Sage Journals: Discover world-class research

Abstract

Helicobacter pylori infections have been one of the major factors associated with gastroduodenal ulcer. Toll-like receptors (TLRs) of human recognize mycobacterium-induced immune response and protect subjects from disease pathogenesis. Variants in TLR genes are believed to influence immune responses to H. pylori and clinical severity. TLR-9 polymorphisms have been associated with susceptibility to gastroduodenal ulcer in different populations. In this study, we investigate the role of common TLR-9 variants in susceptibility/resistance to the development of gastroduodenal ulcer in a Chinese cohort. The present hospital-based case–control study enrolled 580 patients with abdominal discomfort, and based on endoscopic investigation, the patients were categorized into (1) gastric ulcer (n = 154), (2) duodenal ulcer (n = 70), (3) gastric and duodenal ulcers (n = 25), (4) gastritis (n = 195), and (5) healthy stomach (n = 136). A total of 520 healthy controls from similar geographical areas were enrolled as controls. TLR-9 (C-1237T, C-1486T, and G+2848A) polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Plasma levels of tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β in both healthy controls and patients were quantified by enzyme-linked immunosorbent assay (ELISA). Furthermore, messenger RNA (mRNA) expressions of TNF-α, IL-6, and IL-1β in biopsy tissues were quantified by real-time polymerase chain reaction (RT-PCR). The prevalence of TLR-9+2848 heterozygotes (CT) was significantly higher in gastroduodenal ulcer patients compared to healthy controls. Sub-categorization of patients revealed higher prevalence of heterozygotes of TLR-9 C+2848T and C-1486T polymorphisms in patients with gastric ulcer (GU), duodenal ulcer (DU), and those with both gastric and duodenal ulcers (GDU) when compared to controls. Patients displayed higher plasma cytokine levels than healthy controls. TLR-9 polymorphisms (C+2848T and C-1486T) correlated with altered cytokine expression in biopsy tissues and their plasma levels. In conclusion, TLR-9 (C+2848T and C-1486T) polymorphisms are associated with gastroduodenal ulcer and correlated with altered cytokine levels.

Keywords

association gastroduodenal ulcer gene polymorphism susceptibility

Introduction

Helicobacter pylori, a gram-negative bacterium, has been demonstrated as a crucial factor for the development of gastroduodenal ulcer. H. pylori infection has been estimated in half of the world’s population. About 60%–70% of people in China (824 million) harbored H. pylori infection.¹ Although a large number of subjects are infected with this bacterium, a fraction of humans develop gastroduodenal ulcer, indicating the possible role of host genetics in the development of disease pathogenesis.

Toll-like receptors are transmembrane proteins, which recognize specific molecular patterns on microorganisms and stimulate both innate and adaptive immune responses. Recognition of H. pylori by various toll-like receptors and their role in immune response have been well documented.² Toll-like receptor (TLR)-5 and TLR-9 sense flagellin and mycobacterial CpG DNA, respectively, and induce immune responses against pathogens. Various studies have demonstrated the induction of TLR-9 expression in gastric epithelial cells by H. pylori, which in turn stimulate mitogen-activated protein kinases (MAPKs). Elevated MAPKs induced angiogenesis and cell invasion through prostaglandin E2, suggesting an important role of TLR-9 in H. pylori infections.^3,4

Functional genetic variations in the promoter region have been associated with the altered expression of the respective mRNA. In addition, certain mutations in the coding region lead to the production of deformed proteins and may hamper downstream signaling or be subsequently degraded by ubiquitin-mediated pathways, thus lowering its levels.⁵ Several polymorphisms in TLR-9 gene have been reported in the literature (https://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=54106). However, the functional relevance of limited single-nucleotide polymorphisms (SNPs) has been characterized. Two variants in the promoter region of TLR-9 (C-1237T: rs5743836 and C-1486T: rs187084) and a common SNP in the coding area (C+2848T: rs352140) are investigated largely and are shown to alter downstream signaling molecules. A transition mutation occurs (C>T) in all positions and possibly affects the transcription levels or the three-dimensional structure of TLR-9.

