Sage Journals: Discover world-class research

Abstract

Introduction

Hepatic inflammation is considered key driver of hepatic tissue impairment.We aimed to explore the interaction of Halamphora coffeaeformis (Amph.) with low dose ionizing γ radiation (γR) exposure against D-galactosamine (D-GaIN)-induced chronic hepatitis in Albino rats.

Methods

Chronic hepatitis was induced with single dose of D-GalN (400 mg/kg BW i.p.). Rats received 400 mg Amph/kg BW daily by gastric gavage concomitant with .25 Gy γ-R. Liver oxidative stress and inflammatory status were assessed. Gene expression levels of signal transducer and activator of transcription 3 (STAT3) and nuclear factor kappa B (NFKB) were estimated by q-PCR. D-Galactosamine injection significantly encouraged hepatic oxidative damage and inflammatory disturbance accompanied with improved intercellular adhesion molecule-1 level (ICAM-1).

Results

messenger RNA gene expression levels of STAT3 and NF-kB were expressively higher in D-GaIN-treated animals. Histopathological examination supported results. Interestingly, Amph treatment with γ-radiation (γ-R) subjection displayed significant improvement of oxidative and inflammatory status along with controlled signaling molecular factors which was supported by amended histological structure of induced liver hepatitis.

Conclusion

Results conclude the efficacious control of liver hepatitis progression by dual collaboration of Amph. with low dose γ-R via control of vital growth signaling factors linked with inflammation thru anti-inflammation, antioxidative and anti-proliferative activities.

Keywords

D-galactosamine signal transducer and activator of transcription nuclear factor kappa B intercellular adhesion molecule-1

Introduction

Liver injury is a mutual cause of liver disease, which is considered the key controller of hepatic tissue injury, causing evolution from nonalcoholic fatty liver disease (NAFLD) to severe fibrogenesis and, lastly, hepatocellular carcinoma. Liver diseases generally happen because of chronic hepatocellular injury triggered by the alcohol overuse, hepatitis C virus chronic infections, bile duct impairment and NAFLD.¹

D-Galactosamine (D-GaIN), a discriminating hepatotoxin, leads to liver damage like human viral hepatitis through reduction of uridine nucleotides, leading to diminished formation of RNA and proteins.² D-Galactosamine causes reduction of cellular energy load thus leads to cellular death. The steady compensation of energy levels activated by D-GaIN encourages a process which ends in apoptosis.³ D-Galactosamine prevents hepatocytes synthesis of messenger RNA (mRNA) and protein with hypersensitivity to Kupffer cells released tumor necrosis factor-α (TNF-α), that stimulate cellular death signaling pathways.⁴ Reactive oxygen species (ROS) are generated from activated Kupffer cells after D-GaIN treatment, moreover TNF-α that leads to apoptosis was synthesized. Excessive ROS disturbs homeostasis, leading to oxidative stress, that plays a serious part in liver diseases.⁵

Plant derived food additives have developed natural antioxidant in order to alternate synthetic antioxidant with several disadvantage. Worthy to remark that algae are able to produce similar effective and valued natural products. Consequently, utilization of algae in the pharmaceutical applications has attracted global attention.⁶ The brown micro-algae including Halamphora, could be a source of a diverse class of bioactive compounds, it was found that H. coffeaeformis alga belongs to Bacillariophyta which has high levels of chlorophyll and carotenoids such as fucoxanthin and β-carotene which have various biological activities as antioxidant, anticancer, antimicrobial.⁷ Studies stated that phenolics and carotenoids have antioxidant activity against peroxidation and free radicals. H. coffeaeformis algae extract exhibited hopeful scavenging properties to neutralize DNA damage caused by hydrogen peroxide.⁸

Although the health effects of ionizing radiation are quite variable, it is generally known that high doses are hurtful and can destroy organisms, but low dosages of radiation are remarkable and beneficial to health. Earlier studies presented that low dose frequency ionizing radiation improves body immunity, antitumor, and antioxidant activities and also accelerates oxidative stress recovery triggered by chemotherapy.⁹ So, the significance of this study is to evaluate the interaction between low dose gamma radiation (IR) and algae extract to suppress D-GaIN-induced chronic hepatitis in male Albino rats by targeting signaling molecular targets.

Materials and Methods

Chemicals

D-galactosamine was acquired from Sigma Aldrich Limited, United States (Catalog No: 1772038), and all chemicals used of high grade were purchased from Sigma Aldrich Limited, United States.

Preparation of Algal Extract

\The H. coffeaeformis alga belongs to Bacillariophyta. It was locally isolated from drainage water of Ismailia Governorate and was collected and extracted by El-Sayeed et al.⁹ H.coffeaeformis extract was sent to the Analytical Chemistry Unit at institute; Agricultural Research Center, Giza, Egypt for Gas Chromatography Mass-Spectrometry (GC/MS) analysis. The results of GC-MS analysis indicated the presence of 26 different compounds (Table 1 and Figure 1). Briefly the extraction was done by incubating the fresh algae at 50°C for seventy-two hours then turned to powder. Then, the dehydrated algae ash was repeatedly extracted with cold water. The extract was centrifuged at 10 000 rpm for 5 minutes and then filtered. All filtrates were brought together and evaporated at 40°C under vacuum until whole dehydration, then stored in the dark to avoid photolysis. Algae extract is full of catechins, gallic acid, fumaric acid, and β-carotene.⁹

Table 1.

Gas Chromatography Mass-Spectrometry Activity of H. coffaeiformis Extract.

