Sage Journals: Discover world-class research

Abstract

Various members of the enteric bacteria in recent times are evolving diverse survival mechanisms for antibiotic therapy resulting in failure of treatment in infection and disease cases. The Enterococcus species are potential strains implicated in gastrointestinal tract infection and are recently evolving in the resistance mechanism. The study evaluates the occurrence of New Delhi Metallo-beta-lactamase 1 (NDM-1) amongst Enterococcus species using the phenotypic and genomic characterization of environmental strains in the Oghara water nexus. Presumptive isolates of Enterococcus species were retrieved from various sampled water sources and confirmed using polymerase chain reaction (PCR). Antibiotic susceptibility testing was conducted on confirmed isolates using Kirby-Bauer disk diffusion methods. The result reveals 63 genus isolates confirmed Enterococcus species, of which 42 (67%) were Enterococcus faecium, 15 (23%) were Enterococcus faecalis, and 6 (10%) were other Enterococcus species. Fourteen among the E. faecalis isolates show resistance to Ertapenem-EDTA, while 17 (44.8%) of the E. faecium show resistance to Ertapenem-EDTA to presumptively reveal their NDM-1 phenotype. The PCR detection of the NDM-1 gene further confirmed 23 (36.5%) isolates as positive genotypes amongst the isolates that previously showed presumptive NDM-1 phenotype. It was also observed that 10 (15.9%) of Enterococcus faecium members harbored the NDM-1 genotype, whereas 8 (12.7%) members of the Enterococcus faecalis harbored the NDM-1 genotype. The observation of such resistance determinants necessitates a call for the adroit application of relevant therapeutics in the management of related infections and an environmental health caution to prevent the spread of such resistance potential enteric bacteria pathogens.

Keywords

New Delhi Metallo-beta-lactamase 1 antibiotic resistance gene Oghara water nexus

Introduction

The water nexus has been described as a central distribution hub of diverse microbial pathogens in developing regions of the world with ardent incrimination of poor sanitation and hygiene.^1-3 Various disease cases have been source-tracked with these concerns, yet insufficient attention and intervention strategies have been employed in these regards.^4,5 Globally, an estimated 1.1to 2.6 billion people lack access to essential/safe water supply.^5,6 Although the populace is aware of the water-related concerns, they have continued with diverse unhygienic practices—for example, washing meat with contaminated water, contact with effluents, animals exposed to contaminated water, indiscriminate disposal of waste etc. Such activities have created a significant challenge for water-related researchers as they encounter new daily problems as antibiotic-resistant organisms continue to emerge and re-emerge.^7,8 In addition, there had been an imbalance in microbiota and the environment arising from unrestricted use of antimicrobials and wastewater release, giving rise to the emergence and spread of antimicrobial resistance.

One notable resistance reported in recent times is the New Delhi Metallo-β-lactamase 1 (NDM-1). It was first described by a Swedish national, Yong et al,⁹ in the capital city of India. Klebsiella pneumoniae was the first organism reported to harbor the first documented NDM-1 gene. It is expressed in organisms that harbor them with the following features; a broad spectrum of aminoglycoside resistance enzymes such as acetyltransferases and methylases, and topoisomerase mutations leading to a high level of resistance^5,10,11 resistance to carbapenem and β-lactam antibiotics were the produce carbapenemase and β-lactamase.^5,11 NDM-1, like most enzymes, requires metal-based cofactors to carry out catalytic reactions (in the presence of the zinc ions), hence the term “Metallo.”¹² NDM-1 is involved in the inactivation of the beta-lactams ring while excluding aztreonam. Its monomeric molecular mass is 28 kda. The gene (bla_NDM-1) is readily transferred from one bacterium to another via horizontal gene transfer.¹³ Such metallo-based resistant phenotype/genotype has been reported amongst Gram-negative enteric bacteria (Klebsiella pneumonia, Pseudomonas aeruginosa, Escherichia coli, Morganella morganii, Acinetobacter baumannii, and Proteus mirabilis etc.) globally with high endemicity in the USA and Greece.^5,14,15 Southern Europe, Germany and Asia have not been left out on the prevalence of NDM-1 and the metallo-based resistant determinants amongst Gram-negative strain.¹⁶ The prevalence of NDM-1 has also been reported in the United Kingdom, Pakistan, India and other continents of the world as interest is growing to prevent its spread.^14,16 In Africa, several investigators have reported the occurrence of NDM-1 amongst members of enteric bacteria, including Klebsiella species, Enterobacter cloacae, Citrobacter freundii, Serratia marcescens, Acinetobacter baumannii etc.^17-21 in South Africa, Kenya, Ethiopia and other eastern/southern African countries. In Nigeria, NDM-1 has been reported amongst Gram-negative enteric bacteria in various geopolitical zone, including the Southwestern region (Lagos), Northeastern region (Maiduguri), South-southern region (Bayelsa), North-western region (Kano), and South-eastern region (Enugu) of the country^22-29 however, non has reported NDM-1 amongst Gram-positive strains.

