Sage Journals: Discover world-class research

Abstract

Lipopolysaccharides are structural components within the cell walls of Gram-negative bacteria. The LPSs as microbe-associated molecular pattern (MAMP) molecules can trigger defense-related responses involved in MAMP-triggered immunity and basal resistance in plants, presumably from an initial perception event. LPS from Burkholderia cepacia as well as two fragments, the glycolipid, lipid A and the polysaccharide (OPS-core) chain, were used to treat Arabidopsis thaliana seedlings to evaluate the eliciting activities of the individual LPS sub-domains by means of Annealing Control Primer-based Differential Display transcript profiling. Genes found to be up-regulated encode for proteins involved in signal perception and transduction, transcriptional regulation and defense – and stress responses. Furthermore, genes encoding proteins involved in chaperoning, secretion, protein–protein interactions and protein degradation were differentially expressed. It is concluded that intact LPS, as well as the two sub-components, induced the expression of a broad range of genes associated with perception and defense as well as metabolic reprogramming of cellular activities in support of immunity and basal resistance. Whilst the lipid A and OPS moieties were able to up-regulate sub-sets of defense-associated genes over the same spectrum of categories as intact LPS, the up-regulation observed with intact LPS was the more comprehensive, suggesting that the lipid A and glycan molecular patterns of the molecule act as partial agonists, but that the intact LPS structure is required for full agonist activity.

Keywords

innate immunity lipid A lipopolysaccharides MAMPs O-polysaccharide defense transcriptome

Introduction

In addition to preformed defenses, plants can specifically recognize pathogenic microbes and then respond with appropriate defense mechanisms by activating a multicomponent defense response.^1,2 Complex signaling pathway(s), involving cytosolic Ca²⁺ and H⁺ ions, reactive oxygen intermediates (ROI), jasmonic acid (JA), salicylic acid (SA) and ethylene, trigger inducible defense responses³ characterised by defense gene activation, activation of programmed hypersensitive response (HR) cell death to restrict the invading pathogen and production of phytoalexins and pathogenesis-related (PR) proteins.⁴^–⁶

Activation of the signal transduction cascades depends on the initial recognition of the plant pathogen, perceived by receptor proteins encoded by receptor-like protein/kinase (RLP/K) genes to trigger pathogen-triggered immunity (PTI). Microbe-associated molecular pattern (MAMP) molecules have several common characteristics including highly conserved structures, indispensability to the micro-organism and their absence in host organisms.^7,8 To date, several MAMPs from different micro-organisms (bacteria, fungi, and oomycetes) have been reported with the potential to trigger plant defense responses, and include flagellin, chitin, cell wall derived oligogalacturonides, elongation factor Tu, peptidoglycan and LPSs.^2,9 The corresponding receptors for some of these MAMPs in plants have been identified and characterized as pattern recognition receptor-like proteins/kinases (PRR-RLP/Ks). Such include, amongst others, the flagellin sensing 2 (FLS2) receptor for flagellin and the EFR for the elongation factor Tu; their functions towards enhanced plant pathogen responses are well documented.¹⁰^–¹² Although no receptor for LPSs has been identified thus far, it can be recognized by plants to trigger defense-related responses.¹³^–¹⁷ These biochemical changes may be associated with the HR-preventative and priming activities reported for LPSs.¹⁶

On-going research on the LPS from a plant-associated endophyte (Burkholderia cepacia, strain ASP B 2D) has shown that it exhibits inducing capacity as a modulator of defense-related responses.¹⁸ We have previously shown that LPS_B.cep. can elicit defense responses on a cellular level. These responses include influx of calcium, an oxidative burst, an NO burst, extracellular alkalinization (K⁺/H⁺ exchange), and changes in reversible protein phosphorylation, including MAP-kinase activation.^14,19^–²³ In addition, the synthesis of inducible PR proteins was observed in tobacco.¹⁸ The identification of RLK and resistance (R) genes up-regulated by LPS_B.cep. in tobacco cells was indicative of the operation of an innate immune recognition system and expression of basal resistance.¹⁸ The altered gene expression in response to LPS may be responsible for activation of surveillance mechanisms and enhancement of the non-self recognition capacity²⁴ supporting the induction of an enhanced defensive capacity¹⁸ or systemic acquired resistance (SAR) by LPSs.²⁵

Up to now, the eliciting or MAMP-active part(s) of LPSs have not been fully identified. As lipoglycan macromolecules, LPSs can potentially contain MAMP structures within the lipid A, oligosaccharide core and O-polysaccharide (OPS). Lipopolysaccharides from bacteria have developed a wide spectrum of compositionally different LPSs²⁶ and not only the OPS, but also the attached core and the lipid A region can vary in structure. The OPS extending outward from the bacterial cell surface are exposed to the environment and the defense system of a potential host, and have been found to play a role in triggering plant defenses. The structural variation of the OPS of bacterial pathogen and symbiont LPSs and their roles in plant-microbe interactions was previously reviewed.²⁷ The composition and/or size of the OPS might be reliable indicators of virulence potential and appears to be part of a molecular communication between the bacterium and the host plant.^27,28

It is increasingly believed that the lipid A of LPSs from different species lies at the center of the biological activity of LPSs;^16,23 for example, lipid A has been implicated to be the inducing part of LPS from Xanthomonas campestris pv. campestris.^16,29,30 This is believed to be due to the fact that lipid A is relatively conserved in many Gram-negative bacteria, while the OPS shows variations from one organism to another.^28,31 Rough-LPS (LPS lacking an OPS), i.e. lipooligosaccharides (LOSs), were found to exhibit biological activity similar to those of intact LPS_X.cam. These activities include induction of plant defenses, monitored by the expression of the PR1 and PR2 genes.³²

It has been observed that certain bacteria can manipulate the composition of their lipid A in response to environmental cues and thereby modulate or even antagonize the triggering of innate host responses.^16,30,33,34 Variations in lipid A structures are exhibited by different fatty acid and phosphate numbers and locations and can lead to a heterogeneity even in the same bacterium.³⁵ The chemical composition, structure and conformation of lipid A may thus be important determinants during a plant’s interaction with pathogenic or beneficial bacteria.

Support for multiple MAMPs within the LPS structure comes from Silipo et al.,³² that showed that the LOS from X. campestris was able to induce defense-related gene transcription in two temporal phases. This LOS_X.cam. did not contain an OPS chain, but only a very peculiar core oligosaccharide ending up with a terminal mannose disaccharide. The core oligosaccharide induced the earlier phase only and, in contrast, the lipid A induced the latter phase only. The data suggested that not only can plant cells recognise lipid A and core oligosaccharide structures within LOS in order to trigger defensive cellular responses, but that this recognition may occur via two distinct recognition events.^28,32

Using a different approach with LPS mutants of X. campestris, Braun et al.²⁹ reported that the LPS_X.cam. substructure recognized by tobacco cells is localized in the inner core region of the LPS, consisting of the glucose, galacturonic acid and 3-deoxy-D-manno-oct-2-ulosonic (Kdo) acids. Although lipid A seems to be insufficient to induce an oxidative burst in tobacco cells, it could not be ruled out that lipid A or the glucosamine backbone might be important in combination with the inner core oligosaccharides.

In the current study, the MAMP-active eliciting determinant(s) of LPS_B.cep. were investigated by comparing the genes of which the expression is increased at a transcriptional level by lipid A and the OPS to those induced by the intact LPS in A. thaliana. Here, a very sensitive variant of differential display mRNA profiling, the Annealing Control Primer (ACP)-based Differential Display Reverse Transcription Polymerase Chain Reaction (DDRT-PCR)^36,37 was used to obtain information about the respective transcriptomes.

Materials and methods

Plant material

Arabidopsis thaliana (Colombia ecotype) seeds were surface sterilized and grown in 0.5× Murashige and Skoog (MS) medium containing 2% glucose at pH 6.³⁸ Seedlings were grown in horizontal Falcon tubes on an orbital shaker at approximately 25 rpm at 24°C in a 9-h light/15-h dark photoperiod.