Although several studies on the association of TLR-9 variants with various infectious diseases have been reported worldwide, the role of common TLR-9 variants in gastroduodenal ulcer is limited. A recent report in Mexican populations showed the association of TLR-9 C+2848T mutant with susceptibility to duodenal ulcer development.⁶ Another independent work including patients from South India has demonstrated an association of TLR-9 C+2848T with chronic H. pylori infection.⁷ These observations lead us to investigate the possible association between common TLR-9 variants with gastroduodenal ulcer in a Chinese cohort where such reports are completely absent.

In the present hospital-based case–control study, we performed genotyping of TLR-9 common polymorphisms in a large cohort of gastroduodenal ulcer patients and healthy controls from China. Furthermore, we wished to quantify the plasma levels of cytokines and their genetic expressions in biopsy tissues were investigated and correlated with various genotypes of TLR-9 polymorphisms.

Materials and methods

Subjects

This study included 580 subjects who visited or referred to Digestive System Department, Guangdong Medical University from March 2013 to December 2016, with complaints of abdominal discomfort. All patients underwent endoscopic examination and were clinically categorized as (1) gastric ulcer, (2) duodenal ulcer, (3) both gastric and duodenal ulcers, (4) gastritis, or (5) normal. To fulfill our objectives, the association of TLR-9 variants with susceptibility/resistance to H. pylori-linked gastroduodenal ulcer, following patients were excluded from this study: (1) gastroduodenal patients negative for H. pylori infection status, (2) subjects with history of systemic diseases, (3) cases with other malignancies, and (4) those who received nonsteroidal anti-inflammatory drugs (NSAIDs) earlier. In this study, we included students, staff of medical college, and subjects recruited under various health camps as healthy controls (mean age ± standard deviation (SD): 52.63 ± 11.64). All controls were negative for rapid urease test and antibody test. A total of 1128 subjects were screened and 520 healthy individuals were found to be negative for H. pylori infection. About 5 mL of intravenous blood was collected in an anti-coagulant tube from all participants. The human ethical committee of Guangdong Medical University cleared the protocol and written informed consent was obtained from all subjects.

Detection of H. pylori infection status

To investigate the infection status of H. pylori, all patients were subjected to four different tests: (1) histopathology, (2) culture test, (3) rapid urease test, and (4) antibody test, and those who passed at least one test were considered as positive.

Histological investigations

All patients were subjected to endoscopy and gastric biopsies were analyzed both histopathology and cultured for H. pylori. Based on endoscopic and histopathological results, the patients were grouped into various clinical categories.

TLR-9 polymorphism genotyping

Whole genomic DNA was isolated from the blood by a DNA isolation kit (Qiagen). TLR-9 promoter polymorphisms (−1237 and −1486) and codon variants (C+2848T) were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). In brief, a pair of common primers (F: TTCATTCAGCCTTCACTCAG; R: TCAAAGCCACAGTCCACAG) were used to amplify TLR-9 gene spanning both promoter polymorphisms. Thermocycling conditions included an initial denaturation for 5 min at 950 C, followed by 37 cycles of 950 C for 40 s, 640 C for 40 s, and 720 C for 1 min, and a final extension at 720 C for 7 min, which produces an amplicon of 558 bp. The PCR product was cleaved by different restriction enzymes (T-1237C: Bsl I; T-1486C: Afl II), and based on differential fragment sizes TLR-9 polymorphisms were deciphered as follows: (T-1237C: T = 264 + 145 + 126 + 23 bp and C = 264 + 115 + 126 + 30 + 23 bp; T-1486 C: T = 413 + 145 bp and C = 558 bp). Primers (F: GCCAGGTAATTGTCACGGAG and R: GATGTTTGCCCAGCTCTCG) were used for the amplification of TLR-9 gene-flanking C+2848T polymorphism, which produced an amplicon of 528 bp. The amplified product was digested by BstU I, and TLR-9 C+2848T polymorphism was assessed based on different product sizes (CC: 362 + 166 bp; CT: 528 + 362 + 166 bp; TT: 528 bp). The digested products were separated by polyacrylamide gel electrophoresis. About 20% of the samples were randomly selected and sequenced for TLR-9 polymorphisms, and 100% concordant results were obtained.

Cytokine quantification

Plasma levels of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 were quantified by enzyme-linked immunosorbent assay (ELISA) as instructed by the manufacturer (R&D System).

