Sage Journals: Discover world-class research

Abstract

Objectives. Erxian Decoction (EXD) is a well-documented Chinese medicinal formulation, which has been clinically applied for years for relieving menopausal syndromes by modulating hormonal levels indicating that EXD might also be effective in treating hormone-related tumors. This study aimed to differentially investigate the efficacy of EXD and its antimetastatic property on human ovarian cancer cells, OVCA429. Methods. The efficacy and cell cycle progression of EXD on OVCA429 cells was determined by MTT assay and flow cytometry, respectively. The modulated expression of metastatic markers by EXD in OVCA429 cells and xenografts was evaluated at transcriptional and translational levels by Western blotting and real-time polymerase chain reaction, respectively. The migrating and invasive ability of the cancer cells were determined by wound healing and invasive assays. Results. The IC₅₀ value of EXD on OVCA429 cells was determined after 24 hours incubation with EXD at 1 mg/mL. EXD (1.5 mg/mL) mediated S-phase cell cycle arrest and apoptotic cell death at 24 hours posttreatment. EXD repressed the expression of several metastatic mediators, including EGFR, ErbB2, MMP2, MMP7, MMP9, and VEGF in OVCA429 cells and xenografts at transcriptional and/or translational levels. Furthermore, EXD functionally demonstrated significant inhibition of migrating and invasive ability of OVCA429 cells. EXD suppressed tumor size in xenografts without any adverse effects on body weight. Conclusions. This is the first study that illustrates the antimetastatic property of EXD on human ovarian cancer models. This decoction merits serious consideration for further delineation of its multiple pharmacological effects, especially on hormone-related cancers, and these would be valuable for future clinical applications of EXD as an alternative regime for cancers.

Keywords

Chinese medicinal decoction Erxian Decoction ovarian cancer antitumor effect antimetastasis

Introduction

Ovarian cancer is one of the major causes of death from gynecological malignancies. The etiologic origins of ovarian cancer are poorly understood. Most of them that arise from epithelium are possibly influenced by hormonal imbalance in ovulation and pregnancy and that brought about by exogenous estrogens and progestins.¹ The use of unopposed postmenopausal estrogen has been associated with a 25% to 50% increase in risk of ovarian cancer.^2-4 The majority of ovarian cancers are detected in late stage with poor prognosis. Therefore, a new alternative regime, especially Chinese medicine, is crucial for improving the survival of menopausal women with ovarian cancer.

Chinese medicinal decoctions are the selected compound formulae, based on the holistic philosophy of traditional Chinese medicine and following the rules of drug synergism and compatibility.⁵ Based on the theory of Chinese medicine, different combinations of herbs cause systemic therapeutic effects in human subjects. Apart from the individual bioactivities, the various components of herbs/decoctions might act synergistically to reinforce the bioactivities of others, thereby modulating the multiple therapeutic effects of the herbal medicine.⁶

Erxian Decoction (EXD), a popular Chinese medicinal formula, has long been applied clinically in the treatment of menopausal syndrome and osteoporosis without adverse side effects.^7,8 EXD consists of 6 Chinese medicinal herbs, namely, Curculigo orchioides, Herba Epimedii, Morinda officinalis How, Angelica sinensis, Phellodendron chinense, and Anemarrhena asphodeloides.⁹ Many clinical and experimental reports demonstrated that EXD was effective in relieving menopausal syndrome via increasing the circulatory estradiol level as well as involving increased endocrine and antioxidant function.^7,10 Because of the substantial progress made in clinical and experimental studies of EXD, the number of these studies has been extended to elucidate the multiple pharmacological actions of EXD in various diseases, such as endocrine-related diseases, immunological disorders, and anti-inflammation.⁷ Furthermore, studies also demonstrated that some pure extracts from these 6 herbs have antitumor effect. It is reported that Icariin, a pure extract from H Epimedii, significantly suppressed gastric cancer cell invasion and migration.¹⁰ A novel polysaccharide, isolated from Angelica sinensis was found to induce apoptosis through the intrinsic apoptotic pathway in cervical cancer cells.¹¹ Besides, 2 compounds isolated from A asphodeloides, namely timosaponin A-III and sarsasapogenin, exhibited potent cytotoxicity by inducing apoptosis in cervical cancer and hepatoma cells, respectively.^12,13 These studies indicated that EXD might have potent anticancer effects.

