Abstract
Introduction
According to global cancer statistics from the International Agency for Research on Cancer (IARC), which is part of the World Health Organization (WHO), approximately 1.85 million new cases of colon, rectal, and anal malignancies (“colorectal cancer”, or CRC, for short) were diagnosed in 2018 worldwide, ranking third on the spectrum of malignant tumors. The mortality of CRC ranks second among all malignant tumors, as it is estimated to have caused 880 000 deaths. 1 Over the past 10 years, the incidence and mortality of CRC have continually increased in China, thus causing a prominent problem that endangers the health of the population. 2 The prognosis of patients with CRC is not ideal, and new treatment regimens are urgently needed. Molecular targeted therapies have become a new trend in CRC due to their advantages of high efficiency and low toxicity. Therefore, elucidation of the molecular mechanisms underlying the occurrence and development of CRC and identification of new biomarkers for new targeted therapies are expected to benefit patients who are ineligible for radical surgery.
The forkhead box (FOX) transcription factor family was first discovered in fruit flies 3 and is now divided into 19 subfamilies, namely, FOXA-FOXS. 4 The most distinctive feature of their structure is the FOX DNA-binding domain, which is composed of more than 100 conserved amino acid sequences. 5 The FOX gene family mediates a variety of biological functions, such as DNA damage repair, embryonic development, the cell cycle, and some metabolic balance regulation,6,7 suggesting its involvement in the complex processes of tumorigenesis. Forkhead box transcription factor F2 (FOXF2) protein, a member of the FOX transcription factor family, contains 444 amino acid residues and is located on chromosome 6p25.3 in humans. FOXF2 is mainly expressed in the epithelial–mesenchymal cells of the respiratory tract, digestive tract, urinary tract, and other organs and is involved in extracellular matrix synthesis, mutual transformation between the epithelium and mesenchymal tract, and embryonic and tissue development.8–10 FOXF2 is correlated with tumor progression, metastasis of breast cancer,11,12 lung cancer,13–15 hepatocellular carcinoma (HCC),16,17 colorectal cancer (CRC),18–22 prostate cancer (PC),23–25 gastric cancer (GC),26,27 oral cancer, 28 ovarian cancer (OC), 29 mouse rhabdomyosarcoma, 30 bladder cancer, 31 and esophageal squamous cell carcinoma. 32 FOXF2 has shown inhibitory effects in most tumors, such as liver cancer16,17 and prostate cancer, 25 and shown tumor-promoting effects in lung cancer 14 and mouse rhabdomyosarcoma. 30 However, FOXF2 plays either an inhibitory or promotional role in breast cancer.11,12,33,34 FOXF2 was downregulated in 76.0% of CRC samples and could be a potential diagnostic biomarker in CRC. 18 However, the mechanism underlying the effect of FOXF2 on CRC development is still unclear.
PRUNE2 (prune homolog 2, Drosophila) encodes a 340-kDa protein that has a conserved BNIP-2 and Cdc42GAP homology (BCH) scaffold domain at its C-terminus. 35 PRUNE2 is a specific prognostic gene in neuroblastoma and plays an important role in regulating the differentiation, proliferation, and invasion of neuroblastoma cells. 36 PRUNE2 plays an important role in regulating the growth of tumors, such as leiomyosarcoma, 37 oral cancer, 38 prostate cancer39,40 and neuroblastoma. 41 Our previous study found that the expression of PRUNE2 was significantly reduced in CRC patients, and the survival prognosis of patients with low expression of PRUNE2 was poor. Overexpression of PRUNE2 significantly inhibited the proliferation, migration, and invasion of CRC cells and significantly inhibited the growth of CRC cells in nude mice, suggesting that PRUNE2 inhibits the growth of CRC in vivo and in vitro. 42 However, the association between FOXF2 and PRUNE2 expression in CRC is poorly understood.
In this study, we investigated the expression of FOXF2 in CRC using human CRC tissue samples and cell lines and then assessed the effect of FOXF2 upregulation on CRC in vitro and in vivo. Furthermore, for the first time, we investigated the transcriptional regulatory relationship between FOXF2 and PRUNE2 in CRC cells and the underlying regulatory mechanism. Our data indicated that FOXF2 upregulation inhibited the proliferation and invasion of CRC in vivo and in vitro. FOXF2 was shown to bind the promoter region of PRUNE2 and regulate its transcription, thereby affecting the pathogenesis of CRC.