Lipopolysaccharide, lipid A and OPS preparation

Burkholderia cepacia strain ASP B 2D was grown in nutrient broth liquid medium and LPS was extracted, purified and characterized as previously described.¹⁸ The OPS was prepared and purified as previously described.³¹ Briefly, LPS was hydrolyzed with aqueous 1% acetic acid for 2 h at 100°C and centrifuged (6000 g, 4°C, 1 h). The supernatant (OPS-core fraction, 55 mg, 90% LPS), was further purified by gel permeation chromatography on a Sephacryl S100-HR column (90 × 1.5 cm) using 0.05 m ammonium bicarbonate as the eluent and monitored with a differential refractometer. Free lipid A was prepared according to Silipo et al.³⁹ by subjecting LPS (10 mg) to mild hydrolysis with 0.1 m sodium acetate buffer (pH 4.4) containing 1% SDS at 100°C, until a precipitate was visible in the tube. The solution was lyophilized, treated with 2 m HCl:ethanol (1:100, v/v) to remove the SDS, evaporated, dissolved in water and ultracentrifuged (100,000 g, 4°C, 90 min). The obtained precipitate (free lipid A) was washed with water (yield: 1.8 mg, 18% of the LPS).

Plant elicitation

Ten-day-old seedlings were harvested and placed in fresh 0.5× MS medium. Stock solutions of LPS, lipid A and OPS in MS medium were added to final concentrations of 100 µg/ml, 20 µg/ml and 50 µg/ml respectively, in separate tubes. Plant elicitation was allowed to take place for 8 h while the tubes were continuously rotated at 25 rpm as described above.

Isolation of RNA

After 8 h of elicitation, seedlings were harvested and collected using vacuum filtration. Total RNA was isolated using the Trizol reagent method (Sigma-Aldrich, Germany). RNA integrity and concentration were assessed by denaturing RNA gel electrophoresis and NanoDrop Spectrophotometry (NanoDrop Technologies Inc., Wilmington, USA). The most important aspect for the success of ACP-DDRT-PCR is the quality of RNA. The RNA used in the study was of a high standard, and DNA-free, following treatment with RNase-free DNase (Promega) according to the manufacturer’s instructions.

Differential display

Annealing Control Primer-based DDRT-PCR was performed on the total RNA using the GeneFishing DEG premix kit (Seegene, Seoul, South Korea) according to the manufacturer’s instructions, using 40 different arbitrary primers in combination with a oligo-dT anchor primer. Annealing Control Primer-based DDRT-PCR amplicons were evaluated on 1.5% agarose gels stained with Gel Green stain (Biotum Inc., Hayward, USA). In order to identify differentially expressed bands, LPS, lipid A, and OPS-responsive amplicons were analyzed parallel to the control amplicons. Display patterns obtained with biological replicates were reproducible. Bands which represented up-regulated genes were excised from the gel with a sterile scalpel blade and kept at –80°C until further use. The DNA was extracted from gel slices using the Zymoclean Gel DNA Recovery kit (Zymo Research, USA). The extracted cDNAs were re-amplified using two universal primers with sequence complementary to the 5’ end of the ACP-primers used in the ACP-DDRT-PCR. The sequences of the primers were: upstream primer, 5’-GTCTACCAGGCATTCGCTTCAT-3’ and downstream primer, 5’-CTGTGAATGCTGCGACTCGAT-3’.

Sequencing of DNA and bioinformatic analysis

Approximately 12 µg of DNA derived from either LPS, lipid A or OPS treatments were labelled with different tags in order to distinguish them from one another. Sequencing of DNA was performed with a GS-FLX sequencer (Inqaba biotec, RSA), with the aid of 454 high-throughput pyrosequencing technology using the Genome Sequencer 20 system (Roche diagnostics, Germany). Using the different sequencing tags, the source of the amplicon after sequencing could be identified, i.e. whether it was derived from the LPS, lipid A or OPS pool. Gene annotation or identification was done using the basic local alignment search tool (BLAST) programme from NCBI (National Center for Biotechnology Information), the Arabidopsis Information Resource (TAIR; <http://arabidopsis.com>), Genevestigator Response Viewer (<http://www.genevestigator.com>,⁴⁰ and the InterPro database (<http://www.ebi.ac.uk/interpro/>).

Reverse transcriptase-PCR analysis

In order to confirm the up-regulation observed with ACP-DDRT-PCR, four genes were selected and investigated with RT-PCR in comparison to 18S rRNA as a reference gene. Total RNA was isolated following treatment with 20 µg/ml lipid A or 100 µg/ml LPS for 4 h and 8 h, using the Trizol reagent method according to the manufacturer’s instructions (Sigma-Aldrich, USA). Following DNase treatment (Promega, USA), semi-quantitative RT-PCR was performed with the Transcriptor-one-step RT-PCR kit (Roche, Germany). Transcription profiles of the lipid transfer protein (LTP, At4g12470) and oxysterol-binding protein (OBP, At4g08180), serine hydroxymethyl transferase 1 (At4g37930) and the ACT domain-containing protein (At2g39570) were obtained. Primer pairs were designed using the Primer3 programme and their sequences were as follows:

LTP-Fw TAATCCTAGGCCGGTCACAC LTP-Rv GACTCCCGATTGCAAGAACC

OBP-Fw AAGGCACTGCCACTGAGTCT OBP-Rv TCATCGGACGAAAATGATGA

ACT-Fw GGGTTGTGATTGCTGTTGTG ACT-Rv GGGTCAACTCTGTCGCTCTC

SHT-Fw CCAGGAACCAAGTTGAAGGA SHT-Rv CCAATTGTTGGGAACTGCTT

18S-Fw CGGGTACCACATCCAAGGAA 18S-Rv GCTGGAATTACCGCGGCTCT

The thermocycler RT-PCR programme was as follows: reverse transcription at 50°C for 30 min, initial denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, elongation at 68°C for 30 s and final elongation at 68°C for 7 min. The samples were then analyzed on a 1.5% agarose gel and stained with ethidium bromide.

Results and discussion

Molecular patterns within LPS

The LPS from this plant-associated B. cepacia¹⁸ is a macromolecular (M_r > 12 kDa), hydrophilic heteropolysaccharide, that is covalently linked through a core oligosaccharide (M_r approximately 1.8 kDa) to the glycolipid moiety, lipid A (M_r approximately 1.6 kDa). An LPS-specific SDS-PAGE analysis of LPS_B.cep. is shown in Figure 1. The lanes on the gel loaded with purified LPS displays bands representing LPS_B.cep. of various molecular sizes. The characteristic ladder represents LPS biosynthesis intermediates, consisting of the lipid A and core oligosaccharide, but containing a different number of oligosaccharide repeating units that forms the extended OPS.

Figure 1.

Electrophoretic analysis of purified LPS from B. cepacia by 12.5% denaturing SDS-PAGE gel containing 4 m urea. The silver-stained gel displays microheterogeneity with different bands resembling: (I) the mature LPS lipoglycan consisting of the OPS and the core region attached to lipid A; (II) biosynthetic LPS intermediates with varying numbers of the repeat unit of the OPS; and (III) low molecular mass LPS (R-type or LOS).

The repeat unit of the OPS of the LPS_B.cep. lipoglycan was recently characterized in our laboratories as [→2)-β-D-Ribf-(1→6)-α-D-Glcp-(1→].³¹ Structural analysis on the lipid A component of LPS_B.cep. revealed a heterogeneous tetra- or penta-acylated, 1,4’-diphosphorylated, [β-D-GlcpN-(1→6)-α-D-GlcpN] disaccharide backbone, further substituted by 4-amino-4-deoxy-L-arabinopyranose (L-Ara4N). Fatty acid analysis indicated the presence of (R)-3-hydroxyhexadecanoic acid (16:0(3-OH)), (R)-3-hydroxytetradecanoic acid (14:0(3-OH)) and tetradecanoic acid (14:0).⁴¹ This lipid A possesses either a consistent amount of under-acylated species such as tetra- and penta-acylated lipid A or a low amount of phosphate. Both these are important factors in the elicitation of innate immune responses in animals and an interesting parallel with basal resistance in plant can be drawn.^30,39

Transcriptional reprogramming in response to LPS, OPS and lipid A

Messenger RNA differential display has been successfully used to investigate alterations in transcriptome profiles and to identify and isolate genes involved in plant stress responses, including plant–microbe interactions.^15,42,43 Annealing Control Primer technology is an improved method for identification of differentially expressed genes (DEGs) using a novel, patented annealing primer system. Because of high annealing specificity during PCR using the ACP system, the application for DEG discovery generates highly reproducible, authentic, and long PCR products. Furthermore, it generates no false positives.^36,37 A representative electrophoretogram which shows the outcome of the DDRT-PCR and re-amplification PCR of selected amplicons is shown in Figure 2. It was also found that the sequences aligned perfectly to the subject sequences during BLAST (basic local alignment search tool; National Centre for Biotechnology) searches, with ‘E-values’ for alignments below 10–50.

Figure 2.