Although hormone replacement therapy (HRT) is effective in relieving menopausal syndromes, HRT may increase the risk of breast cancer, ovarian cancer, heart attacks, and stroke.^14-17 A recent British study found that the risk of developing ovarian cancer increased by 20% among postmenopausal women who had used HRT for 5 to 7 years.¹⁵ Previous studies reported that EXD treatment enhanced serum estrogen in both menopausal women and animal models.^18-20 Our previous findings elucidated that the mechanism of action of EXD responsible for estrogen biosynthesis in the aged-rat ovary, which was comparable to menopausal women.^21,22 Besides, the modified EXD improved the bone marrow hematopoietic function chemotherapy in breast cancer patients with chemotherapy.²³

It has been demonstrated that EXD has multiple pharmacological effects; however, the efficacy and mechanism of EXD in combating tumors has not been reported so far. Furthermore, the application of EXD in menopausal women is well studied; however, whether EXD exerted an effect on the growth of hormonal-related cancer in menopausal women, such as ovarian and breast cancers remains to be investigated. Since no data have been reported on the efficacy and mechanism of EXD in combating tumors so far, therefore, this study aimed to investigate the efficacy of EXD on human ovarian cancer models through the elucidation of the metastatic marker expression at transcriptional and translational levels.

Methods

Drug Preparation

Erxian Decoction (EXD, powdered form) was generously provided by PuraPharm International (HK) Ltd with GMP standard (lot number: A090612-01). EXD is a mixture of 6 Chinese medicinal herbs, C orchioides, H Epimedii, M officinalis How, A sinensis, P chinense, and A asphodeloides. The stock solution of EXD (10 mg/mL) was prepared in phosphate-buffered saline and filtered with a 0.2 µm filter before use. Aliquots of stock solution were stored at −20°C for subsequent used. The working dilutions of EXD were prepared in RMPI-1640 supplemented with 10% fetal bovine serum.

Cell Line and Culture

A human ovarian cancer cell line OVCA429 was used as it is capable of mimicking the spread of ovarian cancer in peritoneal implants observed in patients.²⁴ It was a gift from School of Biomedical Sciences, the Chinese University of Hong Kong. The cells were subcultured in RPMI-1640 (Gibco, Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and 1% of penicillin and streptomycin mixture (Hyclone) at 37°C with 5% carbon dioxide.

Ovarian Cancer Xenograft Model

The experiment was approved by the Department of Health, Hong Kong SAR, and Committee on the Use of Live Animals in Teaching and Research of Li Ka Shing Faculty of Medicine, the University of Hong Kong. Seven-week-old female nude mice were purchased from the University’s Animal Laboratory Unit. The ovarian carcinoma was established by subcutaneous injection of OVCA429 cells (1.5 × 10⁷) into the right thigh of each animal. When the tumors became palpable after xenografting, mice were randomly divided into 2 groups of 8 to 10 animals each. A volume of 200 µL EXD (10 mg/mL) or water was administered orally for 17 consecutive days. Tumor volume was measured using a digital caliper every day (formula = length in mm × width in mm × height in mm). Body weights were recorded throughout the whole experiment as an assessment of drug toxicity. At the end of the experiment, the tumor xenografts were excised and stored at −80°C for subsequent experiments.

Cell Proliferative Assay by MTT Assay

The OVCA429 cells (2 × 10⁴) were serum-starved for 24 hours, and then incubated with serial concentrations of EXD (0, 0.25, 0.5, 1, 1.5, 2, and 2.5 mg/mL) for 24 and 48 hours in 96-well plates. Inhibition of cell proliferation was assessed by the 3-4,5-dimethylthiazol-2-yl-2,5- diphenyltetrazolium bromide (MTT) assay. After lysing cells with dimethyl sulfoxide, the absorbance was recorded using a spectrophotometer at 595 and 655 nm as reference. The data obtained were in triplicate.

Cell Cycle Analysis by Flow Cytometry

OVCA429 cells (2 × 10⁵) were treated with EXD at 1 and 1.5 mg/mL in 35 mm dishes and incubated for 0, 8, 24, 32, 48, and 56 hours. Control cells were included. At specified time points, the cells were trypsinized, washed, and fixed with 80% ethanol at 4°C. The cells were then stained with propidium iodide at 37°C for 30 minutes. The EXD-mediated cell cycle progression was determined by counting 10 000 cells from each sample using a Cytomics FC500 flow cytometer (Beckman Coulter, Brea, CA). The percentage changes of each cell cycle phase were analyzed by Modfit LT 3.0.