No	Retention Time	Compound Name	Peak Area (%)
1	6.404	1-Pyrroline, 2-phenyl-	3.1
2	10.341	Heptacosane	3.98
3	10.726	Docosane	2.12
4	11.407	3′,4′,7-Trimethylquercetin	2.63
5	11.932	Heptacosane	5.1
6	12.592	Norphytan	3.94
7	12.826	Phytol	6.85
8	12.957	Geranyl isovalerate	5.8
9	13.088	(S)-(−)-Citronellic acid	4.63
10	13.351	Squalane	3.73
11	13.613	Hexadecane	1.63
12	13.863	(+)-Nerolidol	4.34
13	14.417	Eicosanoic acid	2.83
14	14.667	Pentacosane	2.53
15	14.876	Dotriacontane	2.37
16	15.024	Octacosanol	3.02
17	15.803	Nonacosane	4.72
18	16.529	Eicosane	2.51
19	17.48	Octadecanoic acid	1.71
20	17.907	Heneicosane	18.14
21	18.776	Salicylic acid β-D-O-glucuronide	3.06
22	19.887	Hesperetin 7-neohesperidoside	2.35
23	20.178	1-Tricosanol	3.55
24	21.117	Hexa-hydro-farnesol	.19
25	21.437	2-Hexadecanol	2.05
26	22.549	3,2′,4′,5′-Tetramethoxyflavone	3.11

Figure 1.

GC-MS chromatogram represents the separated bioactive constitutes of H coffaeiformis extract.

Charachterization of H. coffeaeformis alga was done by El-Sayeed et al⁹ from whom we obtained H. coffeaeformis alga extract in the current study.

Animals

Male Wistar rats (170 ± 30 g) were acquired from Nile Pharmaceutical Co., Cairo, Egypt. Before experiment begins, animals were permitted to acclimatize at the animal’s house of National Center for Radiation Research and Technology for 7 days. Animals exposed to typical laboratory circumstances of 12 hours light/12 hours dark cycle, with temperature 25 ± 2°C and moisture of 60 ± 5%. Rats in cages have free access to food and ad libitum water. Standard laboratory diet was administrated to rats (58% carbohydrates, 3.4% lipid, 20.5% protein, 1.49% minerals, .53% phosphorus, 3.1% cellulose, .98% calcium, and 12.0% moisture). The current study protocol follows the Guide for the Care and Use of Laboratory Animals (NIH Publications No. 85-23, revised 1996) and was supervised by the Research Ethics Committee of the National Center for Radiation Research and Technology, Atomic Energy Authority (Ref. no. 202/21).

Radiation Facility

Rat’s body was exposed to gamma irradiation at Atomic Energy Agency’s National Center for Radiation Research and Technology using a Cesium-137 source (gamma cell 40), Atomic Energy of Canada Limited (Chalk River, ON, Canada). As reported by Kandil et al, rats received a single dose of .25 Gy at a dose rate of .423 Gy/min.¹⁰

Median Lethal Dose of Algal Extract (LD50)

Algae extract’s LD50 was determined via rats according to Akhila et al.¹¹ Rats were administrated high dose (500-5000 mg/kg b.wt.) of algae extract and death was documented 24 hours after treatment. Animals were fed through gavage with 10% (LD₁₀) of LD₅₀ (400 mg/kg b.wt.).

Experimental Design

This experimental study was conducted at the animal’s house of National Center for Radiation Research and Technology. After 7 days acclimatization period, rats were randomly separated to 8 groups (8 rats each).

1. Group I (control): rats received 1.0 mL of physiological saline solution/day by gastric gavage and were left till the end of the experiment (1 month) then they were sacrificed.

2. Group II (Gal group): rats were injected with D-GalN (Sigma Aldrich) intraperitoneally in a single dose of 400 mg/kg body weight¹² for 1 month.

3. Group III (Amp group): rats received daily extract of Halamphora Coffeaeformis (400 mg/kg b.wt) for 1 month by gastric gavage.

4. Group IV (IR): rats were subjected to single gamma radiation (IR) dose .25 Gy¹⁰ and left for 1 month (end of experiment).

5. Group V (Gal + IR): rats received D-GalN injection like group II, then after 48 hours; rats were subjected to low dose gamma radiation as in group IV.

6. Group VI (IR + Amp): rats received H. coffeaeformis extract daily for 1 month by gastric gavage then subjected to low dose gamma radiation as in group IV

7. Group VII (Gal + Amp): rats received D-GalN intraperitoneal injection like group II then after 48 hours; rats received H. coffeaeformis extract as in group III

8. Group VIII (Gal + IR + Amp): rats received D-GalN injection like group II, then after 48 hours rats received H. coffeaeformis extract as in group III, followed by introduction to low dose gamma radiation like group IV.

Samples Collection

Blood Sampling

By the end of experiment duration (1 month), rats were anesthetized using urethane and blood samples were acquired via cardiac puncture and gathered in plain vacutainer tubes. Then samples were left for coagulation and sera were obtained after centrifugation at 4000 rpm for 10 minutes for biochemical analysis.

Tissue Sampling

Livers of rats were dissected out and separated into 2 portions, 1 portion was stored in 10% formalin for histological studies and the other portion was homogenized (10% w/v) in phosphate buffered saline (.02 M sodium phosphate buffer with .15 M sodium chloride, pH7.4). Liver homogenates were established using a portion of liver homogenized in a tissue glass homogenizer with a Teflon pestle.

Biochemical Investigations

Liver Function Markers and Some Related Parameters in Serum

The serum levels of liver enzymes (aspartate aminotransferase (AST) and alanine aminotransferase (ALT)) were assessed colorimetrically.¹³ Activities expressed as IU/L. Serum level of albumin was determined using the bromocresol green method.¹⁴ Levels of serum total proteins were estimated by coloremetric method using Biuret reagent.¹⁵

Inflammatory Markers

The levels of proinflammatory cytokines including, IL6 (Catalog No: MBS175908) and TNF-α (Catalog No: MBS2507393), ICAM (Catalog No: MBS267983) were assessed in liver tissue by ELISA kits purchased from MyBiosource (United States).