A study conducted in Spain by Nuñez et al³⁰ reveals high antibiotic resistance (to sulbactam, clavulanate, and tazobactam) associated with New Delhi Metallo-β -lactamase -1 (NDM-1) phenotype and genotype. Such resistant determinants have necessitated an increase in difficult-to-treat infections and disease cases which, according to some investigators, are on the rise amongst hospitalized patients³⁰ with a 10% increase in NDM-1 since 2003 in the US.

Various members of the Gram-negative enteric bacteria have been reported to harbor NDM-1 resistance but seldom reported among Gram-positive. However, one Gram-positive strain that has shown multiple emerging resistance tendencies is the Enterococci members. Enterococcus species are anaerobic facultative Gram-positive cocci.³⁰They are significant potential pathogens that inhabit the specific environment, and it has been a group of fecal contamination indicator organisms and gastrointestinal tract infection.³⁰ Due to their high virulence determinants and tendency to evade antibacterial agents, including imipenem, monobactam and vancomycin, it has been a notorious species implicated in hospital and community-acquired infections opportunistic.³⁰ In diverse environments, the Enterococci members are part of common flora, making it challenging to differentiate colonization from actual infection and non- pathogenic in typical environment.^31,32

Reports on the prevalence of Enterococcus in water nexus and some hospital environment in Africa has been few³³ with most NDM-1 reports on Gram-negative strains.^22,23,34

There had been few reports of various resistance determinants, for example vancomycin resistant enterococcus (VRE), cephalosporin and other β-lactamase resistance in Africa. However, no report of NDM-1 has been reported in the water nexus of the Western region of Delta State, Nigeria to the best of our knowledge. In addition, there is also a dearth of information as regards Nigeria reports, with few cases reported in other African countries.^22,23,34 Each year in the US, delays in treatment of 9300 water-related infections are caused by NDM-1 resistance gene,^35,36 and approximately 600 deaths result in common types of NDM-1.³³ The increasing reports of Enterococcus species associated infection with diverse life-threatening disease cases are also contributing factors. To this end, this study characterized antibiotic resistance profile and NDM-1 producing Enterococcus species obtained from water sources in Oghara nexus using molecular biology techniques with a view to source-tracking such emergence of resistance determinants.

Materials and Methods

Study area and sample collection

The study was conducted within the suburban area, the Western Delta region of the State, which consisted of 4 communities, including Ajagbodudu, Oghara-efe, Oghara-eki, and Otefe. These communities were selected based on a presumed interest and susceptibility to possible antibiotic resistance outbreaks of related strains and multiple antibiotic resistance strains currently on the rise. The region is located at latitude (E 057°C and W 047°C). Using Nalgene 1 l sterile glass bottles, water samples were aseptically collected (once-off) from surface water (River ethiope, abattoir lake, other lakes, and swamp). Collected samples were transported to Lahor research laboratories, Nigeria, within 6 hours in a cooler box with ice packs for processing (microbiological and molecular analysis) between June and December 2019. Serial dilutions (10¹-10³) of collected water samples were carried out using sterile distilled water. Briefly, test tubes with 9 ml of sterile distilled water were used in dilution, followed by adding 1 ml raw sample onto 9 ml of the sterile distilled water, and the test tubes were labeled 10⁻¹. Each sample serially diluted solution was mixed using a vortex mixer. After that, 3 prepared dilutions of all collected samples were made in tubes from 10⁰ to 10⁻³, while a volume of 0.1 ml was dispensed onto each labeled agar plate corresponding to the dilution factor. A sterile glass spreader was used to spread the pre-prepared water inoculum onto selective agar plates (Bile Esculin Azide Agar) (Merck Germany, www.merck-chemicals.com). Agar plates were incubated at 37°C for 24 hours. One colony per plate with black cultural morphology and colonial characteristics on a culture medium (culturonomics) was selected as a presumptively positive strain, while a single purified colony was used for DNA extraction using the crude isolate boiling technique.^31,37

Genetic confirmation of Enterococcus genus

The enterococci members were identified/confirmed genetically based on the detection of the genus-specific tuf-gene (product size 112 bp). E. feacalis ATCC 19 433 was used as a positive control. The reaction mixture consisted of a final volume of 25 µL, which contains 5 µL of DNA template, 12.5 µL of a GoTaq ^(P)G2 master mix (Promega Corporation USA www.promega.com), 0.5 µL each of primer ent1 and ent2, and 6.5 µL of nuclease-free water. The sequences of primers used are as follows Ent1 5′-TACTGACAAACCATTCATGATG-3′ and Ent2 5′AACTTCGTCACCAACGCGAAC-3′. These sequences were synthesized by Inqaba Biotechnical Industries (Pty) Ltd. (www.inqababiotech.co.za). The PCR cycling conditions consisted of an initial denaturation of 94°C/3 min, amplification in 30 cycles (94°C/30 s, 53°C/45 s, 72°C/60 s) and a final extension of 72°C/8 min. The amplicons were detected using gel electrophoresis in 2% agarose stained with ethidium bromide and visualized using a UV transilluminator and photographed.^31,37

Genetic confirmation of pathogenic species

PCR technique was employed for the confirmation of Enterococcus (E) species. The species-specific primer pairs of E. faecalis, E. faecium, E. durans, and E. casseliflavus³⁵ were employed (Table 1). The reaction mixture consisted of a final volume of 25 µL, which contains 3 µL of DNA extract (as template nucleic acid), 12.5 µL of GoTaq master mix, 0.5 µL of 0.5 µM concentration of each primer pair, and 8.5 µL of sterile nuclease-free water. The working solutions of all employed molecular biology consumables and premix preparations were aliquot, secured and stored in a refrigerator before analysis, and thawed in ice boxes in a biosafety cabinet to prevent contamination during analysis.

