Molecular Characterization of Plasmid-Mediated Quinolone Resistance Genes in Multidrug-Resistant Escherichia coli Isolated From Wastewater Generated From the Hospital Environment

Abstract

Aim:

This study investigated the carriage of Plasmid-Mediated Quinolone Resistance (PMQR) genes in fluoroquinolone-resistant Escherichia coli recovered from wastewater generated by healthcare institutions.

Materials and Methods:

Isolation of fluoroquinolone-resistant Escherichia coli was done on medium supplemented with 1 µg/mL of ciprofloxacin (a fluoroquinolone). Presumptive isolates were identified via the detection of uidA gene. Susceptibility of the isolates to a panel of antibiotics was done using disc diffusion method. Detection of PMQR genes in the isolates was done using primer-specific PCR.

Results:

Thirty fluoroquinolone-resistant Escherichia coli were obtained from the wastewater over a period of 6 months. The resistance to each of the antibiotic tested was: ampicillin (100%), ceftriaxone (100%), nalidixic acid (100%), tetracycline (96.7%), cefotaxime (96.7%), amoxicillin-clavulanate (80%), gentamicin (60%), cefoxitin (30%), and imipenem (3.3%). The Multiple Antibiotic Resistance Index (MARI) ranged from 0.6 to 0.9. The detection of PMQR genes in the 30 isolates was: qnrA (76.7%), qnrB (53.3%), qnrS (63.3%), aac(6′)-lb-cr (43.3%), and qepA (43.3%). All the fluoroquinolone-resistant Escherichia coli carried at least one PMQR determinant.

Conclusion:

This study revealed that untreated hospital wastewaters are significant hub of multidrug-resistant and fluoroquinolone-resistant Escherichia coli, showing high carriage of PMQR genes, and may be a major contributor to the resistome of fluoroquinolone-resistant bacteria in the Nigerian environment.

Plain Language Summary

Escherichia coli showing resistance ciprofloxacin, a fluoroquinolone antibiotic was isolated from wastewater of some selected healthcare institutions in South-west Nigeria. The bacteria were identified using the detection of uidA gene, and they were tested against some antibiotics using the disc diffusion test. The detection of PMQR genes was done using primer-specific PCR. A total of 30 fluoroquinolone-resistant isolates were recovered from the wastewater in six months. All the isolates were resistant to ampicillin and nalidixic acid, while the least level of resistance was to imipenem, a carbapenem antibiotic. The multiple antibiotic resistance index for the isolates ranged from 0.6 to 0.9. All the isolates were multidrug-resistant. The frequency of PMQR genes in the 30 resistant isolates obtained from the wastewater was: qnrA (76.7%), qnrS (60%), qnrB (53%), aac(6')-lb-cr (43.3%) and qepA (40%). All the isolates carried at least one of the target PMQR genes. Wastewater from healthcare institution is a breeding ground for fluoroquinolone-resistant Escherichia coli.

Keywords

Plasmid-Mediated Quinolone Resistance (PMQR)healthcare settings antibiotic resistance Multiple Antibiotic Resistance Index (MARI)

Summary of Points

Fluoroquinolone-resistant E. coli were obtained from the wastewater of selected healthcare institutions.

All the isolates resisted ampicillin, ceftriaxone and nalidixic acid, while the least resistance was to imipenem (3.3%).

The MARI of the 30 fluoroquinolone-resistant isolates obtained ranged from 0.6 to 0.9.

The frequency of PMQR genes detected in the isolates was qnrA (76.7%), qnrB (53.3%), qnrS (60%), aac(6′)-lb-cr (43.3%), and qepA (43.3%).

Wastewater from healthcare institution is a “hotspot” of fluoroquinolone-resistant Escherichia coli.

Introduction

Antibiotic resistance (AR) in bacteria has come to be recognized as a major driver of drug therapy failure leading to complications that result in severe and prolonged infections, hardship from higher hospital charges, and increasing rates of morbidity and mortality to otherwise easily treatable infections and diseases.^1-5 Antimicrobial resistance has been designated as an urgent public health threat by the World Health Organization (WHO), and is highlighted as one of the top six emerging environmental issues of the world. Besides other contributors to the menace of antibiotic resistance, the hospital environment is a significant hotspot for antibiotic resistance development, prevalence, and transmission, via the discharge of wastewater. This has been affirmed by several studies.^6-8 It has been established that the emergence of AR is partly consequent of imposing various selective pressures on pathogens, as well as pools of naturally-occurring bacteria in their respective environments. Situations are exacerbated in most developing countries by poor sanitation practices especially the unhygienic discharge of untreated wastewaters into the environment. This is in addition to the fact that adequate monitoring or hygiene auditing of wastewater discharges in most developing countries of the world, including Nigeria is mostly lacking.^7-9