(A) Representative electrophoretogram of DDRT-PCR amplicons derived from treated versus control samples using arbitrary primer pairs 35–40. M, C, T represent DNA molecular size ladders (1000–50 bp), control and treated, respectively. Only bands that exhibited strong differential expression were selected for re-amplification and further analysis. (B) Electrophoretogram of selected re-amplified cDNA amplicons.

Genes which were found to be differentially expressed upon elicitation by a specific inducer are listed in Table 1, grouped into 12 functional categories. The aim of the study was to evaluate the different sub-components within LPS_B.cep., and for this reason a time point of 8 h after treatment was chosen because LPSs are slow acting MAMPs and initial common MAMP-triggered responses seem to diverge at later time points.⁴⁴ A comparison of the genes which were induced by either lipid A or the OPS to those induced by the intact LPS molecule revealed that intact LPS induced more genes than the individual sub-components; however, both lipid A and the OPS were elicitors in their own right, contributing to the gene expression profile of the seedlings in response to intact LPS (Supplementary Tables S1.1 and S1.2). In order to differentiate between effects induced by lipid A and the OPS, their responsive genes were also compared to each other (Supplementary Table S1.3). It was also found that all the three elicitors induced a common cluster of 11 genes (Supplementary Table S1.4).

Table 1.

List of A. thaliana genes found to be up-regulated in response to elicitation by LPS, OPS and lipid A, 8 h after treatment of 10-day-old seedlings grown in 0.5× MS medium

Gene number	Identification	Inducer
DNA binding proteins, transcription factors and transcriptional regulation
At1g07840	Leucine zipper factor-related	L
At1g20340	DNA-damage-repair/toleration protein 112	L, A
At1g21570 ^	Zinc finger (CCH-type) family protein	A, O
At1g21780 ^	BTB/POZ domain-containing protein	A
At1g24300	GYF domain-containing protein	A
At1g74840 ^	Myb family transcription factor	L.O
At1g80070	Abnormal suspensor 2	A
At2g19430 ^	Transducin family protein/WD-40 repeat protein	A, O
At2g32070	CCR4-NOT transcription complex protein	A
At2g33845	DNA-binding protein related	L
At2g36290	Hydrolase, alpha/beta fold family protein	L
At3g06130	Heavy-metal-associated domain-containing protein	L
At3g24070	Zinc knuckle (CCHC-type) family protein	L
At3g55980 *#^	Zinc finger (CC_type) family protein	L
At4g14410	Basic helix-loop helix (bHLH) family protein	O
At4g16750 *	AP2/EREBP Dre-binding transcription factor	O
At4g22820 ^	Zinc finger (AN1-like) family protein	L
At5g20030	Agenet domain-containing protein	O
At5g22920 ^	C3HC4-type RING finger protein	L
At5g42950	GYF domain-containing protein	L
RNA binding proteins
At1g18630	Glycine-rich RNA-binding protein 6	A
At1g56070	Low expression of osmotically responsive genes 1	L
At2g05380	Glycine rich protein 3	O
At3g17810	Oligouridylate mRNA binding protein	L, A
At4g27000	RNA binding	A, O
At4g39260 *	Cold, circadian rhythm, and RNA binding 1	L
At5g50390 #	Heterogeneous nuclear ribonucleoprotein	O
At5g54940	Pentatricopeptide (PPR) repeat-containing protein 40S	O
Signal transduction, protein kinases and phosphatases
At1g09870	Histidine acid phosphatase family protein	A
At1g10210	Mitogen activated protein kinase MAPK1	A
At1g64630	Protein kinase family protein	L
At1g66150 ^	Transmembrane RLK I	L
At1g71840 ^	Transducin WD-40 family protein	L
At2g24360	Serine/threonine/tyrosine kinase	O
At2g39570	ACT domain-containing protein	L
At3g29160	Snf1 kinase homolog 11	L
At3g46280	Protein kinase-related protein	A
At3g60250	Casein kinase II beta chain 3	L
At4g00720 ^	Shaggy-related protein kinase theta/ASK	L
At4g03460	Ankyrin repeat family protein	A
At4g08180	Oxysterol-binding family protein	L, A.O
At4g24740	FUS3-compl gene 1 (CLK/STY lammer-type protein kinase)	A, O
At4g27280 #	Calcium binding EF hand family protein	O
At5g14640	Protein kinase family protein	O
At5g48680	Sterile alpha motif (SAM) domain-containing protein	O
At5g58150 ^	Leucine-rich repeat TM receptor-like kinase	A
At5g60548	Geminivirus REP interacting kinase 2	A
Defense and stress-responsive proteins
At1g02920 ^	Glutathione S-transferase	A, O
At1g05850	Chitinase (POM1)	O
At1g13230	Leucine-rich repeat LRR family protein	O
At1g20440	Cold regulated 47	A, O
At1g62380	ACC oxidase 2	L
At1g72610	Germin-like protein 1	L, A
At2g05790	Beta-glucanase, glycosyl hydrolase family 17 protein	A, O
At2g26560	Phospholipase A 2A	A, O
At2g32150 *^	Haloacid dehalogenase-like hydrolase family protein	L, A, O
At2g44060	Late embryogenesis abundant family protein	A
At3g04120	Glyceraldehyde-3-phosphate dehydrogenase C subunit	A
At3g10985	Wound induced protein 12	L, O
At3g11660 #^	(NDR1/HIN1-like 1) non-race disease resistance	O
At3g26520	Tonoplast intrinsic protein 2	L
At3g30775	Early responsive to dehydration 5	L
At3g49120	Peroxidase 34	L, A
At3g53280 ^	Cytochrome P450 71B5	L, A, O
At3g55970	Jasmonate-responsive gene 21, oxidoreductase	A
At4g02380 #	Senescence associated protein 21	A
At4g12470	Lipid transfer protein	L, A, O
At4g21960 #	Peroxidase 42	A, O
At4g34180	Cyclase family protein	L, A
At4g35770	Senesence-associated gene/Dark-inducible 1	L
At4g37930	Serine hydroxymethyltransferase 1	L, A, O
At5g35180	Enhanced disease resistance 2, similar	O
At5g64120	Peroxidase	L, A
Molecular chaperones
At1g04980 ^	DNAJ heat shock N-terminal domain protein	O
At1g08570	Thioredoxin family protein	L, A
At1g11530	Thioredoxin-related protein	L
At1g13690	ATPase E1/peptidyl-prolyl cis-trans isomerase	L, A, O
At1g21080	Thiol-disulfide isomerase like protein	O
At4g21810	Derlin-2.1	O
At4g22670	HSP70-interacting protein 1, tetratricoredoxin	L, A
At5g02500	Heat shock cognate 70 kDa protein 1	L, O
At5g23040	Cell growth defect factor 1; HSP binding	O
Membrane trafficking and secretion
At1g16180	TMS membrane family protein	L
At1g64720 *	Membrane related protein, CP5	A, O
At2g21160	Translocon-associated protein alpha family protein	L
At2g34250	Protein transport protein Sec 61 alpha	A
At2g45070	Protein transport protein Sec 61 beta	L
At3g05280	Integral membrane Yip1 family protein	O
Ion homeostasis and cell transporters
At1g07140 ^	RAN-binding protein 1a	L, O
At1g11260 # ^	Sugar transporter 1	L, A, O
At1g15690	Vacuolar-type H⁺-pumping pyrophosphatase1	O
At1g19910	Vacuolar-H⁺-pumping ATPase 16 kDa proteolipid	L
At1g54320	Ligand-effect modulator	L
At2g26900	Bile acid: sodium symporter family protein	A
At2g36380	Pleiotropic drug resistance 6	L
At2g46800	Zinc transporter	L
At3g04090	Small and basic intrinsic protein 1a	L
At3g05150	Sugar transporter family protein	O
At3g16240 #	Delta tonoplast integral protein	O
At3g47960	Proton dependent oligopeptide transport family protein	O
At4g16480	Inositol transporter 4	L
At5g25050	Integral membrane transporter family protein	A, O
Protein degradation, proteosome-ubiquitin function
At1g12760 ^	Ubiquitin-protein ligase	L
At1g17280 ^	Ubiquitin-conjugating enzyme 34	L
At1g75990 ^	26S proteosome regulatory subunit S3	A
At3g12400	ATELC/ELC, ubiquitin binding	L
At3g12700 ^	Aspartyl protease family protein	A
At3g19390	Cysteine proteinase	L, A
At3g51330 ^	Aspartyl protease family protein	L
At3g59940	Kelch repeat-containing F-box family protein	A
At4g04690	Putative F-box protein 15	O
At4g38630	Multi-ubiquitin chain binding protein, non-ATPase	O
At5g12120	Ubiquitin-associated/ubiquitin and TS-N protein	L
At5g20570	RING-box 1 protein	O
At5g48430 ^	Aspartyl-type endopeptidase/pepsin A	L, A
Cytoskeletal re-arrangement
At1g49240	Actin 8	L
At2g43160	Espin N-terminal homology domain protein	L
At3g18780	Actin 2	A
At4g34970	Actin binding protein	O
At5g19780	Tubulin alpha-5	L
At5g53400	Nuclear movement family protein	A
Cuticle and cell wall related
At1g14890 #	Pectinesterase inhibitor	L, O
At1g68530	Cuticular 1 acyltransferase	A
At2g16280	Very-long-chain fatty acid condensing enzyme	L
At2g45220 *^	Pectin esterase	A
At3g03990	Esterase/Lipase/Thioesterase family protein	O
At3g16520 *	UDP-glycosyl transferase family protein	A
At3g22120	Cell wall–plasma membrane linker protein	A
At4g34230	Cinnamyl alcohol dehydrogenase 5	O
At5g49720	Glycosyl hydrolase 9A1	O
Hormone related
At1g67080 *	Abscisic acid deficient 4	A
At2g21210 *^	Auxin-responsive protein	A
At2g36270	Abscisic insensitive 5	A
At3g23050 ^	Auxin resistant	L
At5g14920	Gibberelin-regulated family protein	A
Metabolism
At1g13245	Rotundifolia like 15	A
At1g15040	Glutamide amidotransferase-related	O
At1g20330	Sterol C24 methyltransferase 2	L
At1g31812	Acyl-CoA-binding protein	L, O
At1g32928	Hypothetical protein	L
At1g65930	Isocitrate dehydrogenase	O
At2g03690	Coenzyme Q biosynthesis coq4 family protein	O
At2g20830	Folic acid-binding/transferase	A
At2g41530	S-formylglutathione hydrolase	L, A
At3g06850	Dihydrolipoamide branched chain acyl transferase	L, A, O
At3g23570	Dienelactone hydrolase family protein	O
At3g44310 #	Nitrilase 1	O
At3g51620	Nucleotidyltransferase	A
At4g16760 #	Acyl-CoA oxidase 1, ACX1, jasmonic acid biosynthesis	L
At4g18930	Cyclic phosphodiesterase, tRNA splicing	L
At4g29220	Phosphofructokinase family protein	O
At5g07080	Acyltransferase family protein	O
At5g13710	Sterol C24 methyltransferase 1	O
At5g18480	Glycogenin-like starch initiation protein 6	O
At5g51830	pfkB-type carbohydrate kinase family protein	L
At5g53970 *#	Tyrosine aminotransferase	O
At5g58560	Phosphatidate cytidylyltransferase family protein	A