Table 1.

Primer pairs sequences for the various strains of Enterococcus species.

Primer name	Primer sequences 5′ 3′	Expected Amplicon (bp)	Annealing temperature	Targeted strain	Reference
FL1	ACTTATGTGACTAACTTAACC	360	52°C for 60 s	E. faecalis	Jackson et al³⁸
FL2	TAATGGTGAATCTTGGTTTGG
FM1	GAAAAAACAATAGAAGAATTAT	215	48°C for 60 s	E. faecium	Jackson et al³⁸
FM2	TGCTTTTTTGAATTCTTCTTTA
DU1	CCTACTGATATTAAGACAGCG	295	52°C for 60 s	E. durans	Jackson et al³⁸
DU2	TAATCCTAAGATAGGTGTTTG
CA1	TCCTGAATTAGGTGAAAAAAC	288	52°C for 60 s	E. casseliflavus	Jackson et al³⁸
CA2	GCTAGTTTACCGTCTTTAACG

Antibiotic susceptibility testing of Isolates

Confirmed isolates were subjected to antibiotic susceptibility testing using the carbapenem penicillin and cephalosporin groups of antibiotics vis: Carbapenems: {Ertapenem (ETP-10 μg)}, {Imipenem (Imi-30 μg)}, {Doripenem (Dor-10 μg)}, {Meropenem (Mem-10 μg)}, Penicillins: {Ampicillin (Amp-10 μg)}, Betalactam/β-lactamase inhibitors: Piperacillin-Tazobactam (PTZ-110 μg)}, Cephalosporins or Cephem: {Cefotaxime (CTX-30 µg)}, {Ceftazidime (CAZ-30 µg)}, {Ceftriaxone (CRO-30 µg)}, {Cefuroxime (CXM-30 µg)}, {Cefazolin (CZ-30 µg)}, {Cephalexin (CFX-30 µg)}, {Cefepime (CPM-30 µg)} {Cephalothin (KF-30 µg)}.These antibiotics disks were purchased from the Davis diagnostics (Pty) Ltd, 141 Oak Avenue, Ferndale, Randburg, 2194, Gauteng, South Africa (www.daviesdiagnostics.co.za).The antibiotic susceptibility test was interpreted as sensitive (S), Resistance (R) and intermediate (I) using the CLSI (Clinical and Laboratory Standards Institute) guidelines.³⁹

Strains phenotypic confirmation of NDM-1 phenotype/carbapenem resistance

A further test to determine the NDM-1 phenotypic resistance was applied using the Modified Hodge Test (MHT) method and the EDTA-Ertapenem synergy test.^32,39 First, isolates which were resistant to Ertapenem (ETP-10), and cephalosporin such as cefotaxime (CTX-30), ceftazidime (CAZ-30), and ceftriaxone (CRO-30) and those strains that show ⩾4 mm zone of clearance with EDTA enhanced disk were presumptively selected to harbor carbapenemase phenotype. The EDTA-Ertapenem synergy test was then conducted to detect carbapenemase in a secondary detection as those strains which show ⩾4 mm zone of clearance with EDTA enhanced disk reveals an indication for carbapenemase production. This was further confirmed by the MHT method as previously described by various investigators.^40-42

Genetic confirmation of bla_NDM-1 resistance amongst Enterococcus spp

All presumptive carbapenemase or Metallo- β -lactamase-producing Enterococcus strains were genetically analyzed for bla_NDM-1 resistance determinants using PCR. A 25 µl final volume reaction mixtures which contain 12.5 µL GoTaq PCR master mix reagents (www.promega.com), 0.5 µL volume of 0.5 µM concentration of each primer pair as bla_ND-MβL-1-forward and bla_ND-MβL-1- reverse primers{(F: 5′ GGG CAG TCG CTT CCAACG GT 3′ while R: 5′ GTA GTG CTC AGT GTC GGC AT 3′}, 3 µL of DNA extract (as a template nucleic acid/DNA), and 8.5 µL of sterile nuclease-free water, was observed to produce an expected amplicon size of 475 bp.⁴³ The reaction mixture was prepared in an ice box in a biosafety cabinet, aliquot into a nuclease-free 200 μL microfuge tube and arranged in a thermal cycler (Bio-Rad T100^™ thermal cycler, www.lasec.co.za, SA). The reaction cycling condition was as follows: initial denaturation at 94°C for 2 minutes, followed by 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. A final extension step of 72°C for 10 minutes was conducted and stored at 4°C before detection. The PCR products or amplicons were then electrophoresed (machine CLS-AG100, Warwickshire, UK) in 1.5% (wt/vol) agarose gel incorporated with 4 μL/100 mL of 0.5 mg/L ethidium bromide, followed by mixing while avoiding the formation of air bubbles and pouring/casting in the mini gel casting (Anachem, UK) tray and visualized/detected⁴⁴ in gel documentation system (Bio-Rad, USA). The control strain Escherichia coli ATCC 25 922 and Klebsiella pneumoniae (CCBH13327) were used as negative and positive control strains during gene detection.

