involved in stress-related alterations of colonic function and viscerosensitivity: implications for irritable bowel syndrome. Br J Pharmacol 2004; 141: 1321–1330.

38.

Moeser

Klok

Ryan

et al.

Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am J Physiol Gastrointest Liver Physiol 2007; 292: G173–G181.

39.

Moussaoui

Braniste

Ait-Belgnaoui

et al.

Changes in intestinal glucocorticoid sensitivity in early life shape the risk of epithelial barrier defect in maternal-deprived rats. PLOS ONE 2014; 2: e88382–e88382.

40.

Meddings

Swain

. Environmental stress-induced gastrointestinal permeability is mediated by endogenous glucocorticoids in the rat. Gastroenterology 2000; 119: 1019–1028.

41.

Erwan

Chowdhury

Nagasawa

et al.

Central injection of L- and D-aspartate attenuates isolation-induced stress behavior in chicks possibly through different mechanisms. Eur J Pharmacol 2014; 736: 138–142.

42.

Santos

Yang

Söderholm

et al.

Role of mast cells in chronic stress induced colonic epithelial barrier dysfunction in the rat. Gut 2001; 48: 630–636.

43.

Vicario

Guilarte

Alonso

et al.

Chronological assessment of mast cell-mediated gut dysfunction and mucosal inflammation in a rat model of chronic psychosocial stress. Brain Behav Immun 2010; 24: 1166–1175.

44.

Zhong

Wang

Zhang

et al.

Mast cell activation is involved in stress-induced epithelial barrier dysfunction in the esophagus. J Dig Dis 2015; 16: 186–196.

45.

Guilarte

Santos

de Torres

Alonso

et al.

Diarrhoea-predominant IBS patients show mast cell activation and hyperplasia in the jejunum. Gut 2007; 56: 203–209.

46.

Chadwick

Chen

Shu

et al.

Activation of the mucosal immune system in irritable bowel syndrome. Gastroenterology 2002; 122: 1778–1783.

47.

Gaça

Walls

. A role for tryptase in the activation of human mast cells: modulation of histamine release by tryptase and inhibitors of tryptase. J Pharmacol Exp Ther 1998; 286: 289–297.

48.

Jacob

Yang

Darmoul

et al.

Mast cell tryptase controls paracellular permeability of the intestine: Role of protease-activated receptor 2 and β-arrestins. J Biol Chem 2005; 280: 31936–31948.

Asparagine preserves intestinal barrier function from LPS-induced injury and regulates CRF/CRFR signaling pathway

Abstract

Keywords

Introduction

Material and methods

Animals, diets, and experimental design

Sample collection

Bacterial translocation

Intestinal morphology

Western blot analysis

mRNA expression analysis by real-time PCR

Statistical analyses

Results

Bacterial translocation

Intestinal histology

Intestinal tight junction protein claudin-1 expression

Intestinal immune cells and lamina propria cells

CRFR1, CRF, glucocorticoid receptor and tryptase mRNA expression

Discussion

Footnotes

Declaration of Conflicting Interests

Funding

References