Genes also found in a micro-array study of LPS-induced responses are indicated as * (TAIR accession expression set 100808727) and #.^17,23 These conditions of elicitation differ significantly with regard to time-points, tissue and concentrations, and are not readily comparable. ^ Related to N. benthamiana ‘immunity-induced’ gene collection.⁹¹

In order to show the overall number of genes which were found to overlap between all three elicitors, a Venn diagram was constructed (Figure 3). This shows the number of genes which were found to be uniquely expressed in response to individual elicitors. Out of 97 genes induced by LPS, 67% were not overlapping (thus were uniquely expressed). Out of 82 genes induced by lipid A, 51% were not overlapping, and out of 85 genes induced by the OPS, 63% were not overlapping. Figure 3 also shows the relatively small number of genes which were found to be co-regulated by all three elicitors, thus indicating that the responses might be due to distinct perception events. These observations are in support of that made by Silipo et al.³² with LOS and lipid A from X. campestris.

Figure 3.

Venn diagram of genes induced in response to elicitation by LPS, lipid A, and the OPS. The diagram shows both overlapping (common) and non-overlapping (distinct) genes, as indicated by the numbers in the interceptions and within the circles, respectively.

Transcriptional reprogramming of plant cells upon pathogen attack can be extensive, potentially affecting between 3–12% of the 24,000 tested A. thaliana genes upon fungal or bacterial challenge, respectively.⁴⁵ In the case of tomato responding to Pseudomonas syringae pv. tomato, more than 400 genes were found to be up-regulated as part of PTI and effector-triggered immunity (ETI) responses.⁴⁶ However, using intact LPS and its sub-components as single, defined entities, these numbers are expected to be much lower. The response of the plant to potential MAMPs will depend on the structural features/molecular patterns of the elicitors, the corresponding perception capabilities of the plant cells and the time required for signal transduction processes to exceed a threshold value.

After each amplicon was identified and annotated, genes which code for proteins with similar functions were grouped into functional categories based on described gene ontologies with regard to cellular component, molecular function and biological process. Members from these functional categories are discussed below with reference to their reported involvement in plant defense responses, as supported by previously published data, with the gene number followed by the inducing agent (L, A or O) in brackets. This enables a comparison of lipid A (A) and the OPS (O), based on their eliciting potential, judged from the genes that they have induced in comparison to those induced by intact LPS (L).

Resistance and defense-related proteins

The PTI-induced transcriptional responses include a large number of genes, including many that encode RLKs, some of which may be involved in MAMP perception.^47,48 At1g66150 (L) and At5g58150 encode a ‘receptor-like transmembrane kinase 1’ and a ‘leucine-rich repeat (LRR) transmembrane receptor-like kinase’. The RLKs are known to act as surveillance sentinels, alerting the plant to pathogen attack.^2,9 Related to this function, At1g13230 (O) encodes a ‘LRR family protein’ of which the role in plant defense responses is well reviewed.⁴⁹ At3g11660 (O) encodes the ‘NDR1/HIN1-like protein’, i.e. the tobacco harpin-induced protein and A. thaliana non-race-specific disease resistance gene and At5g35180 (O) encodes an ‘enhanced disease resistance 2’ protein.

Ion homeostasis

Changes in pH of cellular compartments and alkalination of extracellular compartments are due to influx of H⁺ and efflux of K⁺ across the cellular membrane. This process is one of the earliest cellular responses involved in signal perception and transduction associated with defense⁵⁰ and is also a response induced by LPS_B.cep. in tobacco.¹⁴ Two of the identified genes, At1g19910 (L) encoding a ‘vacuolar H⁺-pumping ATPase proteolipid’ and At1g15690 (O), encoding a ‘vacuolar-type H⁺-pumping pyrophosphatase 1’ support changes in intracellular pH. In addition, an influx of calcium is another early response induced by LPS_B.cep.¹⁴ and At4g27280 (A, O), encoding a ‘calcium-binding EF hand family protein,’ might be involved in the calcium second messenger system activated in response to LPS.

Signal transduction and protein kinases

Cytoplasmic kinases do have the potential to integrate immune signaling from multiple immune receptors and genes encoding intracellular protein kinases acting downstream from RLKs, were found to be induced by all three elicitors. The genes responsive towards intact LPS include: At1g64630 (L), a ‘protein kinase family protein’, At3g60250 (L), a ‘casein kinase II beta chain 3’, At3g29160 (L), the ‘SNF1 kinase homolog 11’. In non-plant systems, it represents a central regulator of metabolic and stress responses.⁵¹ At4g00720 (L) encodes a ‘shaggy-related protein kinase theta/ASK-theta’; the product of this gene is believed to play a vital role in signal transduction and was up-regulated in A. thaliana plants challenged with Bradyrhizobium spp. strain ORS278 and P. syringae.⁵² The OPS induced At5g14640 (O), encoding a ‘protein kinase family protein’ and At2g24360 (O), a ‘serine/threonine/tyrosine kinase protein’.

The MAPKs are the most classical examples of those whose activities in signal transduction are well documented and At1g10210 (A), a ‘mitogen activated protein kinase 1’ was up-regulated in response to lipid A. Recently, AtMAPK1 was found to be induced by different stresses such as wounding, ABA, JA and H₂O₂.⁵³ lipid A induced other protein kinase genes as well, such as At3g46280, At1g10210 and At5g60548.

The up-regulation of the oxysterol-binding protein gene, At4g08180 (L, A, O), is significant (Figure 4). These proteins also bind phosphoinositides and play roles as lipid sensors/transporters in signal transduction by controlling the extracellular signal-regulated (ERK/MAPK) pathways in mammalian cells.⁵⁴ In A. thaliana, the gene was found to be up-regulated in response to pathogens (Botrytis cinerea and P. syringae – Genevestigator) and in potato in response to Phytophthora infestans and oligogalacturonides.⁵⁵

Figure 4.