Gene expression study

Total RNA was extracted from biopsy tissues by Qiagen kit. About 1 µg of total RNA was used for the synthesis of complementary DNA (cDNA). The relative expression of all cytokines, namely, TNF-α, IL-6, and IL-1b, was quantified by TaqMan method as described earlier⁶ with slight modification. Glyceraldehyde-3-phosphate dehydrogenase was taken as a reference and the relative expressions of the cytokines were measured by delta delta Ct method.

Statistical analysis

TLR-9 genotypes and allele frequencies were calculated by counting in Microsoft excel sheet. Hardy–Weinberg equilibrium (HWE) was analyzed by a web-based tool. Distributions of genotypes and alleles in different clinical phenotypes were compared by Fisher’s exact test, and odds ratio (OR), 95% confidence interval (CI), and P values were calculated. A P value less than 0.016 was considered as significant (after Bonferroni correction for three SNPs 0.05/3 = 0.016). Mean plasma levels of TNF-α, IL-6, and IL-1β in different TLR-9 genotypes were compared by analysis of variance (ANOVA) followed by Tukey’s multiple comparison post hoc test. Furthermore, differential mRNA expressions of TNF-α, IL-6, and IL-1β were analyzed among TLR-9 polymorphisms (C-1237T, C-1486T, and C+2848T). GraphPad Prism 5.01 software was used for these statistical analyses.

Results

Baseline characteristics of patients and controls

During the study period, 580 subjects with abdominal discomfort presented at the department, and after serological investigations and biopsies, 444 patients had H. pylori infections with different clinical manifestations. In all clinical categories, males are more frequent than females. The mean age of patients ranged between 49.72 and 54.94 years. H. pylori-negative subjects with stomach discomfort were grouped into healthy stomach group, for whom the mean age was 41.21 years. Alcohol consumption (29.4%–43.5%) was more frequent in patients than smoking (16.2%–23.7%). In all, 520 healthy controls from similar geographical areas were enrolled as controls with a mean age of 52.63 years and without history of smoking and alcohol consumption.

Prevalence of TLR-9 polymorphisms in healthy subjects

A total of 520 healthy Chinese were enrolled as healthy controls and genotyped for TLR-9 polymorphisms (C-1237T, C-1486T, and C+2848T) by PCR-RFLP. Frequencies of different genotypes and alleles are presented in Table 1. Heterozygotes of TLR-9 (C-1486 and C+2848T) were more frequent compared to other genotypes (C-1486T: CC = 16%, CT = 48%, TT = 36%; C+2848T: CC = 41%, CT = 48%, TT = 11%). For TLR-9 (C-1237T) polymorphism, homozygous mutant (60%) was more frequent than heterozygous (36%) or wild-type (4%) mutants. Distributions of genotypes for TLR-9 (C-1486T and C+2848T) polymorphisms were in HWE (C-1486T: χ2 = 0.001, P = 0.97, and C+2848T: χ2 = 1.66, P = 0.19); however, the distribution of C-1237T genotypes deviated from the equilibrium (χ2 = 1.15, P = 0.02).

Table 1.

Distribution of TLR-9 polymorphism in healthy controls and gastroduodenal ulcer patients.