Determination of EXD-Mediated Metastatic Markers at Transcriptional Level

OVCA429 cells were treated with 1 and 1.5 mg/mL EXD for 24 and 48 hours and the xenografts were harvested. The total RNA of the samples was extracted using High Pure Isolation kit (Roche Applied Science, Indianapolis, IN). Control samples (without drug treatment) were also included. Total RNA (2 µg) of each sample was reverse-transcribed into complementary DNA with Oligo-dT primers using Revert First strand cDNA synthesis kit (Fermentas, Glen Burnie, MD). Primer pairs and probes for real-time polymerase chain reaction were designed by the Assay Design Centre of the Universal Probe Library (Roche Applied Science, Indianapolis, IN). The target genes included epidermal growth factor receptor (EGFR; NM_201283.1; 61nt; Forward: catgtcgatggacttccaga; Reverse: gggacagcttggatcacact; Probe ID: #44), matrix metalloproteinase 2 (MMP2; NM_004530.4; 63nt; Forward: ataacctggatgccgtcgt; Reverse: aggcacccttgaagaagtagc; Probe ID: #70), matrix metalloproteinase 7 (MMP7; NM_002423.3; 128nt; Forward: tggacggatggtagcagtct; Reverse: tctccatttccataggttggat; Probe ID: #6), matrix metalloproteinase 9 (MMP9; NM_004994.2; 73nt; Forward: cctggagacctgagaaccaa; Reverse: gagtgtaaccatagcggtacagg; Probe ID: #27), vascular endothelial growth factor (VEGF; NM_001025370.1; 74nt; Forward: ctacctccaccatgccaagt; Reverse: ccacttcgtgatgattctgc; Probe ID: #29) and vascular endothelial growth factor receptor 2 (VEGFR2; NM_002253.2; 66nt; Forward: gaacatttgggaaatctcttgc; Reverse: cggaagaacaatgtagtctttgc; Probe ID: #18). Glyceraldehyde 3-phosphate dehydrogenase was included as the internal control. Real-time polymerase chain reaction was carried out in a 384-multiwell plate of LightCycler 480 system. The results were analyzed using LightCycler 480 Software, Version 1.5.

Western Blotting Analysis

The Western blot protocol was modified from our previous publication.²⁵ The proteins were extracted from EXD-treated OVCA429 cells, untreated, and EXD-treated excised xenografts. Fifteen micrograms of the denatured protein from each sample was separated and transferred to a polyvinylene difluoride membrane (Pall, Bio-Gene, Pensacola, FL). Membrane blocking with 5% bovine serum albumin (Sigma, St Louis, MO) was then incubated with primary antibodies specifically recognizing phospho-EGFR, epithelial growth factor receptor 2 (ErbB2), VEGFR2 (Abcam, Cambridge, UK), MMP2, MMP7, VEGF (Santa Cruz Biotechnology, Santa Cruz, CA), and MMP9 (Millipore, Billerica, MA) followed by incubation with horseradish peroxidase–conjugated secondary antibodies (Millipore, Billerica, MA). The detection was performed using the Advanced Chemiluminescence Western blotting detection system (GE Healthcare, Waukesha, WI). The band intensities were quantified by a Bio-Rad Chemi Doc EQ densitometer and Bio-Rad Quantity One software (Bio-Rad Laboratories, Hercules, CA), and normalized to that of anti-GADPH (MAB374, Millipore, Billerica, MA).

In Vitro Migration Assay

The procedures of the wound-healing assay were modified.²⁶ In brief, OVCA429 cells (1.5 × 10⁴) were seeded in 24-well plates. After confluence, a wound was made with a 200-µL pipette tip. The cells were then treated with EXD; control cells were included. The closure of the wound area by migrating cells, if any, was observed at 0, 24, and 48 hours post–drug treatment using an inverted-phase contrast microscope (Carl Zeiss; ×100) coupled with a CCD camera and images were recorded at each time point. The images were analyzed by Tscratch software.²⁷ The percentage of open wound area was measured and compared with the value obtained before treatment (at 0 hours). A decrease of the percentage of open wound area indicated migration of cells to cover the open wound area.