Materials and Methods
Gene Expression Analyses and Tissue Specimens Collection
FOXF2 mRNA expression levels were analyzed using data from The Cancer Genome Atlas (TCGA). 43 In total, 35 CRC tissue specimens and 11 adjacent tissue sections were collected from the Department of Gastroenterology at the First People's Hospital of Yunnan Province for quantitative polymerase chain reaction (qPCR), immunohistochemistry (IHC) and Western blot analyses. This study was approved by the Medical Ethics Committee of the First People's Hospital of Yunnan Province (no. KHLL2021-KY130), and written consent was obtained from all participants.
Immunohistochemistry
Tissues were routinely paraffin-embedded, sliced into 4-μm-thick sections, and then subjected to xylene dewaxing and gradient alcohol (100%, 95%, 90%, 80%, and 70% ethanol) rehydration. The slides were washed 3 times with phosphate-buffered saline (PBS; P1020; Solarbio), boiled in sodium citrate antigen retrieval solution (C1031; Solarbio, Beijing, China) at 95 °C to 100 °C in a pressure cooker for 10 min, and then immersed in 3% hydrogen peroxide for 15 min to block endogenous peroxidase. Then, the slides were blocked with 5% goat serum (SL038; Solarbio) for 15 min at room temperature. Subsequently, the slides were incubated with primary antibodies against FOXF2 (1:1000; CSB-PA027320; CUSABIO) and PRUNE2 (1:100; 11458-1-AP; ProteinTech) at 4 °C overnight. The slides were washed 3 times with PBS and then incubated with an HRP goat antirabbit IgG secondary antibody (1:200; cat. no. AS014; ABclonal) for 1 h at room temperature. They were then stained with 3,3-diaminobenzidine (DAB, DA1015; Solarbio), counterstained with hematoxylin (G1140; Solarbio) for 5 min at room temperature and mounted with neutral gum after dehydration. 44 All slides were observed by a blinded investigator under a light microscope. Brown staining indicated immunoreactive (positive) cells; blue staining indicated nuclei. Positive expression was quantified using ImageJ 2× software (National Institutes of Health).
Cell Culture
Human CRC cell lines [SW620 (CCL-227), SW480 (CCL-228), HT29 (HTB-38), HCT116 (CCL-247), LOVO (CCL-229), DLD-1 (CCL-221)] and normal colorectal mucosa cells (FHC; CRL-1831) were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). All cells were maintained in high-glucose Dulbecco's Modified Eagle's medium (DMEM, C11995500BT; Gibco) supplemented with 10% fetal bovine serum (FBS; 10270-106; Gibco) and antibiotics (03-031-1B; Biological Industries). All cells were cultured in a humidified incubator at 37 °C with 5% CO2.
Plasmids, Small Interfering RNA, and Transfection
The full-length coding region of FOXF2 cDNA was amplified by PCR from normal human cells, inserted into the mammalian expression vector pcDNA3.1, and then confirmed by sequencing. A small interfering RNA (siRNA) targeting human PRUNE2 (siPRUNE2; GGGCCAGAATATCGATGAATT) and a nontargeting siRNA control (siControl; UUCUCCGAACGUGUCACGUTT) were synthesized by GenePharma Company. Transient transfection of the plasmids or siRNAs into cells was performed using Lipofectamine 2000 (11668-019; Invitrogen) according to the manufacturer's protocol. For cell transfection, 1 × 105 cells were plated in a 6-well plate at 37 °C overnight. Then, 100 pmol of siPRUNE2 or NC siRNA or 2 μg of pcDNA3.1-FOXF2 or empty pcDNA3.1 vector and 15 μL of Lipofectamine were incubated at room temperature for 20 min. The mixtures were transfected into cells for 48 h. The efficiency of transfection was determined by Western blot.
Dual-Luciferase Reporter Assay
To detect the potential sites at which FOXF2 may bind to the promoter region of PRUNE2, the luciferase reporter vector pGL3-basic (Promega) was used to construct PRUNE2 promoter reporters (pPRUNE2 #1, pPRUNE2 #2, pPRUNE2 #3, and pPRUNE2 #4). PRUNE2 promoter regions (from −2000 to 151, −1800 to 151, −1649 to 151, and −1000 to 151) in relation to the transcription start site (TSS) were synthesized by GenePharma. The PCR products were then inserted into the pGL3-basic vector. HT29 cells were plated in 12-well plates at a density of 5 × 104 cells/well and cultured without antibiotics for 24 h. The cells were then cotransfected with pGL3-PRUNE2 and pcDNA3.1-FOXF2 as well as with the pcDNA3.1 vector as mentioned above. After 48 h, the luciferase activity was measured using the Dual-Luciferase Reporter Assay System (E1910; Promega). Luciferase activity was normalized to that of Renilla, and the experiments were performed in triplicate.