Genotype/allele	HC (n = 520)	HS (n = 136)	GD patients (n = 374)	HC versus HS (P value; OR; 95% CI)	HC versus GD patients (P value; OR; 95% CI)	HS versus GD patients (P value; OR; 95% CI)
TLR-9 C-1237T
CC	21 (4)	8 (6)	21 (6)	Ref	Ref	Ref
CT	187 (36)	50 (37)	149 (40)	0.47; 0.70; 0.29–1.67	0.51; 0.79; 0.41–1.51	0.82; 1.13; 0.47–2.72
TT^a	312 (60)	78 (57)	204 (54)	0.34; 0.65; 0.28–1.53	0.19; 0.65; 0.34–1.22	1.00; 0.99; 0.42–2.34
CC+CT^a	208 (40)	58 (43)	170 (46)	0.62; 0.89; 0.61–1.31	0.11; 0.80; 0.61–1.04	0.61; 0.89; 0.60–1.32
C	229 (22)	66 (24)	191 (26)	Ref	Ref	Ref
T	811 (78)	206 (76)	557 (74)	0.46; 0.88; 0.64–1.20	0.08; 0.82; 0.66–1.02	0.74; 0.93; 0.67–1.29
TLR-9 C-1486T
CC	83 (16)	20 (15)	44 (12)	Ref	Ref	Ref
CT	250 (48)	57 (42)	237 (63)	0.88; 0.94; 0.53–1.66	0.005; 1.78; 1.19–2.68	0.04; 1.89; 1.03–3.45
TT^a	187 (36)	59 (43)	93 (25)	0.40; 1.30; 0.74–2.31	0.82; 0.93; 0.60–1.46	0.35; 0.71; 0.38–1.33
CC+CT^a	333 (64)	77 (57)	281 (75)	0.11; 1.36; 0.92–2.00	0.004; 0.58; 0.43–0.79	< 0.0001; 0.43; 0.28–0.65
C	416 (40)	97 (36)	325 (43)	Ref	Ref	Ref
T	624 (60)	175 (64)	423 (57)	0.20; 1.20; 0.91–1.58	0.14; 0.86; 0.71–1.05	0.02; 0.72; 0.54–0.96
TLR-9 C+2848T
CC	213 (41)	54 (40)	112 (30)	Ref	Ref	Ref
CT	250 (48)	61 (45)	218 (58)	0.91; 0.96; 0.63–1.44	0.0007; 1.65; 1.23–2.22	0.01; 1.72; 1.11–2.65
TT^a	57 (11)	21 (15)	44 (12)	0.21; 1.45; 0.81–2.60	0.09; 1.46; 0.93–2.31	1.00; 1.01; 0.54–1.86
CC+CT^a	463 (89)	115 (85)	330 (88)	0.17; 1.48; 0.86–2.54	0.74; 1.08; 0.71–1.64	0.29; 0.73; 0.41–1.28
C	676 (65)	169 (62)	442 (59)	Ref	Ref	Ref
T	364 (35)	103 (38)	306 (41)	0.39; 1.13; 0.85–1.49	0.01; 1.28; 1.05–1.56	0.38; 1.13; 0.85–1.51

TLR: Toll-like receptor; HC: healthy controls; HS: healthy stomach (H. pylori negative); GD: gastroduodenal; OR: odds ratio; CI: confidence interval.

Values are expressed in number (%).

CC+CT versus TT.

Bold represents statistically significant values

Association of TLR-9 polymorphisms with gastroduodenal ulcer

To investigate the possible association of TLR-9 polymorphism with gastroduodenal ulcer, distributions of TLR-9 genotypes were compared among gastroduodenal patients and controls. As shown in Table 1, heterozygotes (CT) for C+2848T were highly prevalent in patients compared to healthy controls (P = 0.0007, OR = 1.65, 95% CI = 1.23–2.22) and subjects with healthy stomach (P = 0.01, OR = 1.72, 95% CI = 1.11–2.65). In addition, minor allele (T) frequency was also significantly more in patients than healthy controls (P = 0.01, OR = 1.28, 95% CI = 1.05–1.56). Distributions of TLR-9 (C-1237T and C-1486T) polymorphisms were comparable among controls and patients. Furthermore, we compared the distributions of TLR-9 polymorphisms (C-1237T, C-1486T, and C+2848T) between healthy controls and subjects with healthy stomach. As shown in Table 1, the prevalence of TLR-9 variants was comparable between healthy controls and subjects with healthy stomach, indicating an important role of TLR-9 in susceptibility to H. pylori infection.

Clinical phenotypes of gastroduodenal ulcer are associated with TLR-9 (C-1486T and C+2848T) polymorphisms

Based on clinical manifestations, gastroduodenal ulcer patients were further subdivided into different clinical phenotypes and distributions of TLR-9 polymorphisms were analyzed. As presented in Table 2, heterozygotes (CT) of TLR-9 (C+2848T) polymorphism were more prevalent in patients with gastric ulcer (P < 0.0001, OR = 2.30, 95% CI = 1.52–3.49), duodenal ulcer (P = 0.009, OR = 2.13, 95% CI = 1.19–3.79), and those with both gastric and duodenal ulcers (P = 0.01, OR = 3.83, 95% CI = 1.27–11.51). Similarly, promoter variants (C-1486T) were also significantly higher in all clinical cases when compared to healthy controls (gastric ulcer: P = 0.01, OR = 2.05, 95% CI = 1.16–3.62 and duodenal ulcer: P = 0.005, OR = 3.45, 95% CI = 1.33–8.93). However, the distributions of other genotypes and alleles were comparable between healthy controls and patients with different clinical manifestations.