The limitations of the study

The study did not employ the micro broth dilution method for MIC of antibiotics. However, the Kirby-Bauer disk diffusion test method was applied to determine antibiotic susceptibility testing. The choice of applied method was informed by access to the available materials at our disposal during the study. The study did not confirm the horizontal transferability of such resistant genes amongst other environmental strains. However, our ongoing studies in our lab would access the presence of plasmid and the sequence of positively detected strains with diverse resistance markers and plasmid types. Whole genome sequencing and/or partial genome of the positive strains were not conducted since the private/individual funds available to us during the study would not be able to take care of such aspects of the study. External funds are currently being sourced to continue in this study area. We hope to show the reports in the near future publicly

Results

Our study recovered 178 presumptive isolates of Enterococcus specie from the various surface water samples collected as follows: River ethiope (61 isolates), abattoir lake (68 isolates), other lakes and swamp (49 isolates), with 63 (35.4%) confirmed E. species. The presumptive isolates were selected based on their culturonomics in the employed media detailed in Table 2. Amongst the confirmed isolates, 42 (66.67%) were E. faecium, 15 (23.81%) were E. faecalis, and 6 (9.52%) were other Enterococcus species. Figures 1 to 3 show various expected amplicon size photographs of the agarose detection. High antibiotic resistance to ampicillin was observed amongst E. faecium compared to E. faecalis strains. Other resistance signature include: piperacillin/tazobactam (PTZ-110 μg) (21.4%), ampicillin (Amp-10 μg) (100%), ertapenem (ETP-10 μg) (57.1%), cefotaxime (CTX-30 μg) (47.6%), ceftazidime (CAZ-30 μg) (33.3%), and ceftriaxone (CRO-30 μg) (42.9%) amongst E. feacium as depicted in Table 3 below, while piperacillin/tazobactam (PTZ-110 μg) (26.7%), ampicillin (Amp-10 μg) (66.7%), ertapenem (ETP-10 μg) (46.7%) cefotaxime (CTX-30 μg) (53.3%), ceftazidime (CAZ-30 μg) (46.7%), and ceftriaxone (CRO-30 μg) (53.3%) were observed amongst E. faecalis as shown in Figure 4 below. The PCR of ND-MβL-1 gene detection confirmed 23 (36.5%) isolates in Figure 5, which were previously positive for the ND-MβL-1 phenotype and carbapenem resistance.

Table 2.

Distribution of isolates dynamics in the various water nexus sampled.

Sample sources/analyzed reports	River Ethiope	Abattoire Lake	Other lakes and swamp	Total
Numbers isolated presumptively	61	68	49	178
Numbers confirmed per site	21	31	11	63 (35.4%)
Numbers positive with EDTA-ETP	19	14	7	38
Positive E. faecium to EDTA-ETP	10	5	2	17 (44.8%)
Positive E. faecalis EDTA-ETP	6	5	3	14 (36.8%)
Other positive strains to EDTA-ETP	3	2	2	7 (18.4%)
Numbers positive with MHT	12	8	4	24
Positive E. faecium to MHT	6	4	0	10 (41.7%)
Positive E. faecalis to MHT	4	2	2	8 (33.3%)
Other positive strains to MHT	2	2	2	6 (25%)
Numbers with ND-MβL-1	11	8	4	23
Numbers of E. faecium	19	14	9	42 (66.7%)
Numbers of E. faecalis	5	7	3	15 (23%)
Numbers of other strains	3	2	1	6 (9.5%)
NDM-1 positive E. faecium	6	4	0	10 (43.5%)
NDM-1 positive E. faecalis	4	2	2	8 (34.8%)
NDM-1 positive for other strains	1	2	2	5 (21.7%)

Figure 1

Shows an agarose gel analysis of the PCR products of confirmed Enterococcus species targeting the 16S rRNA gene or ENT1/ENT2 (112 bp). Lane L: DNA Ladder (100 bp), Lane Pc: The positive control, Lane Nc is the negative control, Lane Wt is sterile water, and Lanes 1 to 3 are the representative samples.

Figure 2.

Shows an agarose gel electrophoresis photo of the PCR products of some confirmed Enterococcus feacalis strains (FL1/FL2) at 360 bp. Lane L: DNA Ladder (100 bp). Lane Pc: The positive control, Lane Nc is the negative control. Lane Wt is sterile water while, Lanes 1 to 4 are the representative positive strains.

Figure 3.