Quantitative Real-Time PCR Assay
Total RNA was extracted using TRIzol (1596-026; Invitrogen) according to the manufacturer's instructions. A RevertAid First Strand cDNA Synthesis Kit (K1622; Fermentas) was used to reverse transcribe the RNA into cDNA in accordance with the manufacturer's protocol, and qPCR was performed by using THERMO Maxima SYBR Green/ROX qPCR Master Mix (K0223; Thermo) according to the manufacturer's instructions as follows: 95 °C for 3 min; followed by 40 cycles of 95 °C for 10 s and 60 °C for 60 s All samples were normalized to β-actin, and all experiments were performed in triplicate. The mean value of each triplicate was used to calculate the relative mRNA expression levels using the 2−ΔΔCT method. 45 The following primer sequences were synthesized by Sangon Biotech as follows: FOXF2-forward: 5′-TACCAGCATCACTCTACTC-3′, FOXF2-reverse: 5′-ATCCGTCCCAGTTTCTATC-3′; PRUNE2-forward: 5′-GGGTCTTCTGGGATTATGG-3′, PRUNE2-reverse: 5′-CTGGGCTAACAAGGTCTAC-3′, and β-actin-forward: 5′-CATCGTCCACCGCAAATGCTTC-3′, β-actin-reverse: 5′-AACCGACTGCTGTCACCTTCAC-3′.
Western Blot Assay
Total proteins were extracted from tissues and cells with RIPA lysis buffer (R0020; Solarbio), and then quantified by a BCA Protein Assay Kit (PC0020; Solarbio) according to the manufacturer's protocol. A total of 30 μg of protein per lane was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for 120 min at 120 V before being transferred onto polyvinylidene difluoride (PVDF) membranes (IPVH00010; Millipore). Subsequently, the membranes were blocked with 5% skim milk for 2 h at room temperature and then incubated with a specific primary antibody targeting FOXF2 (1:1000; CSB-PA027320; CUSABIO), PRUNE2 (1:1000; 11458-1-AP; ProteinTech), or β-actin (1:2000; ab8227; Abcam) overnight at 4 °C. The membranes were then incubated with HRP-conjugated goat antirabbit antibodies (1:2000; A0208, Beyotime), and β-actin was used as the loading control. The bands were developed using a ChemiDoc XRS+ Imaging System (Bio-Rad) and Immobilon Western Chemiluminescent HRP Substrate (WBKLS0100; Millipore Fontenay-Sous-Bois). The band densities of specific proteins were quantified using ImageJ 2× software (National Institutes of Health).
CCK-8 Assay
Briefly, 10000 cells were seeded into each well of a 96-well plate. After incubation at 37 °C for 24 h, the cells were transfected with pcDNA3.1-FOXF2 or/and PRUNE2 siRNA for 48 h, 10 μL of CCK-8 solution (CP002; SAB) was added to each well, and the cells were incubated at 37 °C for 2 h. The absorbance was measured at 450 nm using a microplate reader (DNM-9602; PERLONG).
Colony Formation Assay
Cells were plated in a 10-mm culture dish at a density of 700 cells/well and cultured at 37 °C for 24 h in an incubator. The next day, the cells were transfected with pcDNA3.1-FOXF2 or/and PRUNE2 siRNA for 48 h and further cultured for 7 days. The medium was replaced with fresh medium every 3 days. Finally, the cells were washed with PBS 3 times and stained with 0.5% crystal violet (C8470; Solarbio) for 15 min at room temperature; colonies with more than 50 cells were counted in the entire well.
Cell Invasion Assay
Cell invasion in vitro was assessed using Matrigel-coated 8-μm Transwell (BD Biosciences). Briefly, 200 μL of cells (4 × 105 cells/mL) was added to the upper Transwell chamber, and 700 μL of complete medium was added to the lower Transwell chamber. After transfection for 48 h, the cells were fixed with 4% formaldehyde for 10 min at room temperature, and the invaded cells were then stained with 0.5% crystal violet (C8470; Solarbio) for 30 min at room temperature. The number of invading cells on the lower membrane surface was counted under a microscope in 5 predetermined fields for each membrane at 200× magnification.