Determination of Nuclear Factor Kappa B and Signal Transducer and Activator of Transcription 3 (STAT3) mRNA Gene Expression by Quantitative Real-Time PCR in Liver Tissues

Extraction of RNA and Reverse Transcription

mRNA extraction from liver tissues was done using the constructer’s instructions of TRIzol reagent (Life Technologies, USA). Complementary DNA (cDNA) synthesis was done with reverse transcriptase (Invitrogen) where 1 μg of total RNA was used as template.

Quantitative Real-Time Polymerase Chain Reaction

Real-Time Polymerase Chain Reactions were achieved in a thermocycler step 1 plus (Applied Biosystems, USA) via sequencing Software (PE Biosystems, CA). Primers sequences used are listed in Table 2. Polymerase Chain Reaction thermal cycling conditions involved an initial step at 95°C for 5 minutes; 40 cycles for 20 seconds at 95°C, 60°C for 30 seconds, and 72°C for 20 seconds. Fold changes of Nuclear Factor Kappa B (NFKB) and STAT3 mRNA were measured by comparative Ct method as stated by Pfaffl,¹⁶ through calculating the values of ∆ cycle threshold (∆Ct) and normalized the average Ct value to the reference control β-actin.

Table 2.

PCR Primers.

Gene	Primer Sequence
NF-κβ	F: 5′ACAACCCCTTCCAAGTTCCCT3′
NF-κβ	R: 5′TGGTCCCGTGAAATACACCT3′
STAT3	F:5′TGGAAGAGGCGGCAGCAGATAGC3′
STAT3	R: 5′CACGGCCCCCATTCCCACAT3′
β-actin	F: 5-TGTTGTCCCTGTATGCCTCT-3
β-actin	R: 5-TAATGTCACGCACGATTTCC-3

Western Blotting of c-Jun N-Terminal Kinase Protein

Tissue liver proteins were isolated using TRIzol reagent (Invitrogen) as stated by Chomczynski,¹⁷ and concentration of proteins were measured as stated by Bradford.¹⁸ Proteins (20 μg/lane) were separated on 10% SDS-PAGE then moved onto PVDF films. The films incubated with rabbit IgG Jun N-Terminal Kinase (JNK) antibody (Cell Signaling Technologies, USA), and β-actin antibody (Proteintech, USA) as loading control. After washing films incubated at room temperature with HRP-conjugated goat anti-rabbit IgG (Cell Signaling Technologies, USA). The films were established and pictured by Amersham detection chemiluminescence kit along with the constructor’s instructions and then subjected to X-ray. c-jun proteins concentrations were analyzed using a scanning laser densitometer (Biomed Instrument Inc., USA).

Determination of Liver Tissue Oxidative Stress Markers

Lipid peroxidative products; malondialdehyde (MDA) were detected clorimetrically in 10% liver homogenates via the thiobarbituric acid test as stated by Satoh.¹⁹ The pink color intensity was spectrophotometrically detected at 535 nm.

Reduced glutathione (GSH) amount were detected according to Ahmed et al method,²⁰ the yellow color formed of liver homogenate (.2 ml) was measured spectrophotometrically against the blank at 412 nm.

While the oxidized glutathione (GSSG) was measured in Liver homogenate as stated by Hissin and Hilf.²¹ Reaction was followed kinetically for 2 min, at a wavelength of 415 nm, GSSG was measured after GSH derivatization by 2-vinylpyridine.

The Paraoxonase-1 (PON-1) activity was kinetically detected in liver homogenate as stated by the method of Kumar.²² The rate of hydrolysis of paraoxon was followed spectrophotometrically by measuring the liberation of p-nitrophenol at 405 nm at 37°C over 50 sec after 1 min lag time.

Histopathological Study

Liver Specimens of all studied rats were cleansed, dehydrated in ethanol, cleaned in xylene, and fixed in paraffin wax. Liver was sliced (5-6 μm thick), deparaffinized then Hematoxylin and Eosin (H & E) tainted for microscopic investigation.²³

Statistical Analyses

Data was analyzed using SPSS programme (version 20) through one-way analysis of variance (ANOVA) followed by Duncan’s multiple Range test (DMRT). Data were expressed as mean ± standard deviation (SD). P values < .05 is significant.

Results

Biochemical Studies

Effect of H. caffeaeformis and/or Low Dose IR on Liver Function Among Groups

Substantial rise in serum ALT and AST activity with decline in ALB and TP serum level were presented in Table 3 in Gal group as compared to normal group.Treatment of induced rats through H. caffeaeformis administration and/or introduction to low gamma radiation dose produced significant reduction in serum ALT and AST activity with rise in ALB and TP of (GalL + Amp), (Gal + IR), and (Gal + Amp + IR) groups compared to Gal group.

Table 3.

Liver Function Test Parameters Among all Studied Groups.

Groups Parameters	Normal	Gal	Amp	IR	Gal + IR	Amp + IR	Gal + Amp	Gal + IR + Amp
ALT (U/L)	19.50 ± 3.50^a	80.50 ± 2.50^b	21.50 ± 3.50^a	24.00 ± 3.00^a	43.50 ± 4.50^a^,^b	23.50 ± 4.50^a	34.00 ± 2.00^a^,^b	28.50 ± 1.50^a
AST (U/L)	34.50 ± 1.50^a	80.00 ± 5.00^b	33.00 ± 4.00^a	25.50 ± 2.50^a	41.50 ± 6.50^a^,^b	31.00 ± 1.00^a	46.50 ± 1.50^a^,^b	31.00 ± 1.50^a
ALB (g/dl)	5.15 ± .15^a	3.13 ± .07^b	5.50 ± .30^a	5.30 ± .10^a	4.05 ± .15^a^,^b	5.34 ± .25^a	4.45 ± .15^a^,^b	4.95 ± .05^a
TP (g/dl)	7.45 ± .55^a	4.12 ± .07^b	8.50 ± .20^a^,^b	7.77 ± .27^a	6.33 ± .26^a^,^b	8.23 ± .16^a	6.35 ± .05^a^,^b	7.65 ± .15^a

Each value represents the mean of 6 records ± standard deviation.