Semi-quantitative RT-PCR of the expression of the genes encoding the lipid-transfer protein (LTP – At4g12470) and the oxysterol-binding protein (OBP – At4g08180) in response to lipid A elicitation and serine hydroxymethyltransferase (SHT – At4g37930) and ACT domain-containing protein (ACT – At2g39570) in response to LPS elicitation. 18S rRNA was used as reference gene.

Transcription factors

Microbe-associated molecular pattern-responsive transcription factors have been proposed to be involved in amplifying the PTI response⁴⁵ and several transcription factor genes were responsive to all three elicitors (Table 1). These include: At1g21570 (A, O), a ‘zinc finger (CCH-type) family protein’; At3g55980 (L), a ‘zinc finger (CC-type) family protein’; At5g22920 (L), a ‘C3HC4-type RING finger’; At1g07840 (L) a ‘leucine zipper factor’; At4g22820 (L), a ‘zinc finger (AN1-like) family protein’; At3g24070 (L), a ‘zinc knuckle (CCHC-type) family protein’ and At1g74840 (O), a ‘Myb transcription factor’. Furthermore, At4g16750 (O), the ‘ethylene responsive transcription factor (ERF)/dehydration-responsive element (DRE)-binding transcription factor’ and At4g14410 (O), a member of the ‘basic helix-loop-helix (bHLH) family, were up-regulated by the OPS. From this list, it is noticeable that more were induced by intact LPS as compared to the other two elicitors. The above-mentioned genes were also amongst the ones identified by Truman et al. to modify basal defence responses during pathogenesis and resistance.⁴⁷

Protein synthesis, folding and secretion

Ten genes with functions related to ribosomes were identified (Supplementary Table S2), presumably in support of enhanced protein biosynthesis required for defense. Chaperones play a vital role during plant–pathogen interactions, being capable of binding and stabilizing proteins such as PRRs at intermediate stages of folding, assembly and translocation from endoplasmic reticulum to plasma membranes.^56,57 The LPS and its sub-components were found to induce genes encoding proteins with chaperonin activity. These proteins include At5g02500 (L), a ‘heat shock cognate 70 family protein’ and At4g22670 (L, A), a ‘HSP 70 interacting protein 1’/tetratricoredoxin. Members of the HSP70 family proteins are known to be involved in protection of cellular homeostasis following stressful stimuli, including biotic stressors⁵⁸ and, together with HSP90, to be involved in the HR and non-host resistance.⁵⁹

Chaperonin-related genes include At5g53400 (A) that encodes a small heat shock protein; At1g13690 (A, O), that encodes ‘(ATPase1) ATE1’, known to stimulate the ATPase activity of the heat shock proteins DNAK/DNAJ, and At1g21080 (O), a ‘DNAJ heat shock N-terminal domain containing protein’ gene. The up-regulation of a related ‘DNAJ heat shock N-terminal domain containing protein’ At1g56300, was found in A. thaliana after treatments with bacteria (P. syringae), PAMPs and oomycetes.⁶⁰

In addition to their involvement in protein folding, thioredoxins have also been implicated in plant defense responses. The CITRX thioredoxin may directly interact with the tomato resistance protein, Cf-9, to regulate the defense, enhancing resistance.⁶¹ Two genes which encode thioredoxin-related proteins were found to be induced: At1g08570 (L), a ‘thioredoxin family protein’ and At1g04980 (O), a ‘thiol-disulphide isomerase-like protein’.

Protein translocation and vesicle trafficking are important aspects of early signaling and defense in response to general elicitors.⁶² Lipid A induced genes encoding transport proteins with distinctive functions in plant stress responses. At2g34250 (A) and At2g45070 (L) encode ‘transport protein sec61α and β’ respectively, secretion-related genes of the Sec61 translocon complex that provides a channel for proteins to cross the endoplasmic reticulum membrane. These genes and the induction of a protein secretory pathway was reported to be required for SAR.⁶³

Stress response proteins

Several genes encoding stress-responsive proteins were found to be induced by all three elicitors. At1g02920 (A, O), encoding a ‘glutathione S-transferase enzyme 11’ was reported to be induced in A. thaliana cell suspensions treated with fungal elicitor and in plants challenged with Peronospora parasitica or treated with SA.^64,65

Senescence-associated genes (SAGs) are induced by biotic and abiotic stressors.^66,67 Here, SAGs playing roles in oxidative stress tolerance, wounding and necrosis were found to be induced by LPS, lipid A and OPS: At4g35770 (L), At4g02380 (A) and At3g10985 (O), respectively.

At4g37930 (L, A, O), a ‘serine hydroxymethyltransferase 1’ (Fig. 4), is involved in controlling cell damage caused by abiotic stressors and the HR in plants, and was reported to influence resistance in A. thaliana towards biotic and abiotic stresses.⁶⁸ Another stress-responsive gene At1g72610 (L, O), a ‘germin-like protein 1’, plays a significant role during various stresses, including pathogen elicitation.⁶⁹ At3g53280 (L, A, O) encodes a cytochrome P450 71B5 monooxygenase, involved in stress metabolism and also responsive towards flg22, elf26, hrpZ, and chitin elicitation (Genevestigator).

Peroxidases and PR-proteins

Three peroxidases were found to be induced: At3g49120 (L, A), At5g64120 (L) and At4g21960 (A, O). Their involvement during stress responses is well documented, and some are regarded as pathogenesis-related (PR) proteins.⁷⁰ An endochitinase, At1g05850 (O), was responsive to the OPS and At2g05790 (A, O), a β-glucanase, to both lipid A and OPS. A third PR protein gene, At4g12470 (L, A, O), a lipid transfer protein (LTP), was found to be induced by all three agents (Figure 4), as well as P. syringae, flg22, hrpZ, ethylene and wounding (Genevestigator). This gene, azi-1, was reported to be involved in priming of SA induction and systemic immunity triggered by pathogens or azelaic acid⁷¹ and to confer disease resistance when overexpressed.⁷² A related LTP (At5g48485, dir1-1, defective in induced resistance 1-1), was reported to be involved in systemic resistance through interaction with lipid-derived molecules to promote long-distance signaling.⁷³

Cellular transporters

A transport-related gene, At2g26900 (A), encodes a ‘bile acid: sodium symporter family protein’, associated with several stress responses.⁷⁴ Bile acids were previously reported to elicit both HR cell death, PR proteins, and phytoalexin accumulation in rice.⁷⁵ At1g11260 (L, A, O), a gene encoding a H⁺/hexose transporter, has been identified as a target for early elicitor signaling in A. thaliana⁷⁶ and is also responsive to flg22, hrpZ, and induced programmed cell death (PCD) (Genevestigator).

Ubiquitin and the proteasome

The proteasome facilitates the degradation of ubiquitinated proteins, the functioning of which is connected to different processes allowing plant cells to respond to environmental cues, including disease resistance and the regulation of plant defense.⁷⁷^–⁸² The inhibition of ubiquitin-26S proteasome system suppresses the elicitation of defense⁸¹ and ubiquitin-ligase genes were induced by a plant defense elicitor, chitin.⁸³ The ubiquitination and proteasomal degradation of repressor proteins controlling the expression of the plant defense response as well as increased turnover of R proteins was observed.^83,84

The LPS elicited At1g17280 (L) and At1g12760 (L) that encode for a ‘ubiquitin-conjugating enzyme 34’ and ‘ubiquitin-protein ligase’ respectively; while At3g12400 (L) and At5g12120 (L) encodes ‘ATELC/ELC, ubiquitin binding’ and ‘ubiquitin-associated/ubiquitin and TS-N domain-containing protein’ respectively. The OPS elicited At4g04690 (O), At5g20570 (O) and At4g38630 (O), that encode a ‘F-box protein 15’, a ‘RING-BOX 1’ and ‘regulatory particle non-ATPase (multiubiquitin chain binding protein), respectively. In the case of lipid A, it induced At1g21780 (A), encoding a BTB domain-containing protein reported to associate with cullin proteins to form ubiquitin protein ligases:⁸⁵ At1g75990 (A) encodes a ‘26S proteasome regulatory subunit S3’ (RPN3) and At3g59940 (A) a ‘Kelch repeat-containing F-box family protein’. The F-box containing proteins are also involved in pathogen defense responses.^78,86

The proteasome complex proteins were also found to be responsive towards LPS_B.cep. treatment on a proteomic level.²¹

Cell wall modification

Cell wall remodelling and re-inforcement are critical plant defenses and all three elicitors had an effect on this response. These genes include: At1g14890 (L, O), encoding a ‘pectinesterase inhibitor’; At2g45220 (A) and At3g49220 (O) encoding ‘pectinesterases’; and At5g49720 (O) encoding ‘glycosyl hydrolase 9A1’. Genes related to this category whose expression was increased by lipid A also include At3g16520 (A), an ‘UDP-glycosyl transferase family protein’ and At4g34230 (O), a ‘cinnamyl alcohol dehydrogenase 5’ protein involved in synthesis of lignin precursors.