In Vitro Invasion Assay

The invasion ability of the EXD-treated OVCA429 cells was determined using the 24-well Transwell inserts with 8 µm porosity polycarbonate filters (Millipore, Billerica, MA) coated with matrigel (Bio-Gene). Briefly, the cells were seeded in the upper compartment of the Transwell inserts with EXD (1 and 1.5 mg/mL) or with medium only (control group) and incubated for 24 and 48 hours. The cells in the Transwell inserts were then fixed in 80% cold methanol and stained with 2% crystal violet. The cells on the upper compartment of the filter were removed and the cells in the lower surface of the filter were counted under a light microscope at ×200 (Carl Zeiss). The experiment was assayed in duplicate and 3 independent experiments were performed.

Statistical Analysis

The data were statistically analyzed by Graphpad Prism (Version 5.02) with a P value <.05 being considered as statistically significant. The data from the in vitro cancer cell and in vivo xenograft models were collected from 3 independent experiments and at least 6 individual xenografts, respectively.

Results

Antiproliferative Effect of EXD on Ovarian Cancer Cells

From the results, the half maximal inhibitory concentration (IC₅₀) and IC₇₀ were determined at 1 mg/mL and 1.5 mg/mL EXD at 24-hour and 48-hour incubation, respectively (Figure 1). The EXD dosages used to obtain IC₅₀ and IC₇₀ were applied to the subsequent experiments. And the antiproliferative effect of EXD on OVCA429 cells was in a time- and dose-dependent manner.

Figure 1.

Antiproliferative effect of Erxian Decoction (EXD) on human ovarian cancer cells.

EXD-Mediated S-Phase Arrest and Apoptotic Cell Death in OVCA429 Cells

The cell cycle progression mediated by EXD on OVCA429 cells was quantitated by flow cytometric analysis. From the results, 1 mg/mL EXD significantly induced S-phase arrest followed by time-dependent apoptotic cell death from 8 to 48 hours (***P < .001; 2-way analysis of variance [ANOVA]; Figure 2A and B); whereas 1.5 mg/mL EXD only triggered S-phase arrest (***P < .001 and *P < .05; 2-way ANOVA; Figure 2A and C). The results indicated that EXD, at a lower dosage of 1 mg/mL, triggered apoptotic cell death in OVCA429 cells in a time-dependent manner.

Figure 2.

Cell cycle analysis of Erxian Decoction (EXD) in ovarian cancer cells by flow cytometry.

EXD-Modulated Expression of Metastatic Markers in OVCA429 Cells

In comparison with the control, the expressions of metastatic markers, including EGFR, MMP2, MMP7, and MMP9 were all significantly downregulated by 1 mg/mL EXD at 48 hours incubation (***P < .001; 1-way ANOVA; Figure 3). There was significant upregulation of MMP2, -7, and -9 at 24 hours incubation of EXD, and then, all of them were further downregulated when the incubation time of EXD was prolonged to 48 hours. Although the reduced expression of VEGF and VEGFR2 by EXD was not statistically significant, the reduced expression of VEGFR2, the surface receptor of VEGF, was consistent with less VEGF. The results suggested that EXD might potentially inhibit the metastatic ability of OVCA429 cells in vitro through downregulation of EGFR, MMP2, MMP7, MMP9, VEGF, and VEGFR2 at the transcriptional level.

Figure 3.

Erxian Decoction (EXD) modulated the expression of metastatic markers by real-time polymerase chain reaction at transcriptional level.

For protein expression, EXD significantly suppressed VEGF (*P < .05; 1-way ANOVA) and MMP9 (**P < .001; 1-way ANOVA) protein expression in OVCA429 cells in a time-dependent manner (Figure 4D and F). However, such reduction was not found in the case of other proteins, such as phosphor-EGFR (Figure 4A), MMP7 (Figure 4C), and VEGFR2 (data not shown). There was an upregulation in ErbB2 (Figure 4B) and MMP2 (Figure 4E) proteins after 48 hours incubation.

Figure 4.

Erxian Decoction (EXD) regulated metastatic protein expression by Western blotting analysis.

Erxian Decoction Functionally Inhibited Migrating and Invasive Ability of OVCA429 Cells

The effect of EXD on migrating and invasive ability of OVCA429 cells was determined functionally by wound-healing assay and invasion assay using Transwell inserts. The results demonstrated that EXD significantly inhibited the migration ability of OVCA429 cells after 24 and also 48 hours incubation when compared with the control cells (Figure 5A). Also, EXD lowered the number of invading cells passing through the pores of the Transwell inserts (Figure 5B), suggesting that EXD suppressed both migrating and invasive abilities of OVCA429 cells in vitro.