^aSignificant difference vs Gal group at P ≤ .05.

^bSignificant difference vs control group at P ≤ .05.

Effect of H. caffeaeformis and/or Low Dose Ionizing Radiation on Inflammatory Markers Among Groups

Levels of (TNF-α), (IL6), and (ICAM-1) were significantly improved in Gal group related to normal group. Meanwhile administration of H. caffeaeformis and/or introduction to low ionizing radiation dose suppress these elevations in (Gal + Amp), (Gal + IR) and (Gal + IR + Amp) groups compared to Gal group (See Figure 2).

Figure 2.

Protein levels of inflammatory markers (A) TNF-α (B) IL-6 (C) ICAM. Values with different superscripts are significantly different at P < .05.

Gene Expression Level of Inflammation Markers Among Groups

Gene expressions of NFκB and STAT3 using RT-PCR are illustrated in Figure 3. NFκB and STAT3 expression in Gal group displayed a substantial increase in Gal group related to normal group; however, treatment with H. caffeaeformis only or combined with low gamma radiation dose resulted in significant decrease in (Gal + Amp), (Gal + IR), and (Gal + IR + Amp) groups compared with Gal group.

Figure 3.

Gene expression level of (A) NFκB (B) STAT3 among groups. Values with different superscripts are significantly different at P < .05.

Effect of H. caffeaeformis and/or Low Dose Ionizing Radiation on c-Jun Expression

c-jun protein immunoblot of different treated rats were detected in liver tissue (Figure 4). The hepatic c-jun protein level was expressively increased with Gal toxicity compared to control group, though the dual collaboration between H. caffeaeformis and γ-R pointedly repressed its expression after Gal toxicity.

Figure 4.

Western blot analysis of proteins JNK relative to β-actin. The bottom panels represented quantification of the immunoblot by densitometry. Values are expressed as mean ± S.E. * P < .05 compared to control.

Effect of H. caffeaeformis and/or Low Ionizing Radiation Dose on Oxidative Stress Markers in Liver Homogenate

As represented in Table 4 D-GalN induced significant elevations in liver MDA content, reduction in GSH level accompanied by significant increase in GSSG/GSH ratio while a significant reduction was detected in liver PON1 activity of Gal group as related to normal group. Conversely administration of H. caffeaeformis and/or exposure to low dose ionizing radiation restore liver MDA level, GSSG/GSH ratio and PON1 activity

Table 4.

Level of Oxidative Stress Markers Among Groups.

Parameters Groups	Normal	Gal	Amp	IR	Gal + IR	Amp + IR	Gal + Amp	Gal + IR + Amp
MDA (μmol/mg tissue)	36.1 ± 10.9^a	101.0 ± 10.3^b	29.3 ± 3^a	30.5 ± 5.6	64 ± 1.9^b,a	47.5 ± 2.4^a	64.7 ± 1.6^a,b	29.0 ± .8^a
PON1 (U/mg tissue)	136.9 ± 13.5^a	66.7 ± 1.9^b	144.5 ± .9^a	138.5 ± 3.8^a	116.6 ± 5^a	131.5 ± 5.5^a	114.4 ± 3.1^a	147.5 ± 3.1^a
GSSG	29.4 ± 4.3^a	85.3 ± 9.5^b	33.6 ± 3.8^a	33.9 ± 8.9^a	48.2 ± 6.0^a	42.5 ± 1.7^a	55.0 ± 1.9^a	33.6 ± 4.8^a
GSH (μmol/mg tissue)	86.4 ± 2.4^a	35.9 ± 6.2^b	87.2 ± 3.0^a	88.9 ± 2.3^a	64.3 ± 1.2^a,b	75.3 ± 2.1^a	63.8 ± 7.9^b,a	93.3 ± 2.8^a
GSSG/GSH ratio	.34 ± .03	2.39 ± .15	.38 ± .03	.38 ± .11	.75 ± .06	.56 ± .01	.87 ± .10	.36 ± .04

Each value represents the mean of 6 records ± standard deviation.

^asignificant difference vs Gal group at P ≤ .05.

^bSignificant difference vs control group at P ≤ .05.

Histopathological Results

Livers of control group that treated by saline showed normal hepatic lobules (Figure 5A). While livers of albino rats treated by D galactosamine revealed hepatic cords disorganization with hepatic necrosis. Hyperplasia of Kupffer cells with lymphocytes and macrophages infiltration were also observed (Figure 5B).

Figure 5.

Photomicrograph of hepatic tissue of rats stained with hematoxylin and eosin and examined with a light microscope at ×200 magnification. (A) Normal group section showing normal hepatic lobules which made up of radiating plate’s or strands of polygonal cells arrow, (B) Gal group showing disorganization of hepatic cords and multifocal area of hepatic coagulative necrosis arrow, (C) IR group showing mild ballooning of hepatocyte with clear faint stain cytoplasm arrow (D) Amp group showing normal histological structure of hepatic lobules with organized hepatic cords arrow, (E) Amp + IR group showing mild swelling of hepatocytes and narrowing of hepatic sinusoids, (F) Gal + IR group showing disorganization of hepatic cords, swelling of hepatocytes with granularity of its cytoplasm arrow, (G) Gal + Amp showing ballooning of hepatocytes and narrowing of sinusoids with hyperplasia of Kupffer cells arrow, (H) Gal + Amp + IR showing normal histological structure of hepatic lobule arrow.