Cytoskeletal re-arrangements

The expression of non-host resistance is associated with the dynamic re-organization of microfilaments and microtubules,⁸⁷ and genes encoding proteins involved in cytoskeletal re-arrangements were induced by all three agents. At5g19780 (L), encodes ‘tubulin alpha-5’ and At1g49240 (L) an ‘actin 8’. At4g34970 (O) codes for an ‘actin binding protein’ and At3g18780 (A) an ‘actin 2’ protein. Actin and tubulin were previously reported as targets for LPS-responsive post-translational modification in tobacco cells by us.²¹

The cytoskeleton and cell wall–plasma membrane connectivity have been identified as important responsive elements of non-host resistance.⁸⁸ In this context, it is of interest that At3g22120 (A) encoding a ‘cell wall–plasma membrane linker protein’ was up-regulated by lipid A.

Metabolism and energy production

Several genes which have a role in metabolism have been found to be up-regulated by all three elicitors. During plant–pathogen interactions, the normal metabolic flow in the host plant is altered in support of defense responses but also, potentially, as means whereby pathogens channel the nutrients for their own benefit in order to survive.⁸⁹ Phospholipase A 2A, At2g26560 (A, O), that accumulates upon infection by fungal and bacterial pathogens is an example of this category as well as At3g04120 (L), glyceraldehyde-3-phosphate dehydrogenase C, that is responsive towards a signaling cascade induced by ROS. The sterol C24 methyltransferases At1g20330 (L) and At5g13710 (O) encode enzymes that control carbon flux into sterol synthesis, potentially influencing membrane fluidity, permeability and microdomains. Interestingly, the application of β-sitosterol to A. thaliana leaves results in enhanced resistance to P. syringae.⁹⁰ The importance of members of this category should not be overlooked, as several of the 14 Nicotiana benthamiana genes identified that, when silenced, compromised PTI, were grouped in this category.⁹¹

Lastly, genes grouped to the categories ‘mitochondria and chloroplast function’, are listed in Supplementary Table S2.

Concluding discussion

Previous micro-array data with LPS_B.cep. (TAIR accession expression set 100808727), although obtained under different experimental conditions and plant development stages, are consistent with the data obtained in this study.²³ The results indicate that perception of the LPS-derived MAMPs activate signal transduction cascades that result in reprogramming of the transcriptome. This lead to derepression or induction of defense responses, metabolic reprogramming, redeployment of cellular energy and changes in cellular activities supporting protein synthesis, folding, vesicle trafficking and secretion, accompanied by changes to the cytoskeleton. Many of the corresponding proteins are known to be interconnected at various levels through an intricate web of activation/de-activation, protein–protein interactions, complex formation and chaperoning reactions. Several lines of evidence suggest that MAMPs stimulate defense pathways that are independent of the signal molecules, SA, JA and ethylene.⁴⁴ The results obtained here seem to support this observation as few SA- or JA-responsive genes were identified. The broad classes of genes identified were strikingly similar to those reported to be increased in tomato responding to P. syringae pv. tomato.^46,91

Different MAMPs induce overlapping responses to bacteria within leaf tissue⁴⁵ and current models of MAMP perception indicate that different MAMPs can trigger specific sets of both individual as well as generic cellular responses with possible cross-talk of the signaling pathways. Moreover, different MAMP perception systems might rely on different classes of receptor molecules,^2,24 each possibly initiating a specific subset of downstream responses.⁹²

As MAMPs, LPSs are structurally complex molecules, comprising different moieties with distinct chemical patterns and both the lipid A and the OPS from LPS_B.cep. were found to induce genes with known functions in plant defense responses. The results can be interpreted as evidence to support the concept that lipid A and the OPS are MAMP-active structures in their own right. Similar genes were found to be induced by all three elicitors and this may be due to the fact that the responses triggered by these elicitors converge later at the level of signal molecules or transcription factors to form a common response which is aimed at activating defense. However, lipid A and the OPS also induced genes not found/different to those induced by the intact LPS molecules, suggesting that different perception and signal transduction mechanisms might be operative.

Whilst the lipid A and OPS moieties were able to up-regulate genes over the same spectrum of categories as intact LPS, the up-regulation of defense-associated genes observed with intact LPS was the more comprehensive; suggesting that the lipid A and glycan moieties of the molecule act as partial agonists, but that the intact LPS structure is required for full agonist activity. Conjugation to the long hydrophilic OPS glycan may assist in maintaining hydrophobic lipid A in a form in which it can be presented to the plant membrane. Lipid A has the ability to intercalate into phospholipid cell membranes,⁹³ thereby allowing the free carbohydrate-based OPS to bind to putative lectin-like or carbohydrate-recognising signaling receptors,²⁴ and contributing to the defence response. However, it is also possible that the carbohydrate and lipid molecular signatures are perceived by separate, but related or interconnected mechanisms. Indeed, results from animal systems indicate that delipidated LPS appears to have its own binding site in the LPS recognition pathway⁹⁴ and that the lipid A fraction could induce discrete MAPK activation different from that due to LPS.⁹⁵

The presented data offer novel insights and further evidence for the biochemical action of macromolecular LPSs as lipoglycan elicitors of PTI. It can be concluded that the LPS-derived lipid A and OPS from B. cepacia were perceived by the seedlings, leading to the induction of a range of genes; some known to be associated with defense responses as well as biotic and abiotic stresses, whilst others are associated with metabolic reprogramming of cellular activities in support of immunity and defense.

Supplementary data

Table S1.1–1.4. Induced genes of A. thaliana found to be co-regulated in response to LPS, Lipid A and the OPS, 8 h after treatment of 10 d old seedlings.

Table S2. List of ribosomal, mitochondrial and chloroplast genes from A. thaliana found to be up-regulated in response to elicitation by LPS, OPS and Lipid A, 8 h after treatment of 10 d old seedlings.

Footnotes

Acknowledgements

The South African National Research Foundation (NRF) is acknowledged for research funding (Grant number 206492) and the authors thank Dr Lizelle Piater for critical reading of the manuscript.

References

Jones

JDG

Dangl

. The plant immune system. Nature 2006; 444: 323–329.

Sanabria

Huang

J-C

Dubery

. Self/non-self perception in plants in innate immunity and defense. Self/Non-self Imm Regul 2010; 1: 1–15.

McDowell

Dangl

. Signal transduction in the plant immune response. Trends Biochem Sci 2000; 25: 79–82.

Hammond-Kosack

Jones

JDG

. Resistance gene-dependant plant defense responses. Plant Cell 1996; 8: 1773–1791.

Lamb

Dixon

. The oxidative burst in plant disease resistance. Annu Rev Plant Physiol Plant Mol Biol 1997; 48: 251–275.

Van Loon

. Induced resistance in plants and the role of pathogenesis-related proteins. Eur J Plant Pathol 1997; 103: 753–765.

Hammond-Kosack

Parker

. Deciphering plant–pathogen communication: fresh perspectives for molecular resistance breeding. Curr Opin Biotech 2003; 14: 177–193.

Aslam

Erbs

Morrissey

, et al.. Microbe-associated molecular pattern (MAMP) signatures, synergy, size and charge: influences on perception or mobility and host defence responses. Mol Plant Pathol 2009; 10: 375–387.

Nicaise

Roux

Zipfel

. Recent advances in PAMP-triggered immunity against bacteria: Pattern recognition receptors watch over and raise alarm. Plant Physiol 2009; 150: 1638–1647.

10.

Gomez-Gomez

Boller

. Flagellin perception: a paradigm for innate immunity. Trends Plant Sci 2002; 7: 251–256.

11.

Zipfel

Robatzek

Navarro

, et al.. Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 2004; 428: 764–767.

12.

Altenbach

Robatzek

. Pattern recognition receptors: from the cell surface to intracellular dynamics. Mol Plant Microb Interact 2007; 20: 1031–1039.

13.