Shows an agarose gel electrophoresis photo of the PCR amplicons (products) of representative confirmed Enterococcus feacium strains (FM1/FM2) at 215 bp. Lane L: DNA Ladder (100 bp), Lane Pc: The positive control, Lane Nc is the negative control, Lane Wt is sterile water, and Lanes 1 to 4 are the samples.

Table 3.

The prevalence and phenotypic profile of E. faecium isolate.

Antibiotics	Susceptibility (%)	Intermediate (%)	Resistance (%)
Ertapenem (ETP)	14 (33.3)	4 (9.5)	24(57.1)
Imipenem (Imi)	34 (81.0)	5 (11.9)	3 (7.1)
Doripenem (Dor)	31 (73.8)	6 (14.3)	5 (11.9)
Meropenem (Mem)	38 (90.5)	4 (9.5)	0
Ampicillin (Amp)	0	0	42 (100)
Piperacillin-Tazobactam (PTZ)	5 (11.9)	28 (66.7)	9 (21.4)
Cefotaxime (CTX)	14 (33.3)	8 (19.1)	20 (47.6)
Ceftazidime (CAZ)	23 (54.8)	5 (11.9)	14 (33.3)
Ceftriaxone (CRO)	20 (47.6)	4 (9.5)	18 42.9)
Cefuroxime (CXM)	18 (42.9)	8 (19.1)	16 (38.1)
Cefazolin (CZ)	9 (21.4)	5 (11.9)	28 (66.7)
Cephalexin (CFX)	14 (33.3)	8 (19.1)	20 (47.6)
Cefepime (CPM)	11 (26.2)	8 (19.1)	23 (54.8)
Cephalothin (KF)	13 (31.0)	11 (26.2)	18 (42.9)

Carbapenems: {Ertapenem (ETP)}, {Imipenem (Imi)}, {Doripenem (Dor)}, {Meropenem (Mem)}, Penicillins: {Ampicillin (Amp)}, Betalactam/ β-lactamase inhibitors: Piperacillin-Tazobactam (PTZ)}, Cephalosporins or Cephem: {Cefotaxime (CTX)}, {Ceftazidime (CAZ)}, {Ceftriaxone (CRO)}, {Cefuroxime (CXM)}, {Cefazolin (CZ)}, {Cephalexin (CFX)}, {Cefepime (CPM)} {Cephalothin (KF)}.

Figure 4.

Showing the prevalence and phenotypic antibiotic profile of 21E. faecalis Isolates, S indicates susceptibility, I indicate intermediate, while R indicates resistance phenotype as show by the various strains.

Figure 5.

Shows an agarose gel photo of PCR products of representative confirmed New Delhi Metallo-beta-lactamase 1 (ND-MβL-1) amongst Enterococcus feacalis and Enterococcus feacium at 475 bp. Lane L: DNA Ladder (100 bp). Lane Pc: The positive control, Lane Nc is the negative control, and Lanes 1 to 4 are positive samples.

Discussion

Following the previous reports of researchers on the spreading nature of antibiotic resistance determinants and distribution in the water environment, there have been numerous emerging resistance determinants amongst potential pathogens of public health concern. Among such organisms are the enterocyte infecting members to which the Enterococcus species belong. This study has observed Enterococcus species in diverse surface water sources revealing its thriving tendency within the study area. It is important to note that Enterococcus species are bacteria reported as potential indicator strains of fecal contamination. Its presence in our study reflects a potential risk to human health and users of the sampled waters. Our results shown that amongst the 178 presumptive isolates of Enterococcus species recovered from the various surface water samples collected, 63 (35.4%) of them were confirmed E. species. The photograph of isolates agarose gel detection of amplicons confirmed isolates 66.7% (42) were Enterococcus faecium, 23.8% (15) were Enterococcus faecalis, and 6 (10%) were other Enterococcus species. Therefore, our study shows that E. faecium is the most prevalent, followed by E. faecalis. Such an evident report indicates that the environmental water nexus possesses enterococcal contaminants, which are traceable to fecal contamination.^8,41

In an earlier study by Iweriebor et al, similar strains were reported, including other strains of Enterococcus species such as E. casseliflavus, E. avium, E. sgallinarum, Enterococcus durans, and E. raffinosu.^31,33 Other investigators have also reported E. faecalis and E. faecium as the most prevalent species in both water environments and hospital or public health systems which may be source-tracked and/or traced with major nosocomial infections.^16,37,45 During the study, multiple resistant phenotypes were observed amongst the confirmed isolates, which borders on the carbapenem group of antibiotics and the β-lactam antibiotics group. It was found that 92% of the confirmed isolates exhibited resistance toward ampicillin in addition to other antibiotics (carbapenem) resistance phenotype, including piperacillin/tazobactam, ertapenem, imipenem, doripenem, ceftazidime, ceftriaxone etc. Due to its broad-spectrum nature, such resistance phenotype was not reported for meropenem. However, the intermediate phenotypic range on meropenem and resistance in other carbapenem antibiotics indicates resistance determinants. Such a high level of antibiotic resistance phenotype to the carbapenem antibiotics has become a significant cause of health concern as it resulted in aggravated infection cases and a challenge to treat situation^11,37 in a disease implication. Following the reports of Shah et al and his group on related studies, it was affirmed that such increased resistant phenotypes might result in increased volume and incidence of hospitalized patients.⁴⁶