The fluoroquinolones, a broad-spectrum class of antibiotics were in no too far times hailed as one of the most potent, yet safe, reasonably priced antibiotics in clinical medicine. Besides, they are one of the antibiotics relied upon for the treatment of infections caused by Enterobacterales including E. coli.¹⁰ However, there are increasing reports of reduced activity, to loss of therapeutic prowess of the fluoroquinolones in the wake of emergence of resistance. Acquisition of resistance to fluoroquinolones has been reported to be mediated by either chromosomal mutation or the acquisition of plasmids, encoding resistance to the fluoroquinolones.^10,11

Plasmid-Mediated Quinolone Resistance (PMQR), a mechanism used by bacteria to evade the activity of fluoroquinolones could be via genes encoding pentapeptide repeat family proteins (qnr), which protects the DNA gyrase and topoisomerase (IV) of the bacteria from the deleterious effects of fluoroquinolones; aac(6′)-Ib-cr which encodes amino acetyltransferases⁸ and the quinolone efflux pumps (qepA and oqxAB). These genes have been identified in E. coli, as the top mechanisms mediating resistance to fluoroquinolones.¹² Horizontal transmissibility of the PQMR genes among members of the same and different species of bacteria has further made their spread faster when compared with chromosomal mutation.¹³

Strains of Escherichia coli are recognized as one of the most dynamic bacterial species in nature, mostly due to their dual existence as commensals and pathogens. Though a primary inhabitant of the lower intestinal tract of humans and other warm-blooded animals, the ease of adaptability to varying environments coupled with their genetic pliability enable them to acquire antimicrobial resistance determinants in their environment to a great extent.¹⁴ In addition to this, E. coli has a remarkable capability to serve as donor and recipient of antimicrobial resistance (AMR) genes which earned it a place among the top high-risk pathogens. Most studies on the prevalence of PQMR determinants have focused entirely on clinical samples, with a few focusing attention on wastewater generated from hospital operations thus, leaving a significant gap on the possible contribution of untreated wastewater from hospital/clinical sources to the alarming trend of antibiotic resistance. In this study, we investigated the occurrence of PMQR determinants in E. coli isolated from hospitals whose wastewaters are channeled into municipal drains without any form of treatment in three selected towns located in Ogun State, Southwest Nigeria.

Materials and Methods

Study Site and Sample Collection

This study was conducted in three towns in Ogun State, located in the Southwest geopolitical zone of Nigeria. The towns were chosen because of their popularity in terms of land mass and population; as well as being commercial hubs in Ogun state. All three towns have similar layout structure and healthcare delivery operations. All the hospitals (names withheld) sampled in this study are sited within the metropolis, with some literally sharing fences with adjoining communities. The selected hospitals manage wastewaters in private sewer/septic tank in combination with some wastewater pipes which ultimately discharge directly into the community sewers. Six hospitals, two from each study town were selected for this study. Untreated hospital wastewater samples were collected aseptically into sterile sample bottles from the main discharge channels at the hospitals, and transferred on ice to the Microbiology Laboratory for analysis within three hours of collection. Sampling was performed fortnightly for a period of six months (January-June, 2023). A total of 72 samples (13 samples from each hospital) were collected during the course of sampling. The location and geographical positioning system (GPS) of the hospitals sampled are shown in Table 1.

Table 1.

Location and geographical positioning system (GPS) of the hospitals sampled.

Hospital code	Location	GPS reading
VH	Ijebu Igbo	6°57′59.5″N;3°59′34.9″E
BH	Ijebu Igbo	6°56′53.7″N;3°56′56.6″E
GH	Ijebu Ode	6°48′44.7″N;3°55′34.9″E
OOC	Ijebu Ode	6°49′10.8″N;3°55′15.8″E
FH	Ago Iwoye	6°56′06.7″N;3°54′05.9″E
NDH	Ago Iwoye	6°56′14.9″N;3°55′03.2″E

Selective Isolation of Fluoroquinolone-Resistant Escherichia coli

Aliquot (1 mL) of each hospital wastewater sample was inoculated into Brain Heart Infusion (Becton, Dickinson and Company, France), supplemented with ciprofloxacin (a fluoroquinolone), at a concentration of 1 µg/mL, following the Minimum Inhibitory Concentration (MIC) breakpoint of the Clinical Laboratory Standard Institute.¹⁵ This was incubated at 35 ± 2°C overnight. After the incubation period, a loopful of the inoculated broth was streaked on MacConkey agar (Oxoid, UK). Colonies with deep pink pigmentation were picked and purified on Eosin Methylene Blue (Oxoid, UK). Colonies exhibiting pronounced green metallic sheen were selected and further purified on Nutrient agar (Oxoid, UK) before storage on nutrient agar slants kept at 4°C and glycerol stock kept at −80°C for further studies.