Figure 5.

Reduction of migration and invasive effects of Erxian Decoction (EXD) on OVCA429 cells.

Erxian Decoction Suppressed Ovarian Cancer Growth and Metastatic Protein Expression in Xenografts

The tumor size in the EXD-treated xenografts was significantly suppressed without affecting the body weight when compared with the control group (Figure 6A and B). The results indicated that EXD did not exert toxicity to the normal control group but inhibited ovarian cancer growth in vivo. Regarding the expression of metastatic proteins in ovarian cancer xenografts, EXD significantly downregulated ErbB2, MMP7, and VEGF expression but not the expressions of MMP2 and MMP9 (Figure 6C). There was only a slight expression of VEGFR2 in the control xenograft and no obvious changes in its expression after EXD treatment (data not shown).

Figure 6.

Suppression of ovarian cancer growth and metastatic protein expressions by Erxian Decoction (EXD) in xenograft model.

Discussion

Erxian Decoction, a Chinese medicinal decoction, has been well-studied as a treatment for age-related diseases, such as menopausal syndromes and osteoporosis.^21,28,29 However, elderly patients usually not only suffer from one of these diseases but also have chronic diseases, such as cancer. In view of this, whether EXD exerts any pharmacological effects on patients with multiple diseases deserves investigation. Therefore our study was designed to investigate whether EXD has any effects on a hormone-related cancer, that is, ovarian cancer, using in vitro and in vivo models.

This preliminary study showed that EXD effectively inhibited proliferation of OVCA429 cells with an IC₅₀ value of 1 mg/mL after 24 hours incubation (Figure 1), indicating that EXD might be effective in combating ovarian cancer. To evaluate the mechanism of cell death induction of EXD on OVCA429 cells, cell cycle analysis was performed. From the results, EXD triggered S-phase cell cycle progression in OVCA429 cells followed by apoptotic cell death (Figure 2). EXD induced apoptotic cell death in OVCA429 cells suggesting that the exposure of intracellular materials from apoptotic cells was limited to the surrounding microenvironment, thus avoiding host inflammatory reaction.³⁰

A number of molecules have been investigated as potentially biologic factors involved in the mechanism of ovarian cancer progression, including cell cycle regulation, intercellular interaction, extracellular matrix regulation and degradation, and angiogenesis.³¹ This study was designed to investigate the expression of some prevalent molecular markers, including VEGF, EGFRs, and MMPs under the modulation of EXD in order to delineate the antimetastatic mechanism of EXD in ovarian cancer.

The EGFRs are usually mutated or overexpressed in various tumors such as ovarian cancer.³² This receptor family consists of 4 receptors: EGFR (ErbB1), ErbB2 (HER2/neu), ErbB3 (HER3), and ErbB4 (HER4).^32,33 EGFR is overexpressed in 35% to 70% of human epithelial ovarian cancers, which are associated with more aggressive disease and poor clinical outcome. Cellular responses to EGFR activation play a critical role in tumor growth and survival, and EGFR overexpression in tumors is associated with metastatic progression.³⁴ Studies demonstrated that EGFR activation stimulated MMP9 production and promoted migration and invasion in ovarian cancer cells.^35-37 In view of these studies, anticancer drugs that are targeted to suppress the expression of EGFR, ErbB2, and/or MMP9 possibly inhibited tumor migration and invasion. It has been reviewed that the OVCA429 ovarian cancer cell line employed in this study expresses both EGFR and ErbB2.³⁸ In our study, EXD significantly inhibited ErbB2 expression in the xenograft model (Figure 6C) but not in the cancer cell model (Figure 4A and B). Besides, EXD significantly inhibited VEGF expression in both models and lowered the migrating and invasive abilities of OVCA429 cells, indicating that EXD played an important role in ovarian cancer metastasis and invasion mainly by targeting VEGF (Figures 4D and 6C).