The PCR and molecular gene detection of resistance to New Delhi Metallo-β-lactamase-1 (NDM-1) further confirmed 23 (36.5%) positive isolates to the targeted resistance gene, affirming the presence of the gene amongst environmental strains. This indicates the emergence of Enterococcus harboring strains in the water nexus of Oghara. It also implies the emergence of NDM-1 amongst Gram-positive strains in the study environment. Although reports of NDM-1 amongst Gram-positive strains are seldom documented, this study has shown the need for appropriate documentation and epidemiology of such resistance determinants, especially in the water environment. This is similar to Ranjan and Thatikonda⁴³ and Khan and Mustafa⁴⁴ in which the ND-MβL-1 resistance gene is spreading in the water environment, especially amongst Gram-negative strains. Although our study did not access the horizontal transferability of the resistance gene, studies by diverse investigators have also indicated that the water nexus is a potential hub for sharing such genotype even amongst other unrelated potential pathogens of environmental health relevance.^42,44,47 Observing such resistance phenotype and genotype amongst environmental strains present the isolates as potential pathogens of environmental risk, as previously depicted in the reports of the center for disease control.³³ Such risk may be likened to the previously reported disease cases, which affected more than 9300 patients in the US, with 600 deaths due to ND-MβL-1 resistance gene.^{5,25,26,33,42,44,46} Therefore, it is imperative for respective personnel within the study region that uses these water sources for diverse activities to stop their usage without adequate treatment. It is also important to point out that good hygienic practices be implemented should there be any contact with the specified water sources.

Conclusion

The study evaluates the occurrence of New Delhi Metallo-beta-lactamase 1 (ND-MβL-1) amongst Enterococcus species in the water nexus of Oghara Delta State as the emergence of environmental ND-MβL-1-harboring enterococci bacterial strains. Diverse phenotypes and genotypes of the resistance determinant were observed amongst the isolates of Enterococcus, which were recovered from water bodies. Observing/reporting such resistance determinants amongst Enterococcus members necessitates a call for prompt control action, especially on carbapenem and β-lactam, with the need for further ardent studies in this area. It is important to note that the potential pathogen and its emerging resistant genotypes/phenotypes are spreading in the water environment. There is a need for routine surveillance and monitoring of the water nexus within the study area. It is also of paramount importance that appropriate implementation of hygienic practice is employed amongst the general public to nip the spread of such resistance phenotype and genotype currently spreading in our environment and/or water nexus.

Footnotes

Acknowledgements

Authors wish to appreciate the efforts of microbial researchers and investigators in Lahor Research Laboratory Benin City, Edo State and Western Delta University Oghara Delta State in ensuring adequate sample processing and molecular analysis of the isolates are conducted as required.

Funding:

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Declaration of Conflicting Interests:

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Author Contributions

IBE conceived and designed the study, IBE, OH, and GO carried out the study, analyzed and interpreted the data, IBE drafted the manuscript, while IBE, OH, and GO revised the manuscript. All authors read and approved the final manuscript.

Ethics Approval Statement

The Ethics Research Committee of Western Delta University approved the protocol for this study.

Data Availability Statement

The datasets used for this study are available from the corresponding author on reasonable request.

References

Igere

Igolukumo

Eduamodu

Odjadjare

EO.

Multi-drug resistant Aeromonas species in Annelida: an evidence of pathogen harbouring leech in recreation water nexus of Oghara Nigeria environs. Sci Afr. 2021;20:145-166.

Igere

Okoh

Nwodo

UU.

Wastewater treatment plants and release: the vase of odin for emerging bacterial contaminants, resistance and determinant of environmental wellness. Emerg Contam. 2020;6:212-224.

Igere

Onohuean

Nwodo

UU.

Water bodies are potential hub for spatio-allotment of cell-free nucleic acid and pandemic: a pentadecadal (1969-2021) critical review on particulate cell-free DNA reservoirs in water nexus. Bull Natl Res Cent. 2022;46:56.

Marcoccia

Leiros

Aschi

Amicosante

Perilli

Exploring the role of L209 residue in the active site of NDM-1 a metallo-β-lactamase. PLoS One. 2018;13:e0189686.

Ranjan

Thatikonda

β-lactam resistance gene NDM-1 in the aquatic environment: a review. Curr Microbiol. 2021;78:3634-3643.

Onohuean

Okoh

Nwodo

UU.

Epidemiologic potentials and correlational analysis of Vibrio species and virulence toxins from water sources in greater Bushenyi districts, Uganda. Sci Rep. 2021;11:22429.

Satterthwaite

The impact of urban development on risk in sub-Saharan Africa’s cities with a focus on small and intermediate urban centres. Int J Disaster Risk Reduct. 2017;26:16-23.