Dow

Newman

M-A

Von Roepenack

. The induction and modulation of plant defense responses by bacterial lipopolysaccharides. Annu Rev Phytopathol 2000; 38: 241–261.

14.

Gerber

Zeidler

Durner

, et al.. Early perception responses of Nicotiana tabacum cells in response to lipopolysaccharides from Burkholderia cepacia. Planta 2004; 218: 647–657.

15.

Sanabria

Dubery

. Differential display profiling of the Nicotiana response to LPS reveals elements of plant basal resistance. Biochem Biophys Res Commun 2006; 344: 1001–1007.

16.

Newman

M-A

Dow

Molinaro

, et al.. Priming, induction and modulation of plant defence responses by bacterial lipopolysaccharides. J Endotoxin Res 2007; 13: 69–84.

17.

Livaja

Zeidler

Von Rad

, et al.. Transcriptional responses of Arabidopsis thaliana to the bacteria-derived MAMPs harpin and lipopolysaccharide. Immunobiology 2008; 213: 161–171.

18.

Coventry

Dubery

. Lipopolysaccharides from Burkholderia cepacia contribute to an enhanced defensive capacity and the induction of pathogenesis-related proteins in Nicotiana tabacum. Physiol Mol Plant Pathol 2000; 58: 149–158.

19.

Gerber

Dubery

. Protein phosphorylation in Nicotiana tabacum cells in response to perception of lipopolysaccharides from Burkholderia cepacia. Phytochemistry 2004; 65: 2957–2966.

20.

Gerber

Laukens

Witters

, et al.. Lipopolysaccharide-responsive phosphoproteins in Nicotiana tabacum cells. Plant Physiol Biochem 2006; 44: 369–379.

21.

Gerber

Laukens

De Vijlder

, et al.. Proteomic profiling of cellular targets of lipopolysaccharide-induced signaling in Nicotiana tabacum BY-2 cells. Biochim Biophys Acta 2008; 1784: 1750–1762.

22.

Piater

Nürnberger

Dubery

. Identification of a lipopolysaccharide responsive erk-like MAP kinase in tobacco leaf tissue. Mol Plant Pathol 2004; 5: 331–341.

23.

Zeidler

Zahringer

Gerber

, et al.. Innate immunity in Arabidopsis thaliana: lipopolysaccharides activate nitric oxide synthase (NOS) and induce defense genes. Proc Natl Acad Sci USA 2004; 101: 15611–15616.

24.

Sanabria

Goring

Nürnberger

, et al.. Self/nonself perception and recognition mechanisms in plants: a comparison of self-incompatibility and innate immunity. New Phytol 2008; 178: 503–514.

25.

Mishina

Zeier

. Pathogen-associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in Arabidopsis. Plant J 2007; 50: 500–513.

26.

Ojanen

Helander

Haahtela

, et al.. Outer membrane proteins and lipopolysaccharides in pathovars of Xanthomonas campestris. Appl Environ Microbiol 1993; 59: 4143–4151.

27.

Lerouge

Vanderleyden

. O-Antigen structural variation: mechanisms and possible roles in animal/plant-microbe interactions. FEMS Microbiol Rev 2001; 26: 17–47.

28.

Bedini

De Castro

Erbs

, et al.. Structure-dependent modulation of a pathogen response in plants by synthetic O-chain polysaccharides. J Am Chem Soc 2005; 127: 2414–2416.

29.

Braun

Meyer

Holst

, et al.. Characterization of the Xanthomonas campestris pv. campestris lipopolysaccharide substructures essential for elicitation of an oxidative burst in tobacco cells. Mol Plant Microb Interact 2005; 18: 674–681.

30.

Silipo

Sturiale

Garozzo

, et al.. The acylation and phosphorylation patterns of lipid A from Xanthomonas campestris strongly influence its ability to trigger the innate immune response in Arabidopsis. ChemBioChem 2008; 9: 896–904.

31.

Leone

Molinaro

Gerber

, et al.. The O-chain structure from the LPS of the endophytic bacterium Bukholderia cepacia strain ASP B 2D. Carbohydr Res 2006; 341: 2954–2958.

32.

Silipo

Molinaro

Sturiale

, et al.. The elicitation of plant innate immunity by lipooligosaccharide of Xanthomonas campestris. J Biol Chem 2005; 280: 33660–33668.

33.

Scheidle

Gross

Niehaus

. The lipid A substructure of the Sinorhizobium meliloti lipopolysaccharide is sufficient to suppress the oxidative burst in host plants. New Phytol 2005; 165: 559–566.

34.

Al-Qutub

Braham

Karimi-Naser

, et al.. Hemin-dependent modulation of the lipid A structure of Porphyromonas gingivalis lipopolysaccharide. Infect Immun 2006; 74: 4474–4485.

35.

Holst

Molinaro

. Core oligosaccharide and lipid A components of lipopolysaccharides. In: Moran

Brennan

Holst

von Itszstein

(eds) Microbial Glycobiology: Structures, Relevance and Applications. San Diego, CA: Elsevier, 2009, pp. 29–56.

36.

Hwang

I-T

Kim

Y-J

Kim

S-H

, et al.. Annealing Control Primer system for improving specificity of PCR amplification. Biotechniques 2003; 35: 1–5.

37.

Kim

Y-J

Kwak

C-I

Y-Y

, et al.. Annealing Control System for identification of differentially expressed genes on agarose gels. Biotechniques 2004; 36: 1–5.

38.

Zhang

Ramonell

Somerville

, et al.. Characterization of early, chitin-induced gene expression in Arabidopsis. Mol Plant Microb Interact 2002; 15: 963–970.

39.

Silipo

Molinaro

Cescutti

, et al.. Complete structural characterization of the lipid A fraction of the clinical strain of Burkholderia cepacia genomovar I lipopolysaccharide. Glycobiology 2005; 15: 561–570.

40.

Zimmerman

Hirsch-Hoffmann

Hennig

, et al.. GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox. Plant Physiol 2004; 136: 2621–2632.

41.

Madala

Molinaro

Dubery

. Deciphering the structural and biological properties of the lipid A moiety of lipopolysaccharides from Burkholderia cepacia strain ASP B 2D, in Arabidopsis thaliana. Glycobiology 2011; 21: 184–194.

42.

Seehaus

Tenhaken

. Cloning genes by mRNA differential display induced during the hypersensitive reaction of soybean after inoculation with Pseudomonas syringae pv glycinea. Plant Mol Biol 1998; 38: 1225–1234.

43.

Takemoto

Hayashi

Doke

, et al.. Isolation for the gene for EILP, an elicitor-inducible LRR receptor-like protein from tobacco by differential display. Plant Cell Physiol 2000; 41: 458–464.

44.

Denoux

Galletti

Mammarella

, et al.. Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings. Mol Plant 2008; 1: 423–445.

45.

Thilmony

Underwood

. Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. Plant J 2006; 46: 34–53.

46.

Mysore

Crasta

Tuori

, et al.. Comprehensive transcript profiling of Pto- and PRf-mediated host defense responses to infection by Pseudomonas syringae pv tomato. Plant J 2002; 32: 299–315.

47.

Truman

de Zabala

Grant

. Type III effectors orchestrates a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. Plant J 2006; 46: 14–33.

48.

Nürnberger

Kemmerling

. Receptor protein kinases – pattern recognition receptors in plant immunity. Trends Plant Sci 2006; 11: 519–522.

49.

Jones

JDG

. The roles of leucine-rich repeats in plant defence. Adv Bot Res 1996; 24: 90–167.

50.

Otte

Pachten

Hein

, et al.. Early elicitor-induced events in chickpea cells: functional links between oxidative burst, sequential occurrence of extracellular alkalinization and acidification, K⁺/H⁺ exchange and defense-related gene activation. Zeitsch Naturfors 2001; 56c: 65–76.

51.

Fordman-Skelenton

Chilley

Lumbreras

, et al.. A novel higher plant protein tyrosine phosphatase intercats with SNF1-related protein kinases via a KIS (kinase interaction sequence) domain. Plant J 2002; 29: 705–715.

52.

Cartieaux

Contesto

Gallou

, et al.. Simultaneous interaction of Arabidopsis thaliana with Bradyrhizomium sp. strain ORS278 and Pseudomonas syringae pv. tomato DC3000 leads to complex transcriptome changes. Mol Plant Microb Interact 2008; 21: 244–259.

53.

Ortiz-Masia

Perez-Amador

Carbonell

, et al.. Diverse stress signals activate the C1 subgroup MAP kinases of Arabidopsis. FEBS Lett 2007; 581: 1834–1840.

54.