Animals subjected to low dose gamma radiation showed mild ballooning of hepatocyte in some of hepatic lobules with narrowing of hepatic sinusoids (Figure 5C). Moreover, rats treated by Halamphora caffeaefomis displayed organized hepatic cords made up of polygonal cells with prominent round nuclei and eosinophilic cytoplasm. Hepatic lobules have no significant pathological alterations (Figure 5D).

Animals exposed to H. caffeaefomis and low dose gamma radiation showed organized hepatic cords of polygonal cells. Mild swelling of hepatocytes with narrowing of hepatic sinusoids were seen (Figure 5E). On the other side, animals exposed to D galactosamine and low dose gamma radiation exhibited disorganized hepatic cords and swelling of hepatocytes with granularity of its cytoplasm. Also, narrowing of hepatic sinusoids and hyperplasia of Kupffer cells were seen (Figure 5F). Hepatic tissue of animals group exposed to D galactosamine and H. caffeaefomis, showed ballooning of hepatocytes and narrowing of sinusoids with hyperplasia of Kupffer cells (Figure 5G). While animals exposed to D galactosamine and H. caffeaefomis and low dose gamma radiation showed near normal histological structure of hepatic lobules made up of cords of polygonal cells with prominent round nuclei and eosinophilic cytoplasm with noticed hyperplasia of Kupffer cells (Figure 5H).

Discussion

Liver regulates many vital roles in our body; thus, it causes grave sickness once diseased or wounded. Liver diseases could be caused from medications, toxins, or alcohol abuse. Because of deficiency of reliable hepatoprotective drugs in current treatment, there is a vital need for the progression of powerful in addition to safe hepatoprotective agents for the hepatitis treatment.²⁴ To the best of our knowledge, there were no information or experimental researches concerning H. caffeaeformis hepatoprotective effect against hepatotoxicity induced by D-GalN-. It was stated that low-dose radiation decreases inflammation (i.e., hepatitis) in experimental animals and induces antioxidant defenses.^25,26

Low IR dose (<1 Gy) improves cell defense thru stimulation of AKT/NF-KB pathway, which controls cell death and cell propagation. It was found that mitogen-activated protein kinase (MAPK) superfamily (i.e., c-(JNK)) is controlled by IR thus affecting cell existence or passing.²⁷ Lall et al²⁸ stated that regular human cells dealing with low IR dose enhances metabolic switch from oxidative phosphorylation to aerobic glycolysis accompanied by improved radiation resistance. This switch exhibited up-regulation of enzymes encoding genes of glycolysis and glucose transportation in the direction of pentose phosphate oxidative pathway thus introduction to low IR dose enhances cell fight against oxidation stress.

In the current study, changes linked with Gal—induced hepatic injury are like that of viral hepatitis.²⁹ Hereafter, D-GalN induced hepatic-toxicity was selected as perfect model of investigation. D-galactosamine changes antioxidant status making certain organs much vulnerable to oxidative stress. Numerous researches have revealed that Gal causes variation in hepatic-enzymes.³⁰ Liver impairment induced by Gal indicates metabolism troubles in hepatic cell leading to distinctive variations in serum enzyme activities.³¹

In the current study, the elevation in ALT and AST activities could be interpreted due to liver cell destruction or membrane absorptivity change both are distinguishing enzymes of liver impairment; so, their serum discharge proves GaI induction of liver injury. On other hand, Gal produced a substantial decline in level of albumin in serum as a hepatotoxicity marker, consistent with Wong et al study.³² Moreover, serum dropping of albumin level is because of mRNA down expression of albumin. Also, the decrease of total liver proteins evidently is due to liver injury³³ which confirms our results. However, our research team showed that Halamphora and/or IR exposure efficiently amended the integrity of parenchymal hepatocyte structural and ameliorates these biochemical parameters of liver injury, verifying the ameliorative effect of Halamphora/and IR against liver inflammation. However, a limitation of our study is the small sample size; therefore, the results of this experimental study should be viewed as indicative and should be validated in a larger cohort.

Inflammation is a closely related biological event involved in hepatitis pathogenesis.³⁴ Preceding studies have confirmed that hepatitis made by Gal was associated by the discharge of many proinflammatory cytokines, counting TNF-α, and IL-6, from liver cells. The current study stated that Halamphora caffeaefomis efficiently decreased the discharge of serum TNF-α, and IL-6 in hepatitis rat model.

ICAM-1 is a cell surface glycoprotein and an adhesion receptor that is best known for regulating leukocyte recruitment from circulation to sites of inflammation. However, in addition to vascular endothelial cells, ICAM-1 expression is also robustly induced on epithelial and immune cells in response to inflammatory stimulation.³⁵ Increased ICAM-1 likely reflects the persistence of inflammation³⁶ which agree with our histopathological results. ICAM-1 is an important early marker of response to inflammatory mediators and immune activation released from a variety of cells including hepatocytes.³⁷

ICAM-1, that activated strongly in several cell types by proinflammatory cytokines, has a critical role in immune cell enrolment. ICAM-1 offers adhesion sites between lymphocytes and neutrophils with activating release of inflammatory mediators by vascular endothelial cells.³⁸ Elevated levels of ICAM-1 in Gal group agreed with a previous study indicated that TNF-α is a powerful activator of expression of ICAM-1.³⁹ Elevated levels of TNF-α and NF-κB agreed with a previous study reported increased TNFα levels in liver tissue as a direct result of increased NFκB. After TNF-α binds to type 1 TNF-α receptors, NF-κB is phosphorylated and activated, thus generating a vicious cycle, and increasing the degree of injury.⁴⁰

The NF-.B/IL-6/STAT3 pathway shows an essential role in hepatic defense and renewal in a diversity model of liver injury, counting hepatotoxins induced noxious injury with ischemic liver injury, and Fas-mediated injury. STAT3 displays a vital part in stopping cell death by the activation of antioxidant (i.e., Ref-1) and antiapoptotic proteins. It was reported that STAT3 binds NF-κB and increases induction of NF-κB -dependent gene. NF-κB is vital for the initiation of mRNA expression of IL-6, also ROS activates NF-κB as a result of TNF-α in immune cells.⁴¹ In our study, the NF-κB and STAT3 expression showed significant increase in Gal group.