Cell Cycle Assay
After transfection for 48 h, 1 × 105 cells were harvested and resuspended in 1 mL of 70% ethanol overnight at 4 °C. Then, the cells were incubated in 100 μL of RNase A solution (1 mg/mL; R8020-25; Solarbio) in the dark at 37 °C for 30 min and then with 400 μL of propidium iodide (PI) solution (50 μg/mL; C001-200; 7Sea Biotech) in the dark at room temperature for 10 min. The cell cycle was detected on a flow cytometer (Accuri C6) according to the manufacturer's instructions. BD Accuri C6 plus software (3.1.1.0; BD Biosciences) was used for analysis. Red fluorescence was detected at an excitation wavelength of 488 nm, corresponding to the BD Biosciences flow cytometry FL2 detection channel.
Cell Apoptosis Assay
Cell apoptosis was detected using an annexin V-APC/PI dual staining kit (E-CK-A151; Elabscience). After transfection for 48 h, 1 × 105 cells were harvested and resuspended in 195 μL of annexin V-APC binding buffer. Then, 5 μL of annexin V-APC staining solution was added to the cells in the dark at 4 °C for 15 min, followed by the addition of 5 μL of PI staining solution in the dark at 4 °C for 5 min. Apoptosis was detected on a flow cytometer (Accuri C6) according to the manufacturer's instructions. BD Accuri C6 plus software (3.1.1.0; BD Biosciences) was used for analysis. The percentage of apoptotic cells was calculated as the sum of the percentage of early apoptotic cells and late apoptotic cells.
Xenograft Tumor Assay
Twelve female BALB/c nude mice (weight, 18 ± 2 g; age, 6-8 weeks; Charles River Laboratories, Inc.) were reared in a sterile environment at 21 °C to 25 °C with 40% to 70% humidity and a 12/12-h light/dark cycle for one week. The animal study was approved by the Ethics Committee of Shanghai Genechem Co., Ltd (no. GSZE0260446) on December 15, 2020, and performed in compliance with Chinese national guidelines for the care and use of animals. HT29 cells were infected with the pGV492 vector lentivirus (KL2117-2; Genechem) and FOXF2 overexpression lentivirus (44482-2; Genechem). After 48 h of infection, the cells were trypsinized with 0.25% trypsin (25200056; Gibco, California, USA) and subcultured. Following cell adherence, puromycin (cat. no. P8230; Beijing Solarbio Science & Technology Co., Ltd) was added at 5 μg/mL to screen the cells, and the solution was replaced with complete DMEM supplemented medium with 5 μg/mL puromycin every 2 to 3 days. After 1 week, the cells were cultured in complete medium containing 2 μg/mL puromycin. qPCR was performed to verify the expression levels of FOXF2 in the screened FOXF2 overexpressing HT29 and vector-HT29 cells (data not shown). The successfully screened cell lines were named FOXF2 and Vector. In total 1 × 107 vector or FOXF2 cells in 0.1 mL of PBS were subcutaneously injected into the dorsal side of the right hind limb. The mice were randomly divided into 2 groups for the xenograft tumor assay: the Vector group and the FOXF2 group (n = 6/per group). After 13 days, all mice were anesthetized with pentobarbital sodium (50 mg/kg) by intraperitoneal injection, and the fluorescence at the cell inoculation sites was then observed using an IVIS Spectrum In Vivo Bioluminescence imaging system (Lumina LT; PerkinElmer). The living image data are expressed as the total radiant efficiency [p/s]/[μW/cm2]. A Vernier caliper was used to measure the long (L) and short (W) diameters of subcutaneous tumors at 6, 8, 10, 12, and 13 days after injection. Tumor volume was calculated according to the following formula: 3.14/6 × L × W2. At 13 days, all nude mice were euthanized by an intraperitoneal injection of pentobarbital sodium (150 mg/kg) followed by cervical dislocation to remove the subcutaneous tumors. The tissues were paraffin-embedded, sectioned, and subjected to IHC staining.
Statistical Analysis
Data are presented as the mean ± standard deviation (SD). All experiments were conducted in triplicate, and all results were analyzed using GraphPad Prism 5.0 software (GraphPad Software, Inc). Differences between 2 groups were analyzed by unpaired Student t test, while those among multiple groups were compared by one-way ANOVA (post hoc test). Pearson's correlation coefficient was used to determine the correlation between FOXF2 and PRUNE2 mRNA expression in CRC tissues. P < .05 was considered to be significant.