Onohuean

Igere

BE.

Occurrence, antibiotic susceptibility and genes encoding antibacterial resistance of Salmonella spp. and Escherichia coli from milk and meat sold in markets of Bushenyi District, Uganda. Microbiology Insights. 2022;15:11786361221088992

Yong

Toleman

Giske

, et al Characterization of a new metallo-β-lactamase gene,bla _ndm-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from india. Antimicrob Agents Chemother. 2009;53:5046-5054.

10.

Ranjan

Shaik

Mondal

, et al Molecular epidemiology and genome dynamics of New Delhi Metallo-β-Lactamase-producing extraintestinal pathogenic Escherichia coli strains from India. Antimicrob Agents Chemother. 2016;60:6795-6805.

11.

Onohuean

Agwu

Nwodo

UU.

Systematic review and meta-analysis of environmental vibrio species - antibiotic resistance. Heliyon. 2022;8:e08845.

12.

Igbinosa

Beshiru

Igbinosa

EO.

Antibiotic resistance profile of Pseudomonas aeruginosa isolated from aquaculture and abattoir environments in urban communities. Asian Pac J Trop Dis. 2017;7:47-52.

13.

Nagulapalli Venkata

Ellebrecht

Tripathi

SK.

Efforts towards the inhibitor design for New Delhi metallo-beta-lactamase (NDM-1). Eur J Med Chem. 2021;225:113747.

14.

Aires-de-Sousa

Ortiz de la Rosa

Goncalves

Costa

Nordmann

Poirel

Occurrence of NDM-1-producing Morganella morganii and Proteus mirabilis in a single patient in Portugal: probable in vivo transfer by conjugation. J Antimicrob Chemother. 2020;75:903-906.

15.

Principe

Mauri

Conte

, et al First report of NDM-1-producing Klebsiella pneumoniae imported from Africa to Italy: evidence of the need for continuous surveillance. J Glob Antimicrob Resist. 2017;8:23-27.

16.

Costa

Figueroa-Espinosa

Gaudenzi

, et al Co-occurrence of NDM-5 and RmtB in a clinical isolate of Escherichia coli belonging to CC354 in Latin America. Front Cell Infect Microbiol. 2021;11:654852.

17.

Hayashi

Iimura

Horiuchi

, et al Occurrence of bla_NDM-1 in a clinical isolate of acinetobacter lwoffii in japan: comparison of bla_NDM-1-harboring plasmids between a. Lwoffii and a. Pittii originated from a hospital sink. Jpn J Infect Dis. 2021;74:252-254.

18.

Chen

Zhu

Zhao

, et al Occurrence of high-risk mcr-1 gene and blaNDM-1 positive superbug in the reverse osmosis filter cartridges of the household water purifiers. J Hazard Mater Lett. 2021;2:100011.

19.

Bushnell

Mitrani-Gold

Mundy

LM.

Emergence of New Delhi metallo-β-lactamase type 1-producing enterobacteriaceae and non-enterobacteriaceae: global case detection and bacterial surveillance. Int J Infect Dis. 2013;17:e325-e333.

20.

Adesoji

Ogunjobi

AA.

Detection of extended spectrum beta-lactamases resistance genes among bacteria isolated from selected drinking water distribution channels in southwestern Nigeria. Biomed Res Int. 2016;2016:7149295.

21.

Fischer

Schmoger

Jahn

Helmuth

Guerra

NDM-1 carbapenemase-producing Salmonella enterica subsp. enterica serovar Corvallis isolated from a wild bird in Germany. J Antimicrob Chemother. 2013;68:2954-2956.

22.

Brink

Coetzee

Clay

, et al Emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in South Africa. J Clin Microbiol. 2012;50:525-527.

23.

Govind

Moodley

Peer

, et al NDM-1 imported from India – first reported case in South Africa. S Afr Med J. 2013;103:476.

24.

Pritsch

Zeynudin

Messerer

, et al First report on bla NDM-1-producing Acinetobacter baumannii in three clinical isolates from Ethiopia. BMC Infect Dis. 2017;17:180.

25.

Oyelade

Adelowo

Fagade

. blaNDM-1-producing Vibrio parahaemolyticus and V. vulnificus isolated from recreational beaches in Lagos, Nigeria. Environ Sci Pollut Res. 2018;25:33538-33547.

26.

Uwaezuoke

Kieffer

Iregbu

Nordmann

First report of OXA-181 and NDM-1 from a clinical Klebsiella pneumoniae isolate from Nigeria. Int J Infect Dis. 2017;61:1-2.

27.

Mohammed

Zailani

Onipede

AO.

Characterization of KPC, NDM and VIM type carbapenem resistance Enterobacteriaceae from North Eastern, Nigeria. J Biosci Med. 2015;03:100-107.

28.

Abdullahi

Arzai

Yusuf

, et al Molecular detection of New Delhi Metallo beta Lactamase 1 (NDM-1) producing bacterial isolates in kano- northwestern Nigeria. Annu Res Rev Biol. 2017;14:1-6.

29.