Jun N-Terminal Kinase pathway is the main path of cell apoptosis and inflammation induction.⁴² It was established that JNK signals are inspired by numerous exterior aspects like stress (high pressure infiltration, UV radiation, ischemia/reperfusion damage), cytokines (TNF-α, IL-1), and growth factors. p38 and JNK are stimulated by liver injury, and the regulatory effect is the result of their cooperation. In vitro researches in numerous types of cells as hepatic cell have shown that long-term stimulation of JNK signaling pathway is the mechanism of TNF-induced cell death.⁴³ Our results confirmed that treatment with the Halamphora and/or IR amends liver injury induced by D-GalN in rat.

Moreover, TNF-α is controlled in immune cells by NF-κB throughout the inflammatory reply.⁴⁴ Agreeing with Gao,⁴⁵ the raise of IL-6 level could be the protection policy to restore the damaged liver and control inflammation. IL-6 stimulates STAT3 then induce variation of hepatoprotective genes in hepatocytes.⁴⁵

The current results propose that useful effect of Halamphora and/or IR against Gal induced liver toxicity may somewhat be accredited to anti-inflammatory effects of Halamphora and/or IR that protect the hepatic cell through proinflammatory cascade mediated by toxins. Treatment with algae extract or/and IR significantly reduced NF-κB, TNF-α, ICAM, and IL6 levels in Gal induced rats compared to normal group suggesting their anti-inflammatory therapeutic effect. One of the main compounds found in algae extract is hespertin (Table 1). Hesperetin was found to inhibit NFκB by down regulating STAT3 signaling axis.⁴⁶

Oxidative stress is considered as one of the pathological mechanisms leading to the development and progression of many liver diseases, such as chronic viral hepatitis.⁴⁷ The present study showed that MDA levels, an indicator of lipid peroxidation, were significantly increased in liver homogenates accompanied with depleted activity of paraxonase-1 enzyme and imbalance in the ratio between GSSG/GSH of D-GalN treated rats. These results were supported by the finding of previous study,⁴⁸ that stated the vital role of GSH in detoxification and cell protection and that loss in GSH level indicates oxidant protection mechanism.

Alternatively, the intake of algal extract or/and IR depressed lipid peroxidation and improved antioxidants levels significantly when related to group treated with D-GalN. This was matching with improvement in liver function test telling that H coffaeiformis extract or/and low radiation dose have oxidants defense activities and tissues protection from lipid peroxidation in D-GalN induced hepatotoxicity group. This agreed with Boukhris et al⁴⁹ who specified that effective antioxidant efficiency of Halamphora sp. extract is displayed owing to its flavonoids, phenols and active polyphenolic ingredients high content.

H. coffeaeformis alga displayed hopeful scavenging properties of DNA lesions induced by hydrogen peroxide. The effectiveness of coffeaeformis alga to prevent the oxidative stress is attributed to many vital phyto-constituents existence counting phenolics, carotenoids, and chlorophylls additionally to existence of pyrogallol, flavonoids, and catechin.⁹

Likewise, the highlighted antioxidant activity of H. coffeaeformis depended on occurrence of carotenoids, β-carotene and fucoxanthin that have numerous efficient groups as epoxy, hydroxyl, carbonyl, and carboxyl moieties which are in charge of the antioxidant effect.⁴⁹

Conclusion

In conclusion, therapeutic herbs that have anti-inflammatory and antioxidant activity have turn out to be respectable candidates for study to improve tissue injury. Moreover, our outcomes offer powerful molecular suggestion in support of the hepto-ameliorative effect of Halamphora and/or IR against D-GalN induced hepatotoxicity through modulating signaling molecular targets associated with antioxidant, anti-inflammatory, and anti-proliferative activities. Our conclusions were well valued with histopathological results.

Footnotes

Acknowledgments

The authors would like to thank Dr Ahmed Othman (Professor of Histopathology, Faculty of Medicine, Cairo University) for carrying out blinded histopathological examination in this work.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by all authors. The first draft of the manuscript was written by Elsaman and all authors commented on subsequent versions of the manuscript. All authors read and approved the final manuscript.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Ethical Approval

All Animal procedures were performed according to the international ethical guidelines laid down in Helsinki declaration and are in accordance with the recommendations of the Ethical Committee of the National Research Center for Radiation Research and Technology (NCRRT), Atomic Energy Authority, Cairo, Egypt, conformed to “Guide for the care and use of Laboratory Animals” for the use and welfare of experimental animals, published by the US National Institutes of Health (NIH publication No. 85-23, 1996).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

ORCID iDs

Salma Elsaman

Sawsan M. Elsonbaty

Fatma S. M. Moawed

Marwa G. A. Hegazy

References

Del Campo

Gallego

Grande

. Role of inflammatory response in liver diseases: Therapeutic strategies. World J Hepatol. 2018;10:1-7.

Catal

Bolkent

. Combination of selenium and three naturally occurring antioxidants administration protects D-galactosamine-induced liver injury in rats. Biol Trace Elem Res. 2008;122:127-136.