Results
FOXF2 Expression Is Decreased in CRC Tissues
Statistical analysis of mRNA expression data from TCGA showed that FOXF2 was expressed at low levels in CRC compared to normal tissues (Figure 1A; P < .05). IHC analysis also revealed significantly fewer FOXF2-positive cells in CRC tissues than in adjacent tissues (Figure 1B; P < .001). In addition, the FOXF2 protein levels were significantly decreased in CRC tissues compared with adjacent tissues (Figure 1C; P < .001). Furthermore, FOXF2 expression was also assessed in human normal colorectal mucosa cells (FHC) and 6 CRC cell lines (SW620, SW480, HT29, HCT116, LOVO, DLD-1) by Western blot. As shown in Figure 1D, consistent with the results obtained with the tissue samples, FOXF2 expression was significantly decreased (P < .001) in the 6 CRC cell lines.

FOXF2 expression in CRC tissues and cell lines. (A) The expression levels of FOXF2 were analyzed in CRC tissues and normal tissues from the TCGA database. (B) FOXF2 expression in tumorous (n = 8) and peritumorous tissues (n = 8) was analyzed by IHC (magnification at 400×, left). Scale bar = 50 μm. Quantification of FOXF2 expression using ImageJ software (right). (C) Western blot analysis was performed to detect FOXF2 expression in tumor (n = 3) and peritumorous tissues (n = 3). (D) FOXF2 expression in different cell lines was analyzed by Western blot. Three independent assays were performed in triplicate. The data are expressed as the mean ± SD. ***P < .001.
FOXF2 Overexpression Inhibits CRC Cell Proliferation and Invasion and Induces Apoptosis in Vitro
To investigate the effects of FOXF2 on CRC cell proliferation, invasion, and apoptosis, pcDNA3.1-FOXF2 was transfected into SW620 and HT29 cells to upregulate FOXF2 expression. The effects of pcDNA3.1-FOXF2 transfection on FOXF2 expression were confirmed by Western blot. The FOXF2 protein levels in both SW620 and HT29 cells transfected with pcDNA3.1-FOXF2 were obviously reduced (P < .01 and P < .05, respectively) compared with those in the vector-transfected cells (Figure 2A). The Cell Counting Kit-8 (CCK-8) results revealed that FOXF2 overexpression suppressed the proliferation of the 2 cell lines (Figure 2B; P < .001). Transwell assays showed that FOXF2 overexpression significantly inhibited the invasion of the 2 cell lines (Figure 2C; P < .001). Furthermore, FOXF2 overexpression significantly decreased the number of cell colonies (Figure 2D; P < .001). Flow cytometry analysis showed that the upregulation of FOXF2 arrested CRC cells at the G0/G1 stage (Figure 2E; P < .001) and induced apoptosis in the 2 cell lines (Figure 2F; P < .001 and P < .01, respectively).

FOXF2 overexpression suppresses CRC cell proliferation, invasion, and apoptosis in vitro. (A) Western blot was performed to verify the overexpression of FOXF2 in SW620 and HT29 cells transfected with pcDNA3.1-FOXF2. (B) The viability of CRC cells was detected by the Cell Counting Kit-8 (CCK-8) assay. (C) Representative images of the Transwell assay are shown. Magnification, 200×. The number of invaded cells was counted. (D) Colony formation of CRC cells as determined by staining with crystal violet. The number of stained colonies in CRC cells was counted. (E) Flow cytometry analysis of cell cycle progression. The quantified results of the cell cycle distribution are shown. (F) The apoptosis of CRC cells was detected by flow cytometry with an annexin V-APC/PI double staining kit. The apoptotic cell percentages are shown in the top right and bottom right quadrants. Three independent assays were performed in triplicate. The data are expressed as the mean ± SD. *P < .05; **P < .01; ***P < .001.
FOXF2 Binds to the PRUNE2 Promoter and Promotes Its Transcription
The role of FOXF2 in CRC progression was consistent with that of PRUNE2 revealed in our previous study. To investigate whether PRUNE2 is a transcriptional target of FOXF2, we analyzed the FOXF2 binding sites in the promoter region of the PRUNE2 gene using an online tool (http://jaspar2016.genereg.net/). Seventeen putative FOXF2 binding sites were identified in the FOXF2 promoter region at −2000 to +151, −1800 to +151, −1649 to +151, and −1000 to +151 bp (Figure 3A). Subsequently, we constructed 4 PRUNE2 promoter luciferase reporter constructs (pPRUNE2 #1-4) containing sequential deletions of the candidate FOXF2 binding sites, as shown in Figure 3B, and then performed a dual-luciferase reporter assay in HT29 cells cotransfected with pGL3-PRUNE2 and pcDNA3.1-FOXF2 or the pcDNA3.1 vector. The relative luciferase activity of pPRUNE2 #2, containing the S7-S14 binding sites in HT29 cells, was higher than those of pPRUNE2 #1 and other vectors lacking these sites. The overexpression of FOXF2 significantly enhanced the relative luciferase activity of pPRUNE2 #2, containing S7-S14 binding sites, compared with that in the vector group (Figure 3B; P < .001), suggesting that FOXF2 mainly activates the PRUNE2 promoter by directly binding to the S7 to S14 regions. Furthermore, the ability of FOXF2 to positively regulate PRUNE2 protein expression was confirmed by the overexpression of FOXF2 in SW620 and HT29 cells, as determined by Western blot (Figure 3C). Furthermore, we also detected the mRNA levels of FOXF2 and PRUNE2 in 24 human CRC tissues by qPCR. Consistent with the positive regulatory effects of FOXF2 on the transcription of PRUNE2, the PRUNE2 mRNA levels were similarly correlated with those of FOXF2 in CRC (Pearson's r = 0.6225, P = .0012; Figure 3D).