Table 2.

Distribution of TLR-9 polymorphisms in different clinical categories of gastroduodenal ulcer patients and healthy controls.

Genotype/allele	HC (n = 520)	HS (n = 136)	GU (n = 154)	DU (n = 70)	GDU (n = 25)	Gastritis (n = 125)	HC versus GU (P value; OR; 95% CI)	HC versus DU (P value; OR; 95% CI)	HC versus GDU (P value; OR; 95% CI)	HC versus gastritis (P value; OR; 95% CI)
TLR-9 C-1237T
CC	21 (4)	8 (6)	8 (5)	3 (4)	2 (8)	8 (7)	Ref	Ref	Ref	Ref
CT	187 (36)	50 (37)	59 (39)	28 (40)	9 (36)	53 (42)	0.65; 0.82; 0.34–1.96	1.00; 1.04; 0.29–3.74	0.32; 0.50; 0.10–2.49	0.48; 0.74; 0.31–1.77
TT^a	312 (60)	78 (57)	87 (56)	39 (56)	14 (56)	64 (51)	0.48; 0.73; 0.31–1.71	0.74; 0.87; 0.24–3.06	0.28; 0.47; 0.10–2.21	0.20; 0.53; 0.22–1.27
CC+CT^a	208 (40)	58 (43)	67 (44)	31 (44)	11 (44)	61 (49)	0.45; 0.86; 0.60–1.24	0.51; 0.83; 0.50–1.38	0.68; 0.84; 0.37–1.90	0.08; 0.69; 0.47–1.03
C	229 (22)	66 (24)	75 (24)	34 (24)	13 (26)	69 (28)	Ref	Ref	Ref	Ref
T	811 (78)	206 (76)	233 (76)	106 (76)	37 (74)	181 (72)	0.39; 0.87; 0.65–1.18	0.58; 0.88; 0.58–1.33	0.48; 0.80; 0.42–1.53	0.06; 0.74; 0.54–1.01
TLR-9 C-1486T
CC	83 (16)	20 (15)	17 (11)	5 (7)	1 (4)	21 (17)	Ref	Ref	Ref	Ref
CT	250 (48)	57 (42)	105 (68)	52 (74)	20 (80)	60 (48)	0.01; 2.05; 1.16–3.62	0.005; 3.45; 1.33–8.93	0.03; 6.64; 0.87–50.26	0.88; 0.94; 0.54–1.65
TT^a	187 (36)	59 (43)	32 (21)	13 (19)	4 (16)	44 (35)	0.61; 0.83; 0.43–1.58	1.00; 1.54; 0.39–3.34	1.00; 1.77; 0.19–16.14	0.88; 0.93; 0.52–1.66
CC+CT^a	333 (64)	77 (57)	122 (79)	57 (81)	21 (84)	81 (65)	0.0004; 0.46; 0.30–0.71	0.004; 0.40; 0.21–0.76	0.05; 0.33; 0.11–1.00	0.91; 0.96; 0.64–1.45
C	416 (40)	97 (36)	139 (45)	62 (44)	22 (44)	102 (41)	Ref	Ref	Ref	Ref
T	624 (60)	175 (64)	169 (55)	78 (56)	28 (56)	148 (59)	0.11; 0.80; 0.62–1.04	0.35; 0.83; 0.58–1.19	0.55; 0.84; 0.47–1.49	0.82; 0.96; 0.72–1.27
TLR-9 C+2848T
CC	213 (41)	54 (40)	38 (25)	18 (26)	4 (16)	52 (42)	Ref	Ref	Ref	Ref
CT	250 (48)	61 (45)	103 (67)	45 (64)	18 (72)	52 (42)	<0.0001; 2.30; 1.52–3.49	0.009; 2.13; 1.19–3.79	0.01; 3.83; 1.27–11.51	0.51; 0.85; 0.55–1.30
TT^a	57 (11)	21 (15)	13 (8)	7 (10)	3 (12)	21 (16)	0.46; 1.27; 0.63–2.56	0.44; 1.45; 0.57–3.65	0.17; 2.80; 0.60–12.89	0.20; 1.50; 0.84–2.70
CC+CT^a	463 (89)	115 (85)	141 (92)	63 (90)	22 (88)	104 (84)	0.45; 0.74; 0.39–1.40	1.00; 0.90; 0.39–2.06	0.74; 1.10; 0.32–3.81	0.09; 1.64; 0.95–2.82
C	676 (65)	169 (62)	179 (58)	81 (58)	26 (52)	156 (62)	Ref	Ref	Ref	Ref
T	364 (35)	103 (38)	129 (42)	59 (42)	24 (48)	94 (38)	0.03; 1.33; 1.03–1.73	0.11; 1.35; 0.94–1.93	0.06; 1.71; 0.97–3.02	0.46; 1.11; 0.84–1.48

