Sage Journals: Discover world-class research

Abstract

Diabetic-induced erectile dysfunction (DIED) is a frequent complication of diabetes mellitus. Qianlie Beixi Capsules, a formulation of traditional Chinese medicine, have long been used for its management. The effectiveness of Qianlie Beixi Capsules in treating DIED was evaluated together with an exploration of their possible mechanism of action. Streptozotocin (STZ) was administered to rats to induce diabetes, with confirmation of erectile dysfunction using apomorphine (APO). The animals were allocated to six groups: the blank control (NC), model (M), Qianlie Beixi Capsules low-dose (QD), Qianlie Beixi Capsules medium-dose (QZ), Qianlie Beixi Capsules high-dose (QG), and HIF-1α inhibitor (YC) groups. After 2 weeks of treatment, serum levels of testosterone (T), Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1), and Endothelial Microparticles (EMPs) were measured. Penile histology was analyzed for structural alterations. Furthermore, Western blotting and reverse transcription quantitative polymerase chain reaction (RT-qPCR) were utilized to assess levels of mammalian target of rapamycin(mTOR), p70 ribosomal protein S6 kinase(p70s6k), hypoxia-inducible factor 1-alpha(HIF-1α), vascular endothelial growth factor(VEGF), and endothelial nitric oxide synthase(eNOS ) in the corpus cavernosum. The QZ and QG groups demonstrated markedly increased penile erection frequency relative to the model rats (p < .05). Histological analyses revealed increased smooth muscle cell densities, reduced collagen deposition, and a decrease in erythrocytes within the blood sinuses in these groups. Expression of HIF-1α and VEGF proteins was significantly reduced (p < .05), while eNOS expression was elevated (p < .05). Moreover, serum levels of LOX-1 and EMPs were markedly reduced (p < .05) in the QZ and QG groups. Qianlie Beixi Capsules improve DIED by modifying the mTOR/HIF-1α/VEGF signaling axis, which additionally increases penile endothelial function and reduces endothelial fibrosis.

Keywords

diabetes-induced erectile dysfunction HIF-1α/VEGF pathway Qianlie Beixi Capsules traditional Chinese medicine

Research Background

Diabetes mellitus (DM) is classified by the World Health Organization (WHO) as one of the three major chronic diseases. Globally, more than 415 million individuals are affected by diabetes or are at risk of developing the condition at an early stage (Ogurtsova et al., 2017). According to epidemiological data published in JAMA, the prevalence of diabetes in China has reached 10.9%, with China having the highest number of diabetes patients worldwide (Wang et al., 2017). Diabetes-induced erectile dysfunction (DIED) is among the most common and clinically significant complications of DM and is strongly associated with cardiovascular comorbidities (Bergman et al., 2014). The National Institutes of Health (NIH) has recognized DM as a significant factor in male erectile dysfunction (ED). Epidemiological studies indicate that the prevalence of erectile dysfunction is 1.9 to 5 times greater in DM patients than in non-DM persons. Globally, the prevalence of DIED ranges from 20% to 75% (Phé & Rouprêt, 2012), with 37.5% and 66.3% of individuals with type 1 and type 2 DM, respectively, experiencing ED (Desai et al., 2023).

Professor Tong Xiaolin has proposed that DM induces endothelial injury, leading to an impaired microvascular system (S. Li et al., 2021). The microvasculature is particularly vulnerable during the early stages of DM, where damage progresses through four distinct phases: stasis, recurrent stasis, vascular closure, and structural injury. Based on this framework, Tong advocates for consistent therapeutic interventions that promote blood circulation and alleviate blood stasis, recommending that such treatments be initiated in the early stages of DM. Blood circulation-promoting medications should be administered early on, and therapy that eliminates blood stasis and increases blood circulation should be regularly used to treat DM (S. Li et al., 2021). Furthermore, Foresta et al. (2005) found that a decrease in nitric oxide (NO) due to endothelial damage in penile blood vessels and reduced utilization are common causes of ED. From the perspective of traditional Chinese medicine (TCM), endothelial dysfunction is closely related to blood stasis. TCM believes that endothelial dysfunction is a pathological change of blood stasis, and tonifying the kidney with the promotion of promoting blood circulation is an effective treatment for diabetic ED.

Moreover, numerous studies have shown a close relationship between TCM’s concept of blood stasis and endothelial damage, indicating that endothelial dysfunction is a pathological change of blood stasis (Hu & Chen, 2007; Li & Jiang, 2000). Ye et al. (2022) found that the Bushen Huoxue Huatan decoction inhibits the expression of RhoA/ROCK2 proteins, inhibits fibrosis of penile corpora cavernosa, maintains the smooth muscle contents, and improves erectile function in diabetic rats. Clinical studies have also found significant improvements in erectile function in patients treated with methods such as tonifying the kidney and promoting blood circulation, Huoxue Qiwie Tang, and Shaofu Zhuyu Tang (Jia et al., 2021; Liu et al., 2021; Ru et al., 2020). Blood circulation-promoting drugs have shown promising efficacy in both clinical and experimental settings. Leeches and centipedes can reduce apoptosis of rat corpora cavernosa, endothelial cells, and penile smooth muscle cells through the Calcium-sensing receptor (CaSR)/Phospholipase C(PLC)/Protein kinase C(PKC) and Phosphatidylinositol 3-kinase(PI3K)/Protein kinase B(AKT)/mTOR axes, improving erectile function in ED rats (H. S. Li et al., 2021; Hu & Wang, 2022). Wang et al. (2021) found that the Nuxi-Wangbuliuxing decoction can improve the structure of penile corpus cavernosum tissue and treat ED in ED rats.