FOXF2 positively regulates PRUNE2 expression by targeting and activating the FOXF2 promoter. (A) Schematic of the putative binding sites of FOXF2 on the PRUNE2 promoter region. (B) The transcriptional activity of the PRUNE2 promoter in HT29 cells was assessed by the dual-luciferase reporter assay. (C) The protein levels of PRUNE2 in the 2 cell lines were detected by Western blot. (D) FOXF2 and PRUNE2 mRNA levels were positively correlated in human CRC tissues (n = 24; Pearson's correlation r = 0.6225, P = .0012). Three independent assays were performed in triplicate. The data are expressed as the mean ± SD. *P < .05; **P < .01; ***P < .001.
PRUNE2 Mediates the FOXF2-Regulated Suppression of CRC Aggressiveness
To further investigate whether PRUNE2 mediates the ability of FOXF2 deficiency to induce the proliferation and invasion of CRC cells, SW620 and HT29 cells were cotransfected with pcDNA3.1-FOXF2 (FOXF2) and PRUNE2 siRNAs (siPRUNE2) or their controls and then subjected to CCK-8, colony formation, Transwell, and flow cytometry assays. As shown in Figure 4, downregulation of PRUNE2 partially reversed the FOXF2 overexpression-induced inhibition of cell proliferation (Figure 4A; P < .01 and P < .001, respectively), invasion (Figure 4B; both P < .001), and cell colony numbers (Figure 4C; P < .001 and P < .01, respectively). Flow cytometry analysis showed that downregulation of PRUNE2 promoted cell cycle progression, which was arrested by FOXF2 overexpression (Figure 4D). In addition, downregulation of PRUNE2 inhibited the increase in cell apoptosis induced by FOXF2 overexpression (Figure 4E; P < .001 and P < .01, respectively).

FOXF2 overexpression inhibits CRC proliferation and invasion by upregulating PRUNE2 transcription. (A) The proliferation of SW620 and HT29 cells was detected by Cell Counting Kit-8 (CCK-8) assays. (B) Images and numbers of invaded SW620 and HT29 cells as determined by the Transwell assay (×200). (C) The growth of SW620 and HT29 cells was assessed by the colony formation assay. (D) Flow cytometry analysis of cell cycle progression. The quantified results of the cell cycle distribution are shown. (E) The apoptosis of CRC cells was detected by flow cytometry with an annexin V-APC/PI double staining kit. Three independent assays were performed in triplicate. The data are expressed as the mean ± SD. *P < .05; **P < .01; ***P < .001 versus the Vector + siControl group, #P < .05; ##P < .01; ###P < .001 versus the FOXF2 + siControl group.
FOXF2 Overexpression Suppresses the Aggressiveness of CRC in BALB/c Mice in Vivo
To further confirm the effects of FOXF2 on the growth of CRC cells in vivo, HT29 cells infected with a negative control lentivirus or LV-GFP-FOXF2 were injected into the dorsal sides of the right hind limbs of female nude mice. Visible tumor nodules were observed in the mice of the 2 groups (Figure 5A), and the tumors of mice injected with LV-GFP-FOXF2 cells (FOXF2 group) were smaller than those of mice injected with the negative control lentivirus cells (Vector group) by day 13 after injection. The tumors in the FOXF2 group weighed less than those in the Vector group (P < .001), while the volumes of xenograft tumors in mice of the FOXF2 group were smaller than those of mice from the Vector group (Figure 5B; P < .001). On day 13 postinjection, in vivo bioluminescent imaging was performed to monitor growth using an in vivo bioluminescence imaging system. The bioluminescence imaging analysis revealed significantly less local invasion in the FOXF2 group than in the Vector group (Figure 5C; P < .01). IHC staining confirmed that the levels of FOXF2 and PRUNE2 were increased in the xenograft tumors of mice overexpressing FOXF2 (Figure 5D, both P < .001).