Vascular endothelial growth factor is a primary mediator of angiogenic responses and is produced at high levels in tumor cells and tumor stroma. High-level expression of VEGF is an independent factor predicting poor prognosis in various malignant tumors.³⁹ Recent preclinical studies demonstrated that VEGF blockade might provide an effective control of primary tumors, as VEGF contributed to cancer progression via enhanced invasiveness and hence metastasis.^40,41 In contrast, our study revealed that EXD not only downregulated VEGF expression in both transcriptional and translational levels in the cellular model (Figures 3, 4D, and 4G) but also functionally inhibited the metastatic and invasive ability of OVCA429 cells (Figure 5A and B). Xenografts with diminished tumor mass after EXD treatment verified that the blockade of VEGF by EXD prevent ovarian cancer progression in both in vitro and in vivo models. VEGF molecules have overlapping abilities to interact with their cell surface receptors, VEGFR2 is considered as the main angiogenic receptor that mediates the growth and permeability actions of VEGF.⁴² However, there were no obvious changes in VEGFR2 expression after EXD treatment (data not shown) suggesting no further induction of VEFGR2 expression on EXD-treated OVCA429 cells.

It has been reported that the ovarian carcinoma mouse model presented evidence that implicated tumor-derived MMP2 and MMP9 in the release of VEGF, suggesting that MMP2 shared some substrate specificity and biochemical modes of activities with MMP9 in the release of VEGF.⁴³ Some recent studies also showed that MMP2 was involved in the processing of several VEGF-binding proteins, proteolytic degradation of which ultimately resulted in the recruitment of VEGF.^44,45 Also the chemical suppression of MMP9 expression resulted in diminished VEGF mobilization to its receptor and reduced the level of VEGF; hence inhibited tumor angiogenesis in cervical and prostate cancer models.^46,47 In addition, MMP7 has been shown to cleave in vitro matrix-bound isoforms of VEGF, releasing it from the matrix as soluble fragments.⁴⁷ Similarly, our study illustrated that EXD significantly suppressed both pro- and active-MMP9 at protein level (Figure 4F and G) leading to the repression of VEGF protein (Figure 4D and G) in OVCA429 cells. Although EXD did not significantly inhibit the expression of pro- and active-MMP9 and MMP2 in xenografts, EXD notably reduced the expression of both MMP7 and VEGF (Figure 6).

Conclusion

This study indicated that EXD attenuated the metastatic and invasive abilities of ovarian cancer in vitro and in vivo through suppression of VEFG, ErbB2, MMP2, MMP7, and MMP9 expression, suggesting that EXD might be a potent therapeutic agent for ovarian cancer. Our study extends the merits of EXD applications in future clinical settings. Further in-depth investigations need to be conducted to ascertain whether EXD with multiple pharmacological effects will offer greater clinical benefits.

Footnotes

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article:

This study was supported in part by a grant from Seed Funding Program for Applied Research, Hong Kong University (Nos. 201102160026, 200907160017 and 200802160025) and the donation of TCM extract from Nong’s Company Limited (Member of PuraPharm International (HK) Ltd).

References

Hildebrand

Gapstur

Feigelson

Teras

Thun

Patel

. Postmenopausal hormone use and incident ovarian cancer: associations differ by regimen. Int J Cancer. 2010;127:2928-2935.

Lacey

Jr Mink

Lubin

. Menopausal hormone replacement therapy and risk of ovarian cancer. JAMA. 2002;288:334-341.

Moorman

Schildkraut

Calingaert

Halabi

Berchuck

. Menopausal hormones and risk of ovarian cancer. Am J Obstet Gynecol. 2005;193:76-82.

Pearce

Chung

Pike

. Increased ovarian cancer risk associated with menopausal estrogen therapy is reduced by adding a progestin. Cancer. 2009;115:531-539.

Qiu

. “Back to the future” for Chinese herbal medicines. Nat Rev Drug Discov. 2007;6:506-507.

Han

Qiao

Song

Lung Cheng

. Chemical markers for the quality control of herbal medicines: an overview. Chin Med. 2008;3:7.

. Erxian tang—introduction of a Chinese herbal formula, clinical practice, and experimental studies. Chin J Integr Med. 2007;13:67-73.

Wang

Zhang

. Treatment of 50 cases of osteoporosis with Er-xian Decoction. Shan Xi Zhong Yi. 1998;19:205.

Committee for the Pharmacopoeia of People’s Republic of China. Pharmacopoeia of the People’s Republic of China. Beijing, China: Chemical Industry Press; 2005.

10.

Wang

Dong

Zhu

. Icariin exerts negative effects on human gastric cancer cell invasion and migration by vasodilator-stimulated phosphoprotein via Rac1 pathway. Eur J Pharmacol. 2010;635:40-48.

11.

Cao

Wang

. A novel polysaccharide, isolated from Angelica sinensis (Oliv.) Diels induces the apoptosis of cervical cancer HeLa cells through an intrinsic apoptotic pathway. Phytomedicine. 2010;17:598-605.