Previous studies have found that DIED rats show significant vascular microenvironmental damage, such as endothelial cell dysfunction and abnormal platelet activation, leading to local hypoxia due to insufficient blood supply. The HIF-1α can stabilize and regulate the transcriptional expression of different cytokines in an oxygen-dependent manner during hypoxia-induced cellular stress responses. This may regulate the activity of cytokines, such as VEGF, leading to endothelial cell injury and smooth muscle fibrosis in the penile corpora cavernosa (Sooriyamoorthy & Leslie, 2022). Therefore, it is hypothesized that Qianlie Beixi Capsules may have a beneficial role in the treatment of DIED by modulating the HIF-1 pathway and improving the vascular endothelial environment of the penile corpus cavernosum.

Experimental Methods

Main Reagents

Streptozotocin (STZ) was sourced from Sigma (USA), and apomorphine hydrochloride was obtained from Beijing Soleibao (China). Primary antibodies against ACTIN (GB11001), eNOS (GB11086), HIF-1α (GB111339), mTOR (GB111839), and VEGF (GB11034b) were purchased from Servicebio (China). The p70s6k antibody (AF6226) was acquired from Affinity (China).

Modeling and Grouping

A total of 60 male Sprague-Dawley (SD) rats, specifically pathogen-free grade, aged 8 weeks, and weighing 200 ± 20 g, were used in this study. All rats were supplied by Beijing Huafukang Biotechnology Co., Ltd [Animal License No. SCXK (Jing) 2014-0004]. The animals were kept in the animal facility of the Experimental Animal Center at Dongzhimen Hospital, Beijing University of Chinese Medicine. Before the experiment, the rats underwent mating tests to confirm the normality of their sexual functioning. Following this, the rats were fed for a week and given unrestricted food and deionized water access. The housing environment was maintained under a 10–12-hr light cycle, relative humidity of 55%–80% and temperature of 18°C–25°C. This study received approval from the Animal Experiment Ethics Committee of Chinese Medicine and followed the ethical guidelines (Approval No.: BUCM-2023052402-2198).

DM Rat Model

Sixty 8-week-old SD rats were adaptively given standard feed for 1 week. Ten animals were selected randomly as controls using the random number table approach, and they were fed the same diet. For 4 weeks, the remaining 50 rats were given a diet high in fat and sugar. These rats were injected intraperitoneally with a 1% solution of STZ (55 mg/kg) after food induction, while the control group was given an equivalent amount of sodium citrate buffer. Three days later, fasting blood glucose levels were determined via tail vein blood collection using the tail-cutting method. Diabetes was considered successfully induced when these levels were above 16.7 mmol/L on two consecutive assessments. In total, 50 rats successfully developed diabetes and were included in the subsequent experiments.

DIED Rat Model

ED was assessed in the animals after subcutaneous administration of APO (100 μg/kg) into the neck. The erection response was monitored over a 30-min observation period. Rats that failed to show a penile erection were categorized as having DIED and were used for subsequent analyses.

Grouping and Drug Administration

Ten blank rats were initially designated for the blank control group (n = 10), referred to as the NC group. After the DM animal models had been established, the rats were randomly separated into four groups for medication intervention: the model group (n = 10, referred to as the M group), the low-dose Qianlie Beixi Capsules group (n = 10, QD group), the medium-dose Qianlie Beixi Capsules group (n = 10, QZ group), the high-dose Qianlie Beixi Capsules group (n = 10, QG group), and the HIF-1α inhibitor group (n = 10, YC group). The gavage doses were converted to low, medium, and high doses for rats as 0.324 g/kg, 0.648 g/kg, and 1.296 g/kg, respectively, with reference to the formula for converting drug doses between humans and rats (Xu et al., 2008).

During the treatment phase, all rats were kept under standardized feeding conditions, with drug administration scheduled each day at 10:00. The NC group received deionized water, and the M group was administered a 5% sodium carboxymethylcellulose (CMC-Na) solution via oral gavage. The QD, QZ, and QG groups were gavaged with Qianlie Beixi Capsules dissolved in deionized water and 5% sodium CMC-Na at doses of 0.324 g/kg, 0.648 g/kg, and 1.296 g/kg, respectively. The YC group received intraperitoneal injections of YC-1 (1 mg/kg), prepared by dissolving YC-1 in a mixture of DMSO and corn oil to 1 mg/mL.

The treatments were as follows: Rats in the experimental groups received regular food, with medication administered each day at 10:00. The NC and M groups were orally gavaged with deionized water and a 5% sodium carboxymethylcellulose solution, respectively, at doses of 0.324 g/kg, 0.648 g/kg, and 1.296 g/kg for the QD, QZ, and QG groups, respectively. Qianlie Beixi Capsules were dissolved in deionized water and a 5% sodium carboxymethylcellulose solution for oral gavage. YC-1 was dissolved to 1 mg/mL in DMSO and corn oil, which was given intraperitoneally to the YC-1 rats at 1 mg/kg. After 2 weeks of treatment, the animals were weighed and apomorphine (APO)-induced erections were evaluated as described above.

Tissue Collection

On completion of treatment, the rats underwent a 12-hr fast and were anesthetized with 1% sodium pentobarbital (30 mg/kg). Blood (10 mL) was taken from the abdominal aorta and centrifuged (3000 rpm, 15 min, low temperature) to obtain the sera. Penile corpus cavernosum tissues were obtained from each rat, fixed, paraffin-embedded, and sectioned for histological examination using hematoxylin and eosin (HE) staining.

Evaluation of Erectile Function

After completing 2 weeks of drug intervention, rats from all groups were housed individually for observation in transparent cages under low-light conditions and a quiet environment to minimize external stress. APO was then administered subcutaneously into the neck (100 μg/kg). Penile erections were observed and recorded for 30 min, and the number of erections was counted for each rat. Penile erections in the rats were counted and recorded within a 30-min observation window.