Ogbolu

Alli

OAT

Oluremi

, et al Contribution of NDM and OXA-type carbapenemases to carbapenem resistance in clinical Acinetobacter baumannii from Nigeria. Infect Dis. 2020;52:644-650.

30.

Nuñez

Tornello

Puentes

, et al Hospital effluent constitutes a source of vancomycin-resistant enterococci. Ars Pharm. 2016;57:121-126.

31.

Onanuga

Eboh

Odetoyin

Adamu

OJ.

Detection of ESBLs and NDM-1 genes among urinary Escherichia coli and Klebsiella pneumoniae from healthy students in Niger delta University, Amassoma, Bayelsa State, Nigeria. PAMJ - One Heal. 2020;2:12.

32.

Toru

Beyene

Kassa

, et al Prevalence and phenotypic characterization of Enterococcus species isolated from clinical samples of pediatric patients in Jimma University Specialized Hospital, south west Ethiopia. BMC Res Notes. 2018;11:281.

33.

Iweriebor

Gaqavu

Obi

Nwodo

Okoh

AI.

Antibiotic susceptibilities of enterococcus species isolated from hospital and domestic wastewater effluents in alice, eastern cape province of South Africa. Int J Environ Res Public Health. 2015;12:4231-4246.

34.

Lowman

Sriruttan

Nana

, et al NDM-1 has arrived: first report of a carbapenem resistance mechanism in South Africa. South Afr Med J. 2011;101:873-875.

35.

Pesesky

Hussain

Wallace

, et al KPC and NDM-1 genes in related enterobacteriaceae strains and plasmids from Pakistan and the United States. Emerg Infect Dis. 2015;21:1034-1037.

36.

Bora

Ahmed

Hazarika

, et al Incidence of blaNDM-1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol. 2013;31:250-256.

37.

Walkty

Gilmour

Simner

, et al Isolation of multiple carbapenemase-producing gram-negative bacilli from a patient recently hospitalized in Nigeria. Diagn Microbiol Infect Dis. 2015;81:296-298.

38.

Jackson

Fedorka-Cray

Barrett

JB.

Use of a genus- and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol. 2004;42:3558-3565.

39.

CLSI M100-ED29. 2019 Performance Standards for Antimicrobial Susceptibility Testing. 29th ed. Clinical and Laboratory Standards Institute; 2019.

40.

Igere

Okoh

Nwodo

UU.

Antibiotic susceptibility testing (AST) reports: a basis for environmental/epidemiological surveillance and infection control amongst environmental vibrio cholerae. Int J Environ Res Public Health. 2020;17:1-23.

41.

Onohuean

Okoh

Nwodo

UU.

Antibiogram signatures of Vibrio species recovered from surface waters in South Western districts of Uganda: implications for environmental pollution and infection control. Sci Total Environ. 2022;807:150706.

42.

Fazeli

Norouzi-Barough

Ahadi

, et al Detection of New Delhi metallo-beta-lactamase-1 (NDM-1) in carbapenem-resistant Klebsiella pneumoniae isolated from a university hospital in Iran. Hippokratia. 2015;19:205–209.

43.

Sekar

Sowmiya

Malathi

, et al Clonal diversity of new delhi metallobetalactamase-1 producing enterobacteriaceae in a tertiary care centre. Indian J Med Microbiol. 2013;31:237.

44.

Ranjan

Thatikonda

Prevalence and absolute quantification of NDM-1: a β-lactam resistance gene in water compartment of lakes surrounding Hyderabad, India. J Appl Sci Process Eng. 2021;8:700-711.

45.

Shanthi

Sekar

Arunagiri

, et al OXA-181 beta lactamase is not a major mediator of carbapenem resistance in Enterobacteriaceae. J Clin Diagn Res. 2013;7:1986-1988.

46.

Shah

Cherabuddi

Shultz

Borgert

Ramphal

Klinker

KP.

Ampicillin for the treatment of complicated urinary tract infections caused by vancomycin-resistant Enterococcus spp (VRE): a single-center university hospital experience. Int J Antimicrob Agents. 2018;51:57-61.

47.

Yang

Mao

Zhou

Luo

Prevalence and fate of carbapenemase genes in a wastewater treatment plant in northern China. PLoS One. 2016;11:e0156383.

Occurrence of New Delhi Metallo-Beta-Lactamase 1 Producing Enterococcus Species in Oghara Water Nexus: An Emerging Environmental Implications of Resistance Dynamics

Abstract

Keywords

Introduction

Materials and Methods

Study area and sample collection

Genetic confirmation of Enterococcus genus

Genetic confirmation of pathogenic species

Antibiotic susceptibility testing of Isolates

Strains phenotypic confirmation of NDM-1 phenotype/carbapenem resistance

Genetic confirmation of blaNDM-1 resistance amongst Enterococcus spp

The limitations of the study

Results

Discussion

Conclusion

Footnotes

Acknowledgements

Funding:

Declaration of Conflicting Interests:

Author Contributions

Ethics Approval Statement

Data Availability Statement

References

Genetic confirmation of bla_NDM-1 resistance amongst Enterococcus spp