Fortes Aiub

Bortolini

Arrieira Azambuja

Alves Filho

JCF

Bordignon Nunes

Rodrigues de Oliveira

. Alterations in the indexes of apoptosis and necrosis induced by galactosamine in the liver of Wistar rats treated with fructose-1,6-bisphosphate. Hepatol Res. 2003;25:83-91.

Stachlewitz

Seabra

Bradford

Bradham

Rusyn

Germolec

, et al. Glycine and uridine prevent D-galactosamine hepatotoxicity in the rat: Role of Kupffer cells. Hepatology 1999;29:737-745.

Enwereuzoh

Onyeagoro

. A novel aeration method for the preparation of algae (Dunaliella Salina) biomass for biofuel production. Am J Eng Res. 2014;3:209-214.

Goiris

Muylaert

Fraeye

Foubert

De Brabanter

De Cooman

. Antioxidant potential of microalgae in relation to their phenolic and carotenoid content. J Appl Phycol. 2012;24:1477-1486.

Karawita

Senevirathne

Athukorala

Affan

Lee

Kim

, et al. Protective effect of enzymatic extracts from microalgae against DNA damage induced by H₂O₂. Mar Biotechnol 2007;9:479-490.

Vaiserman

Koliada

Zabuga

Socol

. Health impacts of low-dose ionizing radiation: Current scientific debates and regulatory issues. Dose Response. 2018;16:1559325818796331.

El-Sayed

AEKB

Aboulthana

El-Feky

Ibrahim

Seif

. Bio phyto-chemical effect of Amphora coffeaeformis extract against hepatic injury induced by paracetamol in rats. Mol Biol Rep. 2018;45:2007-2023.

10.

Kandil

El-sonbaty

Moawed

Khedr

. Anticancer redox activity of gallium nanoparticles accompanied with low dose of gamma radiation in female mice. Tumour Biol. 2018;40:1010428317749676-1010428317749714.

11.

Akhila

Shyamjith

Alwar

. Acute toxicity studies and determination of median lethal dose. Curr Sci. 2007;93:917-920.

12.

Radhiga

Pugalendi

. Potential beneficial effect of protocatechuic acid on hepatic markers, lipid peroxidation and antioxidant status against D-galactosamine induced toxicity in rats. J Pharm Res. 2011;4:222-225.

13.

Reitman

Frankel

. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol. 1957;28:56-63.

14.

Doumas

Ard Watson

Biggs

. Albumin standards and the measurement of serum albumin with bromocresol green. Clin Chim Acta. 1971;31:87-96.

15.

Gornall

Bardawill

David

. Determination of serum proteins by means of the biuret reaction. J Biol Chem. 1949;177:751-766.

16.

Pfaffl

. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45.

17.

Chomczynski

. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques. 1993;15:532-536.

18.

Bradford

. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254.

19.

Satoh

. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin Chim Acta. 1978;90:37-43.

20.

Ahmed

Hussein

Loh

Abdel-Rahman

. Studies on the mechanism of haloacetonitrile-induced gastrointestinal toxicity: Interaction of dibromoacetonitrile with glutathione and glutathione-S-transferase in rats. J Biochem Toxicol. 1991;6:115-121.

21.

Hissin

Hilf

. A fluorometric method for determination of oxidized and reduced glutathione in tissues. Anal Biochem. 1976;74:214-226.

22.

Kumar

. Effect of simvastatin on paraoxonase 1 (PON1) activity and oxidative stress. Asian Pac J Tropical Med. 2010;3:310-314.

23.

Banchroft

Stevens

Turner

. Theory and Practice of Histological Techniques. 4th ed. New York, NY, USA: Churchill Livingstone; 1996.

24.

Mondal

Hossain

Hasan

Tarun

MTI

Islam

MAF

Choudhuri

MSK

, et al. Hepatoprotective and antioxidant capacity of Mallotus repandus ethyl acetate stem extract against d-galactosamine-induced hepatotoxicity in rats. ACS Omega 2020;5:6523-6531.

25.

Scott

. Radiation-hormesis phenotypes, the related mechanisms and implications for disease prevention and therapy. J Cell Commun Signal. 2014;8:341-352.

26.

Kojima

Tsukimoto

Shimura

Koga

Murata

Takara

. Treatment of cancer and inflammation with low-dose ionizing radiation: Three case reports. Dose Response. 2017;15:1559325817697531.

27.

Zahran

Elsonbaty

Moawed

FSM

. Selenium nanoparticles with low-level ionizing radiation exposure ameliorate nicotine-induced inflammatory impairment in rat kidney. Environ Sci Pollut Res Int. 2017;24:19980-19989.

28.

Lall

Ganapathy

Yang

Xiao

, et al. Low-dose radiation exposure induces a HIF-1-mediated adaptive and protective metabolic response. Cell Death Differ 2014;21:836-844.

29.

Amir

Mallick

Ahmad

ALI

AHMAD

AKHTAR

, et al. Hepatoprotective effects of Punica granatum fruit against D-galactosamine-induced hepatotoxicity in rats: In vitro and in vivo studies. Int J Pharm Pharmaceut Sci 2017;9:168-172.

30.

Tang

Gao

Fan

Zhao

, et al. Mechanisms of hepatoprotection of terminalia catappa L. extract on D-Galactosamine-induced liver damage. Am J Chin Med 2004;32:509-519.

31.

Cengiz

Ali

Kutlu

Vejselova

Ayhanci

. Potential recruiting and hepatoprotective effects of ellagic acid in D-Galactosamine-induced liver damage in rats. Pakistan J Zool. 2017;49:1251-1259.

32.

Wong

MCY

Portmann

Sherwood

Niemela

Koivisto

Parkkila

, et al. The cytoprotective effect of alpha-tocopherol and daidzein against d-galactosamine-induced oxidative damage in the rat liver. Metabolism 2007;56:865-875.