Detection of Vascular Hormones, Endothelial Injury, and Cytokines in Serum

After centrifugation, serum was collected from each rat, and the levels of T, LOX-1, EMPs, and other related factors were measured by ELISA using the following reagents: P-NFH (FANKEW; FO285-RB; Shanghai, China); NFH (FANKEW; F0280-RB); NO (FANKEW; F9044-B); ET (FANKEW; F3509-B); MDA (FANKEW; F8503-B); SOD (FANKEW; F3262-B); and NSE (FANKEW; F2945-B), using specific kits as directed. Absorbances were read at 450 nm, and protein concentrations were determined against a standard curve.

HE Staining for Observation of Penile Corpus Cavernosum Structure

Penile tissues collected from each experimental group were fixed in a 4% formaldehyde solution for 48 hr, followed by embedding in paraffin. The tissues were sectioned and placed on a warm water surface to flatten. Once the section was uniformly expanded on the water surface, it was transferred to the central area of a glass slide. The slide was then tilted to remove excess water before placement in a constant-temperature oven set at 60–65°C or the baking chamber of a tissue flotation dryer for 15 min to dissolve and eliminate the paraffin from the tissue interstices. The tissue sections were sequentially treated with environmentally friendly dewaxing, using Dimethylbenzene Xylene I and II, for 20 min each. This was followed by dehydration through anhydrous ethanol I and II (each for 5 min) and 75% ethanol (also for 5 min), after which the sections were thoroughly rinsed with tap water. The tissue sections were stained with hematoxylin for 4 min and then rinsed with tap water, subjected to differentiation, rinsed again, and subsequently treated with a bluing reagent, followed by an additional rinse with running water. Subsequent dehydration was performed using 85% and 95% ethanol (5 min each). Eosin staining was then performed for 5 min, followed by dehydration with anhydrous ethanol I, II, and III for 5 min per step. To achieve tissue transparency, sections were treated with xylene I and II (5 min each) and were subsequently sealed with neutral gum. Finally, the sections were examined and imaged at 100× magnification for histological evaluation.

Electron Microscopic Observation of Ultrastructure of Penile Corpus Cavernosum Endothelium and Muscle

Penile tissues from each rat group were fixed in 2.5% glutaraldehyde overnight at 4°C, followed by treatment with 1% osmium tetroxide for 2 hr, after which the samples underwent a gradient dehydration process using acetone, were embedded in epoxy resin, and were sectioned into standard ultrathin slices of 70 nm. Staining of the sections was performed using uranyl acetate and lead citrate, both prepared in acetic acid. Observation and imaging were conducted with a JEM1400plus transmission electron microscope. Three random visual fields were chosen for each specimen.

Western Blot Detection of HIF Pathway-Related Proteins (mTOR, p70s6k, HIF-1α, VEGF, eNOS) in Penile Corpus Cavernosum Tissues

The tissues from the penile corpora cavernosa were immediately crushed in liquid nitrogen and then placed into Eppendorf tube (EP) tubes that had been previously chilled. The tissues were lysed in 250 μL of radioimmunoprecipitation assay (RIPA) lysis buffer containing phenylmethylsulfonyl fluoride (PMSF), phosphatase inhibitor A, and phosphatase inhibitor B in a 100:2:1:1:1 ratio on ice for 20 min, followed by centrifugation (10,000 rpm, 10 min, 4°C). Protein levels were assessed using the bicinchoninic acid (BCA) assays, after which proteins were denatured by boiling in 2× sodium dodecyl sulfate (SDS) loading buffer for 5 min. Twenty micrograms were electrophoresed on 12% Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) gels and electrotransferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were blocked with 5% skim milk dissolved in Tris-buffered saline with Tween-20 (TBS-T) buffer and shaken for 1 hr at room temperature. Following blocking, they were washed three times for 10 min each with TBS-T buffer and incubated at 4°C overnight with primary antibodies against actin (Servicebio, Wuhan, China; 1:2000) and eNOS (Servicebio; 1:2000) in TBS-T buffer. Following the primary antibody incubation, after three rounds of washing in TBS-T buffer, the blot was treated with horseradish peroxidase (HRP)-conjugated secondary antibodies for an hour at 37°C while being shaken. They were incubated with enhanced chemiluminescence (ECL) reagent for 5 min at room temperature with mild shaking after three further washes with TBS-T buffer were performed. Excess ECL solution was removed using filter paper, and the membranes were placed into an X-ray cassette for exposure to X-ray film in a darkroom. The films were then developed, fixed, rinsed, air-dried, and scanned for grayscale band analysis using Image-Pro Plus.

Reverse Transcription Quantitative Polymerase Chain Reaction Detection of HIF Pathway-Related Nucleic Acids (mTOR, HIF-1α, HIF-1β, VEGF, eNOS) in Penile Corpus Cavernosum Tissues

RNA was extracted from tissues using a kit (Servicebio; GM2005) as directed. The isolated RNA’s integrity was examined through agarose gel electrophoresis, and its purity was determined spectrophotometrically. Reverse transcription was performed to synthesize cDNA, which was then amplified by PCR in a 25 μL reaction, using β-actin as the internal reference and specific primers (see Table 1). The PCR cycling parameters involved an initial denaturation at 95°C for 5 min, followed by 30 cycles of 94°C denaturation for 1 min, annealing at varying temperatures for 40 s, and extension at 72°C for 1 min, finishing with a 10-min elongation at 72°C. Amplifications were performed using a fluorescence-based quantitative PCR system, with each sample analyzed in triplicate for accuracy. Relative gene expression was calculated using the 2^−ΔΔCt method.

Table 1.