TLR: Toll-like receptor; HC: healthy controls; HS: subjects with healthy stomach; GU: gastric ulcer patients; DU: duodenal ulcer patients; GDU: patients with gastric and duodenal ulcers; OR: odds ratio; CI: confidence interval.

Values are expressed in number (%).

CC+CT versus TT.

Plasma levels of cytokines in healthy controls and patients

Plasma levels of proinflammatory cytokines such as TNF-α, IL1-b, and IL-6 were quantified in patients and healthy controls. As shown in Figure 1, the plasma levels of TNF-α, IL-b, and IL-6 were significantly elevated in gastroduodenal ulcer patients compared to controls. However, cytokine quantities among healthy controls and subjects with healthy stomach were comparable. Furthermore, after clinical sub-categorization, patients with gastric ulcer, duodenal ulcer, and those with both gastric and duodenal ulcers displayed significantly higher plasma TNF-α, IL-6, and IL-1b levels compared to those with gastritis and controls.

Figure 1.

Plasma levels of cytokines in patients and healthy controls. Plasma levels of TNF-α, IL-1β, and IL-6 were quantified by ELISA. The mean levels were compared by t test or one-way ANOVA as appropriate. (a)–(c) Levels of all cytokines elevated in patients compared to controls. (d)–(f) Upon further clinical categorization, patients with gastric ulcer, duodenal ulcer, and those with both gastric ulcer and duodenal ulcer had higher plasma cytokines compared to healthy controls and subjects with healthy stomach. A P value less than 0.05 was considered as significant.

Cytokines’ expression and plasma levels correlated with TLR-9 genotypes

We quantified the gene expression of cytokines (TNF-α, IL-1b, and IL-6) in biopsy tissues (n = 55) by real-time polymerase chain reaction (RT-PCR) and compared their expressions among different genotypes of TLR-9 polymorphisms (Figure 2). For TLR-9 (C+2848T), wild type (CC) had higher cytokine expressions (TNF-α and IL-1b) compared to heterozygous (CT) and homozygous (TT) mutants. A similar trend was also observed for TLR-9 C-1486T polymorphism for TNF-α and IL-1b cytokine expressions: the mean cytokine expression of CC was higher than those of CT and TT. In line with these observations, the plasma levels of cytokines were also correlated with TLR-9 (C+2848T and C-1486) genotypes (C-1486T (TNF-α; CC vs TT: P < 0.01, CT vs TT: P < 0.001; IL-1β; CC vs TT: P < 0.001, CT vs TT: P < 0.001) and C+2848T (TNF-α; CC vs TT: P < 0.001, CT vs TT: P < 0.01; IL-1β; CC vs TT: P < 0.0001, CT vs TT: P < 0.01)). However, both gene expressions and plasma cytokine levels were comparable among genotypes of TLR-9 (C-1237T) polymorphism (data not shown).

Figure 2.

Association of TLR-9 polymorphisms with expressions in biopsy tissues. Gene expressions of cytokines in biopsy tissues were quantified by RT-PCR and mean delta delta Ct values were compared among different genotypes of TLR-9 polymorphisms (C-1486T and C+2848T). One-way ANOVA followed by Tukey’s post hoc test was employed for the investigation. A P value < 0.05 was considered as significant.