FOXF2 overexpression suppresses CRC cell growth in vivo. (A) Representative images of mice with xenograft tumors comprised of LV-GFP-FOXF2 cells or negative control cells on day 13 after the injection. (B) The weights of the xenograft tumors (n = 6) were measured on day 13 after the injection (left). The volumes of the xenograft tumors (n = 6) at the indicated time points are shown (right). (C) Bioluminescence images of the xenograft tumors of mice (n = 6) on day 13 after injection (left) and bioluminescence quantification of the whole body (right). (D) FOXF2 and PRUNE2 expression in xenograft tumor tissues were detected by immunohistochemistry (×400, left). Scale bar = 50 μm. Quantification of FOXF2 and PRUNE2 expression using ImageJ software (right). Three independent assays were performed in triplicate. The data are expressed as the mean ± SD. *P < .05; **P < .01; ***P < .001.
Discussion
Therapies for CRC patients have been developed and evolved due to a better understanding of advances in the field of oncogenesis and genetics; however, even with these advances, there is still a lack of new biomarkers to guide early diagnosis, targeted therapy, prognosis, and monitoring of CRC patients. Therefore, we believe that the discovery and identification of novel genes with antiproliferative effects in CRC can provide potential molecular markers for the diagnosis, prediction, and prognosis of CRC.
The FOX transcription factor family, which contains a conserved DNA-binding domain with a winged helix structure, plays crucial roles in cell proliferation, apoptosis, the cell cycle, signal transduction, and tumorigenesis. 46 Many FOX transcription factor subfamilies are importantly associated with the biological characteristics of CRC. FOXA1 expression was significantly increased in CRC, and its knockdown reduced proliferation, migration, and invasion and induced G2/M phase arrest in HCT116 and SW480 cells. 47 Gain-of-function assays of FOXF2 showed that high FOXF2 overexpression suppressed proliferation and invasion, and induced G0/G1 phase arrest and apoptosis in SW620 and HT29 cells, suggesting that FOXF2 helps to control the proliferation of CRC cells and inhibit their growth. FOXD3 is downregulated in CRC samples and can be regarded as a potential diagnostic biomarker in CRC. 18 FOXK1 is highly expressed in CRC, and its overexpression promotes CRC cell malignancy by stimulating their proliferation and reducing their apoptosis. 48 FOXQ1 plays critical roles in the malignancy and progression of CRC. 49 Therefore, each FOX member plays a different role in the development of CRC.
Previous studies have demonstrated that the expression of FOXF2 is decreased in CRC and that its upregulation can inhibit CRC progression,18–20,22 indicating that FOXF2 dysregulation is also correlated with CRC development. In our study, FOXF2 expression was significantly decreased in CRC samples and cell lines, and FOXF2 overexpression reduced proliferation, migration, and invasion and induced G0/G1 phase arrest in SW620 and HT29 cells. Our results indicated that FOXF2 can be regarded as a potential diagnostic biomarker in CRC. FOXF2 was downregulated in CRC and can be regarded as a potential diagnostic biomarker in CRC. 18 Our results are consistent with those of the abovementioned previous study. Together, these results indicate that FOXF2 promotes cell proliferation and plays a role in the pathogenesis and development of CRC. In vivo, FOXF2 overexpression significantly inhibited tumor growth in a xenograft tumor mouse assay. In vitro, FOXF2 overexpression inhibited the growth and invasion of CRC cells and promoted cell apoptosis. However, the mechanism by which FOXF2 regulates the development and progression of CRC remains unclear.