Primer Information.

Primer information	Primer sequence (5’-3’)	Fragment length (bp)
MTOR	Forward: CTCTGACTACAGCACCAGTGAAATG	169
	Reverse: CAGGGACTTGAAGATGAAGGTGAT
HIF-1α	Forward: ACCGTGCCCCTACTATGTCG	117
	Reverse: GCCTTGTATGGGAGCATTAACTT
VEGF	Forward: GCAATGATGAAGCCCTGGAGT	157
	Reverse: GGCTTTGTTCTATCTTTCTTTGGTC
eNOS	Forward: ACTATGGCAACCAGCGTCCT	254
	Reverse: CCAGGTGTTTCTTGGGTAGGC

Statistical Analysis

All statistical analyses were conducted using GraphPad Prism 8 and SPSS 22.0. Normally distributed data are expressed as mean ± standard deviation (x ± s) and were compared using one-way ANOVA. Pairwise group comparisons were performed using the least significant difference (LSD) method. Non-normally distributed data were compared using nonparametric rank-sum tests. Homogeneity of variance was tested prior to ANOVA application. The chi-square tests were used for comparison of categorical variables. A p-value less than 0.05 was considered statistically significant. In addition, 95% confidence intervals (CIs) were calculated to enhance the interpretability of the comparisons.

Results

Effects of Qianlie Beixi Capsules on Body Weights, Blood Glucose, and Erectile Function of Rats in Each Group

The M, QD, QZ, QG, and YC groups showed marked reductions in body weight and erection frequency compared to the controls (p < .05), whereas blood glucose levels were significantly raised (p < .05) (Figure 1A–C). No significant differences were detected in body weight, blood glucose levels, or the number of erections between the QD and M groups (p > .05) (Figure 1A–C). When comparing the M group to the QZ, QG, and YC groups, marked increases in body weight and the number of erections were observed (p < .05) (Figure 1A, C). Moreover, markedly reduced blood glucose levels were seen (p < .05) (Figure 1B). However, the body weights, blood glucose levels, and the number of erections did not differ significantly among the QZ, QG, and YC groups (p > .05) (Figure 1A–C).

Figure 1.

Effects of Qianlie Beixi Capsules on Body Weights, Blood Glucose Levels, and Erectile Function in Rats of Each Group. (A) Influence of Qianlie Beixi Capsules on Blood Glucose Levels in Rat Groups. (B) Blood Glucose Variations in Different Rat Groups Treated with Qianlie Beixi Capsules. (C) Changes in Erection Count Across Rat Groups Following Qianlie Beixi Capsule Treatment.

Effect of Qianlie Beixi Capsules on Penile Tissue Structure in Rats of Each Group

Histological analysis of the penile corpus cavernosum in the NC group revealed evenly distributed trabeculae and blood sinuses, with minimal presence of red blood cells within the sinuses. The sinuses contained numerous regularly shaped smooth muscle cells, interspersed with small blood vessels and collagen fibers. No interstitial tissue proliferation was seen. However, the M group showed marked reductions in the number of blood sinuses and small blood vessels, along with an irregular sinus distribution. A marked decrease in smooth muscle cell density was observed, alongside a marked increase in collagen fiber deposition relative to the NC group. The QD, QZ, QG, and YC groups displayed relatively uniform distributions of blood sinuses, increased densities of smooth muscle cells, and a decreased quantity of collagen fibers. A small number of red blood cells were detected within the sinuses. Particularly, among these groups, the QG group demonstrated significant improvement, with a substantial increase in the number of blood sinuses and a higher density of smooth muscle cells (see Figure 2).

Figure 2.

HE-Stained Penile Corpus Cavernosum Tissue From Rats in Different Groups (×100 magnification).

Effects of Qianlie Beixi Capsules on the Levels of HIF-1α Axis-Associated Proteins

The results indicated that mTOR protein levels in the penile corpora cavernosa were elevated in the M, QD, QZ, QG, and YC groups relative to the NC group, although the changes were non-significant (p > .05). Similarly, when compared to the M group, the QD, QZ, QG, and YC groups showed a decreasing but non-significant trend in mTOR protein levels (p > .05) (Figure 3A). The M and QD groups showed a significant upregulation of p70s6k protein expression relative to the NC rats (p < .05), while the QZ, QG, and YC groups also showed an increasing but non-significant trend in p70s6k protein expression (p > .05). However, when compared to the M group, the QG group showed markedly reduced mTOR protein levels in penile corpora cavernosa (p < .05) (Figure 3B).

Figure 3.

Expression Patterns of HIF-1α Pathway Proteins in Rat Penile Corpora Cavernosa. (A) mTOR levels. (B) p70s6k levels. (C) HIF-1α levels. (D) VEGF levels. (E) eNOS levels. (F) Protein immunoblotting of cavernosum tissues from the different groups.

Analysis of HIF-1α protein expression revealed a significant increase in the penile corpora cavernosa of rats in the M, QD, QZ, QG, and YC groups relative to the controls (p < .05). However, a significant reduction in HIF-1α protein expression was observed in the QD, QZ, QG, and YC groups relative to the M group (p < .05) (Figure 3C). Similarly, VEGF protein levels were markedly upregulated in the M, QD, QZ, and YC groups relative to the NC group (p < .05). However, the QG group showed significant downregulation of VEGF relative to the M group (p < .05) (Figure 3D). Moreover, eNOS levels were markedly lowered in the M and QD groups relative to the controls (p < .05). Significant upregulation of eNOS was found in the QG group relative to the M group (p < .05) (Figure 3E).