Furthermore, we investigated the association of TLR-9 polymorphism with plasma levels of cytokines in different clinical categories of gastroduodenal ulcer patients. In gastritis and gastric ulcer patients, CC genotype of TLR-9 polymorphisms (C-1486T and C+2848T) was associated with higher plasma TNF-α and IL-1β levels compared to mutant genotypes (P < 0.05). However, such a significant association was not observed in patients with other two clinical phenotypes, namely, duodenal ulcer and both gastric and duodenal ulcers (Figure not shown).

Discussion

In the present report, we investigated the association of common TLR-9 polymorphisms with gastroduodenal ulcer. Furthermore, we quantified the plasma levels of various proinflammatory cytokines (TNF-α, IL-6, and IL-1β) as well as their genetic expressions in biopsy tissues and observed a significant association with TLR-9 genotypes. To the best of our knowledge, this is the first study in Chinese population and included a larger number of subjects compared to earlier reports.

The prevalence of TLR-9 genotypes for C-1237T, C-1486T, and C+2848T polymorphisms in healthy controls was comparable with earlier reports in Chinese population.^8–12 The prevalence of homozygous mutant (TT) for TLR-9 C-1237T polymorphism was significantly higher when compared to other genotypes, which is in line with earlier studies.^10,11 The high prevalence of heterozygotes or homozygous mutant in various populations has been attributed to the local selection pressure of several infectious diseases. It is believed that variants have survival advantage over wild type against infectious diseases and are thus probably more frequent in human populations. However, a recent report highlighted the selection of TLR-9 C-1486T variant well before the migration of humans out of Africa.¹³

The present hospital-based case–control study revealed a significant association of TLR-9 (C+2448T) polymorphisms with susceptibility to development of various forms of gastroduodenal ulcers. In line with our findings, previous reports from South India⁷ and Mexico⁶ have shown an association of TLR-9 (C+2448T) variants with susceptibility to gastroduodenal ulcer. Furthermore, we observed the susceptibility of heterozygotes for TLR-9 (C-1486T) polymorphism to development of ulcer. This is the first report to show such a relationship. The exact reason how TLR-9 (C+2448T and C-1237T) polymorphisms are linked with the development of gastroduodenal ulcer is not known. Probably, these polymorphisms are associated with differential production of cytokines and those unable to clear the H. pylori infections and lead to the development of different clinical pathologies. In contrast, TLR-9 (C-1237T) polymorphism was not associated with gastroduodenal ulcer in Chinese population, corroborating with previous reports.^6,7

Distributions of TLR-9 variants were comparable among healthy controls and subjects with healthy stomach. In addition, the prevalence of TLR-9 (C-1237T, C-1486T, and C+2848T) polymorphisms in healthy stomach was also not significantly different when compared to healthy controls of earlier published reports.^8,10,11 Interestingly, TLR-9 (C+2848T and C-1486T) mutants were more frequent in gastroduodenal ulcer patients compared to subjects with healthy stomach and healthy controls. These observations collectively suggest that TLR-9 polymorphisms possibly predispose subjects to development of gastroduodenal ulcer and related clinical complications.

Proinflammatory cytokines are believed to play an important role in gastroduodenal ulcer.¹⁴ Several reports have shown elevated TNF-α, IL-6, and IL-1b in patients compared to healthy controls.¹⁴ In line with earlier studies, we observed higher levels of TNF-α and IL-1β in patients with gastric ulcer, duodenal ulcer, gastritis, and those with both gastric and duodenal ulcers compared to healthy controls and subjects with healthy stomach in this study. Experimental evidence showed that the induction of TNF-α and IL-1β secretion by testosterone and delayed ulcer healing process¹⁵ further strengthens the role of proinflammatory cytokines in gastroduodenal ulcer.