12.

Yan

Lok

Man

Che

. Timosaponin A-III induces autophagy preceding mitochondria-mediated apoptosis in HeLa cancer cells. Cancer Res. 2008;68:10229-10237.

13.

Bao

Pan

Zhang

Gong

. The apoptotic effect of sarsasapogenin from Anemarrhena asphodeloides on HepG2 human hepatoma cells. Cell Biol Int. 2007;31: 887-892.

14.

Beral

Million Women Study

. Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet. 2003;362:419-427.

15.

Beral

Million Women Study

Bull

Green

Reeves

. Ovarian cancer and hormone replacement therapy in the Million Women Study. Lancet. 2007;369:1703-1710.

16.

Hendrix

Wassertheil-Smoller

Johnson

. Effects of conjugated equine estrogen on stroke in the Women’s Health Initiative. Circulation. 2006;113:2425-2434.

17.

Rossouw

Prentice

Manson

. Postmenopausal hormone therapy and risk of cardiovascular disease by age and years since menopause. JAMA. 2007;297:1465-1477.

18.

Zhang

. The samples of effective clinical cases of Er Xian Tang application by professor Wenzhen Huang. Fujian J Tradit Chin Med. 2004;53:19-22.

19.

Dong

Fang

Shi

. Effect of er xian decoction and its subdivisions on granulosa cells secretory function in rats [in Chinese]. Zhongguo Zhong Xi Yi Jie He Za Zhi. 2006;26(suppl):122-125.

20.

Nian

Qin

Zhang

Zheng

Huang

. Antiosteoporotic activity of Er-Xian Decoction, a traditional Chinese herbal formula, in ovariectomized rats. J Ethnopharmacol. 2006;108:96-102.

21.

Sze

Tong

Zhang

. A novel mechanism: Erxian Decoction, a Chinese medicine formula, for relieving menopausal syndrome. J Ethnopharmacol. 2009;123:27-33.

22.

Fortepiani

Zhang

Racusen

Roberts

Reckelhoff

. Characterization of an animal model of postmenopausal hypertension in spontaneously hypertensive rats. Hypertension. 2003;41:640-645.

23.

Liu

Lin

Situ

Liu

Zhou

. Clinical study of chronological dosage regimen of modified Guilu Erxian decoction regulating bone marrow hematopoietic function of the breast cancer patients after chemotherapy. Liaoning J Tradit Chin Med. 2008;35(7).

24.

Shaw

Senterman

Dawson

Crane

Vanderhyden

. Characterization of intraperitoneal, orthotopic, and metastatic xenograft models of human ovarian cancer. Mol Ther. 2004;10:1032-1042.

25.

Sze

SCW

Wong

Liu

. Regulation of p21, MMP-1 and MDR-1 expression in Human colon carcinoma HT29 by Tian Xian Liquid, a Chinese Medicine Formula, in vitro and in vivo. Integr Cancer Ther. 2011;10:58-69.

26.

Geback

Schulz

Koumoutsakos

Detmar

. TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays. Biotechniques. 2009;46:265-274.

27.

Qin

Han

Zhang

. Antiosteoporotic chemical constituents from Er-Xian Decoction, a traditional Chinese herbal formula. J Ethnopharmacol. 2008;118:271-279.

28.

Zhu

Xue

Han

. Antiosteoporotic effects and proteomic characterization of the target and mechanism of an Er-Xian Decoction on osteoblastic UMR-106 and osteoclasts induced from RAW264.7. Molecules. 2010;15:4695-4710.

29.

Townson

Naumov

Chambers

. The role of apoptosis in tumor progression and metastasis. Curr Mol Med. 2003;3:631-642.

30.

Zagouri

Dimopoulos

Bournakis

Papadimitriou

. Molecular markers in epithelial ovarian cancer: their role in prognosis and therapy. Eur J Gynaecol Oncol. 2010;31:268-277.

31.

Mendelsohn

. Antibody-mediated EGF receptor blockade as an anticancer therapy: from the laboratory to the clinic. Cancer Immunol Immunother. 2003;52:342-346.

32.

Olayioye

Neve

Lane

Hynes

. The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J. 2000;19:3159-3167.

33.

Maihle

Baron

Barrette

. EGF/ErbB receptor family in ovarian cancer. Cancer Treat Res. 2002;107:247-258.