Effects of Qianlie Beixi Capsules on mRNA Levels of HIF-1α Axis Components

The expression levels of mTOR mRNA in the corpus cavernosum were significantly upregulated in the M, QD, QZ, QG, and YC groups relative to the controls (p < .05). The QD, QZ, QG, and YC groups showed reduced mTOR mRNA levels relative to those in the M group, although the difference was not significant (p > .05) (Figure 4A). Likewise, HIF-1α mRNA levels were markedly higher in the M, QD, QZ, QG, and YC groups relative to the NC group (p < .05). However, in comparison to the M group, the QD, QZ, QG, and YC groups demonstrated a marked reduction in HIF-1α mRNA (p < .05) (Figure 4B). Furthermore, VEGF mRNA levels showed marked increases in the M, QD, QZ, and YC groups relative to the NC group (p < .05). However, markedly decreased VEGF mRNA levels were detected in the QG group relative to the M group (p < .05) (Figure 4C). Moreover, eNOS mRNA was downregulated in the M and QD groups compared to the NC group (p < .05), but compared to the M group, it was upregulated in the QD, QZ, and QG groups (p < .05) (Figure 4D).

Figure 4.

mRNA Levels of HIF-1α-Pathway Components in the Corpora Cavernosa of Rats. (A) mTOR mRNA levels. (B) HIF-1α mRNA levels. (C) VEGF mRNA levels. (D) eNOS mRNA levels.

Effects of Qianlie Beixi Capsules on Serum T, COX-1, and EMPs

Analysis of serum T levels revealed a significant decrease in the M, QD, QZ, QG, and YC groups relative to the controls (p < .05). These data indicate that Qianlie Beixi Capsules did not increase serum testosterone relative to the DIED model. However, no significant differences were seen when comparing the QD, QZ, QG, and YC groups to the M group (p > .05) (Figure 5A). Furthermore, marked increases in serum LOX-1 concentrations were observed in the M, QD, QZ, and QG groups relative to the controls (p < .05), although these were markedly lower in the QD, QZ, QG, and YC groups in comparison to the M group (p < .05). Similarly, serum EMP levels were markedly elevated in the M, QD, QZ, and QG groups relative to the controls (p < .05), but compared to the M group, they were reduced in the QZ, QG, and YC groups (p < .05).

Figure 5.

Serum Concentrations of T, LOX-1, and EMPs in Rats From the Different Groups. (A) T levels. (B) LOX-1 levels. (C) EMP levels.

Discussion

DIED is a prevalent complication of DM, characterized by endothelial dysfunction and vascular impairment due to prolonged hyperglycemia. Consistently high blood glucose levels lead to increasing fibrosis and damage to the penile smooth muscle, ultimately impairing erectile function. Therapies based on TCM that focus on increasing blood flow and eliminating blood stasis are effective for treating DIED (Wang et al., 2023).

Qianlie Beixi Capsules, an herbal formulation containing Vaccariae Semen, Hedgehog Hide, Chinese Honeylocust Spine, Maidenhair All-grass, and Mole Cricket, have been shown to promote blood circulation, facilitate collateral flow, and alleviate blood stasis. A clinical study on ED reported that Qianlie Beixi Capsules significantly enhanced International Index of Erectile Function-5 (IIEF-5) scores and improved TCM symptom assessments (Lin et al., 2019). In this study, rats treated with Qianlie Beixi Capsules (QZ, QG, and YC groups) showed markedly improved body weights, increased erectile frequencies, and lower blood glucose levels relative to the model (M) group. These results suggest that Qianlie Beixi Capsules contribute to glycemic control while enhancing erectile function in DIED rats. Furthermore, histological analysis via HE staining further demonstrated that Qianlie Beixi Capsules led to significant improvements in corpus cavernosum architecture, including an increased number of blood sinuses, improved smooth muscle cell density, reduced collagen fiber proliferation, and minimal red blood cell infiltration. Moreover, the QG group, which received a higher dosage, showed more substantial improvements, suggesting that higher doses of Qianlie Beixi Capsules may provide improved therapeutic efficacy against DIED.

Hypoxia induces a sequence of cellular stress responses, where HIF-1α is involved in stabilizing and regulating the transcription of oxygen-dependent cellular factors. Under hypoxic conditions, HIF-1α transcriptionally regulates eNOS, which catalyzes the synthesis of NO from L-arginine. The vasodilatory properties of NO facilitate the expansion of penile corpus cavernosum blood vessels, increasing intracavernosal pressure and supporting erectile function (Serocki et al., 2018; Sooriyamoorthy & Leslie, 2022). Although recovery of tissue under acute hypoxia requires transient HIF-1 activation, restoration of function might not be complete, with new tissues partially replicating the previous architecture but compensating for it. However, prolonged damage or chronic hypoxia can cause hypoxia signaling to become dysregulated, which can lead to organ dysfunction, fibrotic alterations, and excessive scar tissue development (Darby & Hewitson, 2016). Sustained exposure to hyperglycemia and hypoxia results in prolonged HIF-1 overexpression, which, in turn, stimulates the expression of VEGF. This upregulation activates Interleukin-1β(IL-1β) and adhesion molecules (Intercellular Adhesion Molecule 1[ICAM-1] and Vascular Cell Adhesion Molecule 1[VCAM-1]), resulting in abnormal endothelial cell proliferation, endothelial hypertrophy, and intercellular gap expansion, thereby compromising the vascular integrity of the penile corpus cavernosum (Zhou et al., 2020). Furthermore, prolonged HIF-1 overexpression increases the platelet-derived growth factor (PDGF) expression, which stimulates the PDGF pathway. Upon binding to its receptor (PDGFR), PDGF initiates the proliferation and migration of neighboring cells. This facilitates myofibroblast development and excessive extracellular matrix accumulation, resulting in fibrotic changes and further vascular microenvironment of the penile corpus cavernosum (Zhang et al., 2023). This study demonstrates that Qianlie Beixi Capsules and the HIF-1α inhibitor YC-1 could treat DIED by decreasing the mTOR/HIF/VEGF signaling axis, decreasing collagen fiber development in the corpus cavernosum, and improving pathological alterations.