TLR-9 polymorphisms have been associated with altered plasma cytokine levels. Here we hypothesized that TLR-9 common variants could determine differential plasma cytokine levels in patients and healthy controls. The plasma levels of TNF-α and IL-1b correlated with TLR-9 (C-1486T and C+2848T) polymorphism. Interestingly, a similar association was also observed in gastric ulcer patients and gastritis cases. Possibly, mutation in the promoter region and coding area enhances binding of transcription factors, induces the production of TLR-9 transcripts, or gives structural stability to the protein. Upon stimulation with pathogens, those subjects produce higher levels of plasma proinflammatory molecules. A similar trend was also observed in the expression of TNF-α and IL-1b in biopsy tissues similar to an earlier report on TLR-9 C+2848T polymorphism. However, in the present report, we observed a significant association of TLR-9 (C-1486T) with TNF-α and IL-1b expressions, which was not reported earlier. Altogether, the observations of this study and earlier reports suggest a valid genotype–phenotype association of TLR-9 variants with cytokine levels in subjects.

In conclusion, genotyping of common TLR-9 variants revealed the association of C-1486T and C+2848T heterozygotes with susceptibility to development of gastric and duodenal ulcers. Furthermore, plasma cytokine levels and their expressions in biopsy tissues correlated with TLR-9 polymorphisms, further strengthening the earlier observation that TLR-9 functional variants intrude cytokine levels and possibly make subjects susceptible to gastroduodenal ulcer.

Footnotes

Acknowledgements

We are grateful to all the patients and controls enrolled in the present study.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Salih

(2009) Helicobacter pylori infection in developing countries: The burden for how long? Saudi Journal of Gastroenterology: Official Journal of the Saudi Gastroenterology Association 15: 201–207.

Smith

(2014) Role of Toll-like receptors in Helicobacter pylori infection and immunity. World Journal of Gastrointestinal Pathophysiology 5: 133–146.

Chang

Lin

et al . (2005) Helicobacter pylori-Induced invasion and angiogenesis of gastric cells is mediated by cyclooxygenase-2 induction through TLR2/TLR9 and promoter regulation. Journal of Immunology 175: 8242–8252.

Schmausser

Andrulis

Endrich

et al . (2004) Expression and subcellular distribution of toll-like receptors TLR4, TLR5 and TLR9 on the gastric epithelium in Helicobacter pylori infection. Clinical and Experimental Immunology 136: 521–526.

Buckland

(2006) The importance and identification of regulatory polymorphisms and their mechanisms of action. Biochimica Et Biophysica Acta 1762: 17–28.

Trejo-de la

Torres

Sanchez-Zauco

et al . (2015) Polymorphisms in TLR9 but not in TLR5 increase the risk for duodenal ulcer and alter cytokine expression in the gastric mucosa. Innate Immunity 21: 706–713.

Loganathan

Nazeer

Goda

et al . (2017) Genetic variants of TLR4 and TLR9 are risk factors for chronic Helicobacter pylori infection in South Indian Tamils. Human Immunology 78: 216–220.

Chen

Wang

Liang

et al . (2015) Association between toll-like receptors 9 (TLR9) gene polymorphism and risk of pulmonary tuberculosis: Meta-analysis. BMC Pulmonary Medicine 15: 57.

Junjie

Songyao

Minmin

et al . (2012) The association between Toll-like receptor 2 single-nucleotide polymorphisms and hepatocellular carcinoma susceptibility. BMC Cancer 12: 57.

10.

Wang

Shi

(2016) Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population. Genetics and Molecular Research: GMR 15: 15037641.

11.

et al . (2015) Screening toll-like receptor markers to predict latent tuberculosis infection and subsequent tuberculosis disease in a Chinese population. BMC Medical Genetics 16: 19.

12.

Zhu

Teng

Zhao

et al . (2016) Association of TLR9 polymorphisms with sporadic Parkinson’s disease in Chinese Han population. The International Journal of Neuroscience 126: 612–616.

13.

Mahto

Panda

(2017) TLR9 (rs187084) polymorphism is neither under selection pressure and nor predisposed to systemic lupus erythematosus. Lupus. Epub ahead of print 1 January. DOI: 10.1177/0961203317734923.

14.

Ernst

Gold

(2000) The disease spectrum of Helicobacter pylori: The immunopathogenesis of gastroduodenal ulcer and gastric cancer. Annual Review of Microbiology 54: 615–640.

15.

Machowska

Brzozowski

Sliwowski

et al . (2008) Gastric secretion, proinflammatory cytokines and epidermal growth factor (EGF) in the delayed healing of lingual and gastric ulcerations by testosterone. Inflammopharmacology 16: 40–47.