Wang

P-Y

Weng

Anderson

RGW

. OSBP is a cholesterol-regulated scaffolding protein in control of ERK1/2 activation. Science 2005; 307: 1472–1476.

55.

Avrova

Taleb

Rokka

V-M

, et al.. Potato oxysterol binding protein and cathepsin B are rapidly up-regulated in independent defence pathways that distinguish R gene-mediated and field resistances to Phytophthora infestans. Mol Plant Pathol 2004; 5: 45–56.

56.

Sung

Vierling

Guy

. Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant Physiol 2001; 126: 789–800.

57.

Chen

Hamada

Fujiwara

, et al.. The Hop/Sti-Hsp90 chaperone complex facilitates the maturation and transport of a PAMP receptor in rice innate immunity. Cell Host Microbe 2010; 7: 185–196.

58.

Lamotte

Gould

Lecourieux

, et al.. Analysis of nitric oxide signaling functions in tobacco cells challenged by the elicitor cryptogenin. Plant Physiol 2004; 135: 516–529.

59.

Kanzaki

Saitoh

Ito

, et al.. Cytosolic HSP90 and HSP70 are essential components of INF1-mediated hypersensitive response and non-host resistance to Pseudomonas cichorii in Nicotiana benthamiana. Mol Plant Pathol 2003; 4: 383–391.

60.

Kemmerling

Schwedt

Rodriguez

, et al.. The BR1-associated kinase 1, BAK1 has a brassinolide-independent role in plant cell-death control. Curr Biol 2007; 17: 1116–1122.

61.

Rivas

Rougon-Cardoso

Smoker

, et al.. CITRX thioredoxin interacts with the tomato Cf-9 resistance protein and negatively regulates defense. EMBO J 2004; 23: 2156–2165.

62.

Robatzek

. Vesicle trafficking in plant immune response. Cell Microbiol 2007; 9: 1–8.

63.

Wang

Weaver

Kesarwani

, et al.. Induction of protein secretory pathway is required for systemic acquired resistance. Science 2005; 308: 1036–1040.

64.

Chivasa

Hamilton

Pringle

, et al.. Proteomic analysis of differentially expressed proteins in fungal elicitor-treated Arabidopsis cell culture. J Exp Bot 2006; 57: 1553–1562.

65.

Wagner

Edwards

Dixon

, et al.. Probing the diversity of the Arabidopsis glutathione S-transferase gene family. Plant Mol Biol 2002; 49: 515–532.

66.

Park

J-H

Kim

, et al.. Differential expression of senescence-associated mRNAs during leaf senescence induced by different senescence-inducing factors in Arabidopsis. Plant Mol Biol 1998; 37: 445–454.

67.

Weaver

Gan

Quirino

, et al.. A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment. Plant Mol Biol 1998; 37: 455–469.

68.

Ignacio

Raquel

Carmen

. Arabidopsis SHMT1, a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress. Plant J 2005; 41: 451–463.

69.

Patnaik

Khurana

. Germins and germin like proteins: an overview. Indian J Exp Biol 2001; 39: 191–200.

70.

Van Loon

Rep

Pieterse

CMJ

. Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 2006; 44: 135–162.

71.

Jung

Tschaplinski

Wang

, et al.. Priming in systemic plant immunity. Science 2009; 324: 89–91.

72.

Chassot

Nawrath

Métraux

J-P

. Cuticular defects lead to full immunity to a major plant pathogen. Plant J 2007; 49: 972–980.

73.

Maldonado

Doerner

Dixon

, et al.. A putative lipid transfer protein involved in systemic resistance signaling in Arabidopsis. Nature 2002; 419: 399–403.

74.

Wong

Whitty

, et al.. Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap. Plant Mol Biol 2005; 58: 561–574.

75.

Koga

Kubota

Shuichi

, et al.. Cholic acid, a bile acid elicitor of hypersensitive cell death, pathogenesis-related protein synthesis, and phytoalexin accumulation in rice. Plant Physiol 2006; 140: 1475–1483.

76.

Benschop

Mohammed

O’Flaherty

, et al.. Quantitative phospho-proteomics of early elicitor signaling in Arabidopsis. Mol Cell Proteom 2007; 6: 1198–1214.

77.

Glickman

. Getting in and out of the proteosome. Semin Cell Dev Biol 2000; 11: 1–8.

78.

Vierstra

. The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci 2003; 8: 135–142.

79.

Devoto

Muskett

Shirasu

. Role of ubiquitination in the regulation of plant defence against pathogens. Curr Opin Plant Biol 2003; 6: 307–311.

80.

Dielen

A-S

Badaoui

Candresse

, et al.. The ubiquitin/26S proteasome system in plant–pathogen interactions: a never-ending hide-and-seek game. Mol Plant Pathol 2010; 11: 293–308.

81.

Blecker

Kempf

Jeblick

, et al.. Induction of competence for elicitation of defense responses in cucumber hypocotyls requires proteasome activity. Plant J 2000; 21: 311–316.

82.

Libault

Wan

Czechowski

, et al.. Identification of 188 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. Mol Plant Microb Interact 2007; 20: 900–911.

83.

Boyes

Nam

Dangl

. The Arabidopsis thaliana RPM1 disease resistance gene product is a peripheral plasma membrane protein that is degraded coincident with the hypersensitive response. Proc Natl Acad Sci USA 1998; 95: 15849–15854.

84.

Peart

Shirasu

. ‘To degrade or not to degrade?’ – the emerging question in plant disease resistance. Physiol Mol Plant Pathol 2002; 61: 73–76.

85.

Figueroa

Gusmaroli

Serino

, et al.. Arabidopsis has two redundant cullin 3 proteins that are essential for embryo development and that interact with RBX1 and BTB proteins to form multisubunit E3 ubiquitin ligase complexes in vivo. Plant Cell 2005; 17: 1180–1195.

86.

Callis

Vierstra

. Protein degradation in signaling. Curr Opin Plant Biol 2000; 3: 381–386.

87.

Kobayashi

Funaki

, et al.. Dynamic re-organization of microfilaments and microtubules is necessary for the expression of non-host resistance in barley coleoptiles cells. Plant J 1997; 11: 525–537.

88.

Nürnberger

Lipka

. Non-host resistance in plants: new insights into an old phenomenon. Mol Plant Pathol 2005; 6: 335–345.

89.

Biemelt

Sonnewald

. Plant–microbe interactions to probe regulation of plant carbon metabolism. J Plant Physiol 2006; 163: 307–318.

90.

Griebel

Zeier

. A role for beta-sitosterol to stigmasterol conversion in plant–pathogen interaction. Plant J 2010; 63: 254–268.

91.

Chakravarthy

Velásquez

Ekengren

, et al.. Identification of Nicotiana benthamiana genes involved in pathogen-associated molecular pattern-triggered immunity. Mol Plant Microb Interact 2010; 23: 715–726.

92.

Gust

Biswa

Lenz

, et al.. Bacteria-derived peptidoglycans constitute pathogen-associated molecular patterns triggering innate immunity in Arabidopsis. J Biol Chem 2007; 282: 32338–32348.

93.

Jacobs

Yeh

Price

. Fluorescent detection of lipopolysaccharides interactions with model membranes. Adv Exp Med Biol 1990; 256: 233–245.

94.

Kitchens

Munford

. Enzymatically deacylated LPS can antagonize LPS at multiple sites in the LPS recognition pathway. J Biol Chem 1995; 270: 9904–9910.

95.

Fang

W-F

Cho

, et al.. Lipid A fraction of LPS induces a discrete MAPK activation in acute lung injury. Am J Physiol 2007; 293: L336–L344.

Distinct carbohydrate and lipid-based molecular patterns within lipopolysaccharides from Burkholderia cepacia contribute to defense-associated differential gene expression in Arabidopsis thaliana

Abstract

Keywords

Introduction

Materials and methods

Plant material

Lipopolysaccharide, lipid A and OPS preparation

Plant elicitation

Isolation of RNA

Differential display

Sequencing of DNA and bioinformatic analysis

Reverse transcriptase-PCR analysis

Results and discussion

Molecular patterns within LPS

Transcriptional reprogramming in response to LPS, OPS and lipid A

Resistance and defense-related proteins

Ion homeostasis

Signal transduction and protein kinases

Transcription factors

Protein synthesis, folding and secretion

Stress response proteins

Peroxidases and PR-proteins

Cellular transporters

Ubiquitin and the proteasome

Cell wall modification

Cytoskeletal re-arrangements

Metabolism and energy production

Concluding discussion

Supplementary data

Footnotes

Acknowledgements

References