Studies have shown that HIF-1α enhances eNOS secretion, which in turn facilitates NO production. In the penile corpus cavernosum, NO is an essential vasodilatory molecule that is crucial in regulating vascular tone and promoting smooth muscle relaxation. This process increases intracavernosal pressure, facilitating erection. Endothelial cells in the corpora cavernosa are a primary site of NO biosynthesis. However, under hyperglycemic conditions, endothelial cell function deteriorates, leading to a decrease in NO production, thereby contributing to vascular dysfunction (Ren & Li, 2011; Sooriyamoorthy & Leslie, 2022). The formation of NO is crucial for normal erectile function. Endothelial cell damage further leads to local ischemia and hypoxia in the penile corpus cavernosum, which, along with large vessel lesions, collectively affect the vascular microenvironment of the corpus cavernosum, forming a vicious cycle (Li et al., 2024) and becoming a risk factor for inducing ED.

This study observed that while HIF-1α and VEGF levels showed consistent trends, their association with eNOS expression was not directly correlated. These findings suggest that Qianlie Beixi Capsules may regulate eNOS expression through alternative molecular pathways. El Assar et al. (2015) demonstrated that stimulation of the PI3K/AKT/eNOS pathway can reverse endothelial dysfunction in rats and humans, independent of mTOR/HIF-1α activation, in cases of endothelial damage. Future studies should incorporate specific pathway analyses to explore this potential mechanism further and validate these findings. Importantly, we did not measure penile tissue testosterone/dihydrotestosterone or androgen receptor expression/binding; thus, no inference can be made regarding androgen-mediated mechanisms from the present study.

The LOX-1 and EMPs are widely recognized biomarkers of vascular injury, and previous studies have established a direct relationship between increased EMP levels and endothelial dysfunction (Huang & Xia, 2018). Endothelial damage is exacerbated by EMPs, leading to increased vascular dysfunction. Furthermore, the overexpression and activation of LOX-1 increase vascular permeability, facilitating the excessive accumulation of lipids in blood vessels, which ultimately induces NO-mediated coronary endothelial dysfunction (Hein et al., 2019). This study demonstrated that Qianlie Beixi Capsules effectively reduce vascular injury by decreasing LOX-1 and EMP levels, thereby protecting endothelial function and presenting a potential therapeutic intervention for DIED.

Despite the promising results, several limitations should be acknowledged. First, this study utilized an STZ-induced rat model of DIED. Although this model is widely accepted, it may not entirely replicate the complex pathophysiology and multifactorial nature of DIED in humans. Second, although the study focused on the mTOR/HIF-1α/VEGF signaling pathway, other pathways, such as PI3K/AKT/eNOS, TGF-β, or oxidative stress-related mechanisms, were not investigated, which may limit the mechanistic comprehensiveness of the study. Third, the treatment period was relatively short (14 days), which did not permit assessment of the long-term efficacy, toxicity, and sustainability of Qianlie Beixi Capsules. Fourth, the therapeutic components of Qianlie Beixi Capsules were not isolated or quantified, and thus, the specific active compounds responsible for the observed effects were not analyzed. We also did not collect chronic toxicity data, and the present study cannot support claims of long-term safety. However, existing clinical evidence indicates that 1 month of continuous use of Qianlie Beixi Capsules is safe (Geng, 2021). Future studies should aim to address these limitations through longer treatment durations, pathway-specific interventions, and analysis of active components.

Conclusion

This study provides experimental evidence that Qianlie Beixi Capsules can significantly alleviate DIED in rats through modulation of the mTOR/HIF-1α/VEGF signaling pathway. The treatment effectively restored the function of endothelial cells in the penile corpus cavernosum, as demonstrated by the improvements in histological architecture, seen in increased smooth muscle density, reduced collagen fiber accumulation, and enhanced sinusoidal structure. At the molecular level, Qianlie Beixi Capsules reduced the overexpression of HIF-1α and VEGF while upregulating eNOS, contributing to improved NO production and vascular tone. Moreover, the systemic levels of endothelial cell injury markers, including LOX-1 and EMPs, were significantly reduced in the treated groups, indicating improved vascular integrity. These benefits were most pronounced in the high-dose (QG) and HIF-1α inhibitor (YC) groups, suggesting dose-dependent effects and pathway specificity. Collectively, Qianlie Beixi Capsules may cure DIED by improving endothelial cell function in the penile corpus cavernosum and preventing endothelial fibrosis via the mTOR/HIF-1α/VEGF pathway.

Footnotes

Authors’ Note

We confirm that the manuscript is original, has not been published elsewhere, and is not currently under consideration for publication by any other journal. We also confirm that there are no conflicts of interest, financial or otherwise, that could be perceived as influencing the research reported in this manuscript.

ORCID iDs

Longji Sun

Junlong Feng

Weidong Feng

Zixiang Gao

Ethical Considerations

The study was conducted in accordance with ethical standards and has been approved by the relevant ethics committee. The study was approved by the Ethics Committee of Beijing University of Chinese Medicine, approval number BUCM-202501V402-2198.

Author Contributions

Each author has made significant contributions to the study and has approved the final version of the manuscript. Longji Sun, Zhechao Lin, Junlong Feng, and Weidong Feng contributed equally to this work and share first authorship.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was supported by the Wu Jieping Medical Foundation Clinical Research Special Funding Fund (320.6750.2022-25-1).