34.

Ellerbroek

Hudson

Stack

. Proteinase requirements of epidermal growth factor-induced ovarian cancer cell invasion. Int J Cancer. 1998;78:331-337.

35.

Cowden Dahl

Symowicz

Ning

. Matrix metalloproteinase 9 is a mediator of epidermal growth factor-dependent e-cadherin loss in ovarian carcinoma cells. Cancer Res. 2008;68:4606-4613.

36.

Cowden Dahl

Zeineldin

Hudson

. PEA3 is necessary for optimal epidermal growth factor receptor-stimulated matrix metalloproteinase expression and invasion of ovarian tumor cells. Mol Cancer Res. 2007;5:413-421.

37.

Lafky

Wilken

Baron

Maihle

. Clinical implications of the ErbB/epidermal growth factor (EGF) receptor family and its ligands in ovarian cancer. Biochim Biophys Acta. 2008;1785:232-265.

38.

Schneider

Radovich

Miller

. The role of vascular endothelial growth factor genetic variability in cancer. Clin Cancer Res. 2009;15:5297-5302.

39.

Paez-Ribes

Allen

Hudock

. Antiangiogenic therapy elicits malignant progression of tumors to increased local invasion and distant metastasis. Cancer Cell. 2009;15:220-231.

40.

Ebos

Lee

Cruz-Munoz

Bjarnason

Christensen

Kerbel

. Accelerated metastasis after short-term treatment with a potent inhibitor of tumor angiogenesis. Cancer Cell. 2009;15:232-239.

41.

Kim

Winer

. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature. 1993;362:841-844.

42.

Belotti

Paganoni

Manenti

. Matrix metalloproteinases (MMP9 and MMP2) induce the release of vascular endothelial growth factor (VEGF) by ovarian carcinoma cells: implications for ascites formation. Cancer Res. 2003;63: 5224-5229.

43.

Dean

Butler

Hamma-Kourbali

. Identification of candidate angiogenic inhibitors processed by matrix metalloproteinase 2 (MMP-2) in cell-based proteomic screens: disruption of vascular endothelial growth factor (VEGF)/heparin affin regulatory peptide (pleiotrophin) and VEGF/connective tissue growth factor angiogenic inhibitory complexes by MMP-2 proteolysis. Mol Cell Biol. 2007;27:8454-8465.

44.

Dean

Overall

. Proteomics discovery of metalloproteinase substrates in the cellular context by iTRAQ labeling reveals a diverse MMP-2 substrate degradome. Mol Cell Proteomics. 2007;6:611-623.

45.

Giraudo

Inoue

Hanahan

. An amino-bisphosphonate targets MMP-9-expressing macrophages and angiogenesis to impair cervical carcinogenesis. J Clin Invest. 2004;114:623-633.

46.

Kong

Wang

Banerjee

Sarkar

. Inhibition of angiogenesis and invasion by 3,3′-diindolylmethane is mediated by the nuclear factor-kappaB downstream target genes MMP-9 and uPA that regulated bioavailability of vascular endothelial growth factor in prostate cancer. Cancer Res. 2007; 67:3310-3319.

47.

Lee

Jilani

Nikolova

Carpizo

Iruela-Arispe

. Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol. 2005;169:681-691.

An In Vitro and In Vivo Investigation of the Antimetastatic Effects of a Chinese Medicinal Decoction,Erxian Decoction,on Human Ovarian Cancer Models

Abstract

Keywords

Introduction

Methods

Drug Preparation

Cell Line and Culture

Ovarian Cancer Xenograft Model

Cell Proliferative Assay by MTT Assay

Cell Cycle Analysis by Flow Cytometry

Determination of EXD-Mediated Metastatic Markers at Transcriptional Level

Western Blotting Analysis

In Vitro Migration Assay

In Vitro Invasion Assay

Statistical Analysis

Results

Antiproliferative Effect of EXD on Ovarian Cancer Cells

EXD-Mediated S-Phase Arrest and Apoptotic Cell Death in OVCA429 Cells

EXD-Modulated Expression of Metastatic Markers in OVCA429 Cells

Erxian Decoction Functionally Inhibited Migrating and Invasive Ability of OVCA429 Cells

Erxian Decoction Suppressed Ovarian Cancer Growth and Metastatic Protein Expression in Xenografts

Discussion

Conclusion

Footnotes

Declaration of Conflicting Interests

Funding

References