The FOX transcription factor family is encoded by the FOX gene, which mediates gene transcription and follow-up functions during physiological and pathological processes. 50 FOXF2 manipulates downstream pathways and targets as both a pro-oncogenic and anti-oncogenic factor across different types of cancer, suggesting that it can serve as a new clinical marker or therapeutic target for cancer. However, the biological functions and specific roles of FOXF2 in cancer development remain unclear. FOXF2, as a tumor suppressor, can inhibit the Wnt/β-catenin pathway,26,51 the CDK2-RB-E2F cascade signaling pathway, 52 and the VEGF-C/VEGFR3 signaling pathway 53 to reduce cell growth and induce apoptosis. However, other unknown regulatory signals may exist that are involved in the function of FOXF2. Analysis of data from TCGA revealed that FOXF2 expression was markedly decreased in CRC, indicating that low FOXF2 expression is involved in the aggressive behavior of CRC. Interestingly, we previously demonstrated that PRUNE2 has the same functions as FOXF2 in CRC, and the survival prognosis of patients with low expression of PRUNE2 was poor. 42 Thus, we speculated that FOXF2 may regulate PRUNE2 and that this regulatory correlation may play an important role in CRC. Herein, we identified PRUNE2 as a novel transcriptional target of FOXF2 and demonstrated that FOXF2 regulated the proliferation and progression of CRC by positively regulating PRUNE2 transcription. From the dual-luciferase reporter assay, FOXF2 upregulation significantly enhanced the luciferase activity of pPRUNE2 #2 compared with that in the control cells and cells transfected with the other pPRUNE2 constructs (#1, #3, #4), suggesting that FOXF2 activates the PRUNE2 promoter by mainly binding to the S7-S14 regions. However, the luciferase activity induced by pPRUNE2 #1 (containing both S1-S6 and S7-S14 binding sites) was much lower than that induced by pPRUNE2 #2, indicating the potential existence of other regulators that can bind sites S1-S6 of the PRUNE2 promoter and thereby suppress its promoter activity, which needs to be further evaluated. These data demonstrate that PRUNE2 is a downstream target of FOXF2 and that FOXF2 directly targets the PRUNE2 promoter and promotes its expression in CRC cells.
PRUNE2 is reported to regulate the differentiation, proliferation, and invasion of neuroblastoma tumor cells, and increased expression of PRUNE2 is associated with favorable prognosis in human patients with neuroblastomas. 36 A previous study demonstrated that PRUNE2 decreased cell survival, proliferation, invasion, and tumorigenicity and promoted apoptosis, suggesting that PRUNE2 functions as a tumor-suppressive gene in CRC. 42 However, the role of PRUNE2 and its mechanism in CRC are still unclear. Taking the above into consideration, we assumed that PRUEN2 mediates the inhibitory function of FOXF2 in the development and pathogenesis of CRC. To prove the above hypothesis, we downregulated the expression of PRUNE2 in pcDNA3.1-FOXF2-transfected CRC cells. Downregulation of PRUNE2 rescued the decreased proliferation and invasion of CRC cells induced by FOXF2 overexpression. Moreover, downregulation of PRUNE2 inhibited CRC cell apoptosis and promoted cell cycle progression, which were accelerated and arrested by FOXF2 overexpression, respectively. IHC analysis of xenograft tumors showed that both FOXF2 and PRUNE2 were upregulated in the xenograft tumors of FOXF2-overexpressing mice compared with mice treated with the negative control vector. These results suggest that PRUNE2 mediates the FOXF2-regulated aggressive properties of CRC cells. However, downstream signaling pathways are activated by FOXF2 regulating PRUNE2 during the development of CRC remains unknown and requires further research.
Conclusion
In conclusion, we indicated that FOXF2 was involved in the pathogenesis of CRC in vitro and in vivo. PRUNE2, as a transcriptional target of FOXF2, at least partially mediates the functions of FOXF2 in CRC. Overexpression of FOXF2 suppresses the proliferation and invasion of CRC by positively regulating PRUNE2 expression. Moreover, the mRNA levels of FOXF2 and PRUNE2 are positively correlated with CRC. The FOXF2 mRNA level, particularly in combination with the PRUNE2 mRNA level, may serve as a prognostic marker for CRC patients. Based on these findings, we speculate that the FOXF2-PRUNE2 transcriptional regulation axis can serve as a candidate therapeutic target for aggressive CRC in future clinical research.
Footnotes
Abbreviation
Authors’ Note
The study was approved by the Ethics Committee of the First People's Hospital of Yunnan Province (no. KHLL2021-KY130). All the patients who enrolled in this research had signed the written informed consent voluntarily. Animal experiments were performed under a project license (no. GSZE0260446) granted by the Ethics Committee of Shanghai Genechem Co., Ltd, in compliance with Chinese national guidelines for the care and use of animals.
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Joint Foundation of Kunming Medical University and Yunnan Provincial Science and Technology Department, Yunnan Health Training Project of High Level Talents, National Natural Science Foundation of China, the Clinical Medical Center of Yunnan Provincial Health Commission, Internal Division of Yunnan Provincial Health Commission (grant number 202001AY070001-114, 2019FE001-121, H-2018039, 81860522, 2020LCZXKF-XH03, 2018NS0263).