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement

We confirm that all data and materials used in this study are original and have not been previously published. We also confirm that we have the right to use and publish these data and materials. The data sets analyzed during the current study are available from the corresponding author on reasonable request.

References

Bergman

R. N.

Stefanovski

Kim

S. P.

(2014). Systems analysis and the prediction and prevention of type 2 diabetes mellitus. Current Opinion in Biotechnology, 28, 165–170. https://doi.org/10.1016/J.COPBIO.2014.05.007

Darby

I. A.

Hewitson

T. D.

(2016). Hypoxia in tissue repair and fibrosis. Cell and Tissue Research, 365(3), 553–562. https://doi.org/10.1007/S00441-016-2461-3

Desai

Chen

Cayetano

Jayasena

C. N.

Minhas

(2023). Understanding and treating ejaculatory dysfunction in men with diabetes mellitus. Andrology, 11(2), 379–398. https://doi.org/10.1111/andr.13262IF:3.2Q1

El Assar

Sánchez-Puelles

J. M.

Royo

Lõpez-Hernández

Sánchez-Ferrer

Aceña

J. L.

Rodríguez-Mañas

Angulo

. (2015). FM19G11 reverses endothelial dysfunction in rat and human arteries through stimulation of the PI3K/Akt/eNOS pathway, independently of mTOR/HIF-1α activation. British Journal of Pharmacology, 172(5), 1277–1291. https://doi.org/10.1111/BPH.12993

Foresta

Caretta

Lana

Cabrelle

Palù

Ferlin

(2005). Circulating endothelial progenitor cells in subjects with erectile dysfunction. International Journal of Impotence Research, 17(3), 288–290. https://doi.org/10.1038/sj.ijir.3901311

Geng

(2021). Clinical expert consensus on the application of Qianlie Beixi Capsules in chronic prostatitis in China. Chinese Journal of Andrology, 27(04), 366–369. https://doi.org/10.13263/j.cnki.nja.2021.04.015

Hein

T. W.

Ren

Tsai

S. H.

Thengchaisri

Kuo

(2019). Requisite roles of LOX-1, JNK, and arginase in diabetes-induced endothelial vasodilator dysfunction of porcine coronary arterioles. Journal of Molecular and Cellular Cardiology, 131, 82–90. https://doi.org/10.1016/J.YJMCC.2019.04.015

J. L.

Chen

(2007). Research progress on the relationship between erectile dysfunction and vascular endothelial function. Chinese Journal of Andrology, 7, 632–635.

Wang

H. J.

(2022). Study on the improvement of erectile dysfunction in rats by leech and centipede decoction through regulating CaSR/PLC/PKC signaling pathway. Chinese Journal of Sexology, 31(4), 150–154. https://doi.org/10.3969/j.issn.1672-1993.2022.04.037

10.

Huang

W. S.

Xia

J. T.

(2018). Clinical observation of reperfusion arrhythmia in patients with acute myocardial infarction after PCI. Journal of Clinical Emergency, 19(8), 510–512, 517. https://doi.org/10.13201/j.issn.1009-5918.2018.08.004

11.

Jia

X. Y.

Zhang

Y. J.

Duan

Y. H.

Zhang

H. B.

Luo

X. N.

(2021). Efficacy observation of Shao Fu Zhu Yu Tang combined with Sildenafil in the treatment of qi stagnation and blood stasis type 2 diabetes mellitus erectile dysfunction. Journal of Modern Integrated Traditional Chinese and Western Medicine, 30(9), 931–935.

12.

Wang

A. L.

Zhao

Z. Q.

Zhang

Z. H.

Zhang

(2024). Protective effect of Astragaloside IV on the retina of type 2 diabetic rats. Chinese Pharmacology and Clinical Pharmacology, 5, 63–67. https://doi.org/10.13412/j.cnki.zyyl.2024.05.002

13.

H. S.

Wang

J. S.

Dai

H. H.

Bao

B. H.

Deng

Long

Z. W.

H. S.

Wang

(2021). Mechanism of hirudo and scolopendra medicine in improving erectile dysfunction in diabetic rats based on the PI3K/AKT/mTOR signaling pathway. Journal of Beijing University of Traditional Chinese Medicine, 44(12), 1118–1125. https://doi.org/10.3969/j.issn.1006-2157.2021.12.009

14.

X. Y.

Tong

X. L.

(2021). Experience of “treating the root cause based on syndrome differentiation” in the treatment of diabetic retinopathy by Tong Xiaolin. Liaoning Journal of Traditional Chinese Medicine, 48(11), 24–26. https://doi.org/10.13192/j.issn.1000-1719.2021.11.006

15.

Jiang

(2000). Endothelial cell injury and blood stasis syndrome. Chinese Journal of Integrated Traditional and Western Medicine, 2, 75–77.

16.

Lin

W. Y.

Bian

T. C.

Cheng

J. S.

Wang

Y. X.

Guo

J. M.

(2019). Clinical efficacy of Qianlie Beixi Capsules on III b prostatitis patients with sexual dysfunction [Paper presentation]. Proceedings of the First Male Health Collaborative Innovation Forum of Traditional Chinese and Western Medicine and the Third National Youth Academic Forum on Integrated Traditional Chinese and Western Medicine in Andrology, Nanchang, China.

17.

Liu

G. Y.

Liao

X. D.

Huang

X. L.

Jiang

C. B.

(2021). Clinical observation of tonifying kidney, activating blood circulation, and promoting meridian therapy in the treatment of diabetic erectile dysfunction. Primary Medical Forum, 25(20), 2919–2921. https://doi.org/10.19435/j.1672-1721.2021.20.059

18.