33.

Ferencíková

Cervinková

Drahota

. Hepatotoxic effect of D-galactosamine and protective role of lipid emulsion. Physiol Res. 2003;52:73-78.

34.

Gao

Liu

Chen

Deng

Zou

, et al. Crocetin protects against fulminant hepatic failure induced by lipopolysaccharide/D-galactosamine by decreasing apoptosis, inflammation and oxidative stress in a rat model. Exp Ther Med 2019;18:3775-3782.

35.

Bui

Wiesolek

Sumagin

. ICAM-1: A master regulator of cellular responses in inflammation, injury resolution, and tumorigenesis. J Leukoc Biol. 2020;108(3):787-799.

36.

Bruno

Sciacca

Cilio

, et al. Circulating adhesion molecules in patients with virus-related chronic diseases of the liver. World J Gastroenterol. 2005;11(29):4566-4569.

37.

El-Gohary

Fawaz

Hassoba

Serwah

Ali

. Soluble ICAM-1 in patients with chronic hepatitis C infection: A prognostic marker of disease activity. Egypt J Immunol. 2004;11(2):109-119.

38.

Liu

Zhang

Zhao

Wang

. Catalpol ameliorates psoriasis-like phenotypes via SIRT1 mediated suppression of NF-κB and MAPKs signaling pathways. Bioengineered. 2021;12:183-195.

39.

Wung

Wang

. ICAM-1 induction by TNFalpha and IL-6 is mediated by distinct pathways via Rac in endothelial cells. J Biomed Sci. 2005;12:91-101.

40.

Mahmoud

Gamal

El-Fayoumi

. Baicalein preconditioning modulates hepatocellular injury following liver ischemia and reperfusion in rats via anti-inflammatory and antioxidant signaling. Dubai Med J. 2019;2:73-80.

41.

Obayashi

Arisaka

Yoshida

Mori

Takahashi

. Proline protects liver from D-galactosamine hepatitis by activating the IL-6/STAT3 survival signaling pathway. Amino Acids. 2012;43:2371-2380.

42.

Liu

Zhang

Xia

Dong

, et al. Protective effect of Xuebijing injection on D-galactosamine-and lipopolysaccharide-induced acute liver injury in rats through the regulation of p38 MAPK, MMP-9 and HO-1 expression by increasing TIPE2 expression. Int J Mol Med 2016;38:1419-1432.

43.

Wang

Singh

Lefkowitch

Rigoli

Czaja

. Tumor necrosis factor-induced toxic liver injury results from JNK2-dependent activation of caspase-8 and the mitochondrial death pathway. J Biol Chem. 2006;281:15258-15267.

44.

Gloire

Legrand-Poels

Piette

. NF-kappaB activation by reactive oxygen species: Fifteen years later. Biochem Pharmacol. 2006;72:1493-1505.

45.

Gao

. Hepatoprotective and anti-inflammatory cytokines in alcoholic liver disease. J Gastroenterol Hepatol. 2012;27:89-93.

46.

Kottaiswamy

Kizhakeyil

Padmanaban

, et al. The citrus flavanone hesperetin induces apoptosis in CTCL cells via STAT3/notch1/NFκB-mediated ssignaling axis. Anti Cancer Agents Med Chem. 2020;20(12):1459-1468.

47.

Tan

Wang

Zhang

Lao

Wong

, et al. The role of oxidative stress and antioxidants in liver diseases. Int J Mol Sci 2015;16:26087-26124.

48.

Seckin

Alsancak

Basaran Kucukergin

AYDIN

, et al. Effect of d-galactosamine on oxidative stress and apoptosis in the liver of rats. J Ist Faculty Med 2008;71:29-32.

49.

Boukhris

Athmouni

Hamza-Mnif

Nasri

Ayadi

Siala-Elleuch

, et al. The potential of a brown microalga cultivated in high salt medium for the production of high-value compounds. BioMed Res Int 2017;2017:1-10.

Evaluation of Brown Micro-Algae Synergies With Low Dose γ -Radiation Against Chronic Hepatitis Induced by D-Galactosamine in Rats

Abstract

Introduction

Methods

Results

Conclusion

Keywords

Introduction

Materials and Methods

Chemicals

Preparation of Algal Extract

Animals

Radiation Facility

Median Lethal Dose of Algal Extract (LD50)

Experimental Design

Samples Collection

Blood Sampling

Tissue Sampling

Biochemical Investigations

Liver Function Markers and Some Related Parameters in Serum

Inflammatory Markers

Determination of Nuclear Factor Kappa B and Signal Transducer and Activator of Transcription 3 (STAT3) mRNA Gene Expression by Quantitative Real-Time PCR in Liver Tissues

Extraction of RNA and Reverse Transcription

Quantitative Real-Time Polymerase Chain Reaction

Western Blotting of c-Jun N-Terminal Kinase Protein

Determination of Liver Tissue Oxidative Stress Markers

Histopathological Study

Statistical Analyses

Results

Biochemical Studies

Effect of H. caffeaeformis and/or Low Dose IR on Liver Function Among Groups

Effect of H. caffeaeformis and/or Low Dose Ionizing Radiation on Inflammatory Markers Among Groups

Gene Expression Level of Inflammation Markers Among Groups

Effect of H. caffeaeformis and/or Low Dose Ionizing Radiation on c-Jun Expression

Effect of H. caffeaeformis and/or Low Ionizing Radiation Dose on Oxidative Stress Markers in Liver Homogenate

Histopathological Results

Discussion

Conclusion

Footnotes

Acknowledgments

Author Contributions

Declaration of Conflicting Interests

Funding

Ethical Approval

Data Availability Statement

ORCID iDs

References