Ogurtsova

da Rocha Fernandes

J. D.

Huang

Linnenkamp

Guariguata

Cho

N. H.

Cavan

Shaw

J. E.

Makaroff

L. E.

(2017). IDF diabetes atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Research and Clinical Practice, 128, 40–50. https://doi.org/10.1016/J.DIABRES.2017.03.024

19.

Phé

Rouprêt

(2012). Erectile dysfunction and diabetes: A review of the current evidence-based medicine and a synthesis of the main available therapies. Diabetes and Metabolism, 38(1), 1–13. https://doi.org/10.1016/J.DIABET.2011.09.003

20.

Ren

L. G.

(2011). Protecting penile endothelial function: A new approach to treating erectile dysfunction. Chinese Journal of Andrology, 17(2), 160–164.

21.

B. Z.

Zhao

G. P.

Lei

B. C.

Feng

G. Q.

(2020). Effect of Huoxue Qiwai Decoction combined with Sildenafil on Hcy, NO, ET-1, and sexual function in patients with erectile dysfunction. Clinical Medical Research and Practice, 5(12), 141–143, 152. https://doi.org/10.19347/j.cnki.2096-1413.202012055

22.

Serocki

Bartoszewska

Janaszak-Jasiecka

Ochocka

R. J.

Collawn

J. F.

Bartoszewski

(2018). MiRNAs regulate the HIF switch during hypoxia: A novel therapeutic target. Angiogenesis, 21(2), 183–202. https://doi.org/10.1007/S10456-018-9600-2

23.

Sooriyamoorthy

Leslie

S. W.

(2022). Erectile dysfunction. StatPearls Publishing.

24.

Wang

J. S.

H. S.

Dai

H. H.

Bao

B. H.

Feng

J. L.

Deng

Long

Z. W.

H. S.

Wang

(2021). Mechanism study of Achyranthes bidentata-Wangbuliuxing in treating erectile dysfunction in diabetic rats based on network pharmacology. World Science and Technology-Modernization of Traditional Chinese Medicine, 23(5), 1579–1587. https://doi.org/10.11842/wst.20200805006

25.

Wang

Gao

Zhang

Huang

Zhang

Deng

Zhao

Qin

Jin

Zhou

Tang

Wang

(2017). Prevalence and ethnic pattern of diabetes and prediabetes in China in 2013. JAMA—Journal of the American Medical Association, 317(24), 2515–2523. https://doi.org/10.1001/JAMA.2017.7596

26.

Wang

X. Y.

Yin

L. X.

Han

X. Y.

Zhang

Kong

Jiang

Y. Y.

(2023). Research progress of traditional Chinese medicine on erectile dysfunction in diabetes. Inner Mongolia Journal of Traditional Chinese Medicine, 42(5), 165–166.

27.

S. Y.

Bian

R. L.

Chen

(2008). Pharmacological experimental methodology (3rd ed.; p. 1543). People’s Medical Publishing House.

28.

M. Y.

Zhao

Wang

J. W.

Shi

Wang

J. X.

(2022). Effect of Buyang Huanwu Decoction on fibrosis of corpus cavernosum and expression of RhoA and ROCK2 proteins in rats with diabetic erectile dysfunction. Chinese Journal of Integrated Traditional and Western Medicine, 42(11), 1369–1375.

29.

Zhang

X. L.

R. K.

Gao

Q. Q.

Wan

S. F.

Zhang

T. Y.

(2023). Mechanism of Astragalus and angelica sinensis ultrafiltration membrane extracts in regulating renal fibrosis in DKD rats through the HIF-1α signaling pathway mediated by renal hypoxia. China Journal of Chinese Materia Medica, 6, 1602–1610. https://doi.org/10.19540/j.cnki.cjcmm.20231116.304

30.

Zhou

S. S.

Z. Z.

W. N.

Y. M.

(2020). Network pharmacology of Rheum officinale against renal fibrosis and the mechanism of action of its active components. Chinese Journal of Experimental Traditional Medical Formulae, 26(10), 163–172. https://doi.org/10.13422/j.cnki.syfjx.20201002

Qianlie Beixi Capsules Ameliorate Diabetes-Induced Erectile Dysfunction via Modulation of the HIF-1α/VEGF Signaling Pathway: Evidence From an in Vivo Study

Abstract

Keywords

Research Background

Experimental Methods

Main Reagents

Modeling and Grouping

DM Rat Model

DIED Rat Model

Grouping and Drug Administration

Tissue Collection

Evaluation of Erectile Function

Detection of Vascular Hormones, Endothelial Injury, and Cytokines in Serum

HE Staining for Observation of Penile Corpus Cavernosum Structure

Electron Microscopic Observation of Ultrastructure of Penile Corpus Cavernosum Endothelium and Muscle

Western Blot Detection of HIF Pathway-Related Proteins (mTOR, p70s6k, HIF-1α, VEGF, eNOS) in Penile Corpus Cavernosum Tissues

Reverse Transcription Quantitative Polymerase Chain Reaction Detection of HIF Pathway-Related Nucleic Acids (mTOR, HIF-1α, HIF-1β, VEGF, eNOS) in Penile Corpus Cavernosum Tissues

Statistical Analysis

Results

Effects of Qianlie Beixi Capsules on Body Weights, Blood Glucose, and Erectile Function of Rats in Each Group

Effect of Qianlie Beixi Capsules on Penile Tissue Structure in Rats of Each Group

Effects of Qianlie Beixi Capsules on the Levels of HIF-1α Axis-Associated Proteins

Effects of Qianlie Beixi Capsules on mRNA Levels of HIF-1α Axis Components

Effects of Qianlie Beixi Capsules on Serum T, COX-1, and EMPs

Discussion

Conclusion

Footnotes

Authors’ Note

ORCID iDs

Ethical Considerations

Author Contributions

Funding

Declaration of Conflicting Interests

Data Availability Statement

References