Extraction of DNA and Identification of the Isolates

Extraction of total genomic DNA from the isolates was done using the boiling lysis method, according to the method of Gugliandolo et al.¹⁶ The identity of the isolates was confirmed by targeting uidA, a housekeeping gene in E. coli according to the method of Janezic et al¹⁷ Isolates possessing the uidA were selected for the antibiotic susceptibility testing and detection of PMQR determinants. The details of the uidA primers are shown in Table 2.

Table 2.

Oligonucleotide primers and amplicon sizes of PMQR determinants targeted in this study.

Target gene	Primer sequence (5′ to 3′)	Amplicon size (bp)	Reference
uidA	AAAACGGCAAGAAAAAGCAG ACGCGTGGTTACAGTCTTGCG	146	Janezic et al¹⁷
qnrA	TTCAGCAAGAGGATTTCTCA GGCAGCACCATTACTCCCAA	608	Wu et al¹⁸
qnrB	CCTGAGCGGCACTGAATTCAT GTTTGCTGCTCGCCAGTCGA	389	Wu et al¹⁸
qnrS	CAATCATACATATCGGCACC TCAGGATAAACAACAATACCC	621	Wu et al¹⁸
aac(6′)-lb-cr	TTGCGATGCTCTATGAGTGGCTA CTCGAATGCTTGGCGCGTTT	482	Kim et al¹⁹
qepA	GCAGGTCCAGCAGCGGGTAG CTTCCTGCCCGAAGTATCGTG	218	Kim et al¹⁹

Susceptibility of the Fluoroquinolone-Resistant Escherichia coli to a Panel of Antibiotics

The isolates carrying the uidA were subjected to a panel of nine antibiotics using the disc diffusion method.²⁰ The CLSI.¹⁵ method was employed in determining the panel of antibiotics to be tested, standardization of inoculum, choice of medium and the interpretation of the zones of inhibition. Multiple Antibiotic Resistance Index (MARI) was calculated using the formula below:

M A R I = a / b

where a = number of antibiotics the test isolate showed resistance to and b = number of antibiotics the isolate was assessed for susceptibility.²¹

Detection of PMQR Determinants

The detection of PMQR determinants in the fluoroquinolone-resistant Escherichia coli was done using the methods of Wu et al.¹⁸ and Kim et al.¹⁹ The duplex polymerase chain reaction (PCR) was used in the detection of qnrA, qnrB, qnrS, and qepA, while a monoplex PCR was used in the detection of aac(6′)-Ib-cr. The PCR reaction mixture in each case was 25 µL and it consisted of 5× PCR Master Mix (Jena Bioscience, Germany), forward and reverse primers (0.25 µL each), DNA template (1 µL), with nuclease-free water making up the volume. The oligonucleotide primers used in this study are shown in Table 2.

Results

Table 3 shows the frequency of fluoroquinolone-resistant Escherichia coli isolated from the untreated hospital wastewater sampled in this study. A total of 30 fluoroquinolone-resistant Escherichia coli isolates were obtained from the 72 hospital wastewater samples analyzed in this study. Of the 30 isolates, 12 were recovered from hospitals in Ago-Iwoye town with FH and NDH having six isolates each. Sixteen fluoroquinolone-resistant Escherichia coli were obtained from the two selected hospitals at Ijebu Igbo [VH (9) and BH (7)]. Only two isolates were obtained from Ijebu Ode, and both were from GH. No fluoroquinolone-resistant Escherichia coli was recovered from OOC at Ijebu Ode.

Table 3.

Frequency of fluoroquinolone-resistant Escherichia coli obtained from hospital wastewater.

Code of Hospitals sampled	Location	Fluoroquinolone-resistant E. coli obtained
VH	Ijebu Igbo	9
BH	Ijebu Igbo	7
GH	Ijebu Ode	2
OOC	Ijebu Ode	0
FH	Ago Iwoye	6
NDH	Ago Iwoye	6

Figure 1 shows the resistance of the isolates recovered from the hospital wastewater to a panel of selected antibiotics. All the 30 fluoroquinolone-resistant Escherichia coli from hospital wastewater were resistant to ampicillin, nalidixic acid and ceftriaxone. Twenty-nine isolates (96.7%) each showed resistance to tetracycline and cefotaxime. The following shows the number of isolates showing resistance to the other antibiotics and their percentage resistance: amoxicillin-clavulanate 24 (80%), gentamicin 18 (60%), cefoxitin 9 (30%), with one isolate (3.3%) showing resistance to imipenem.

Figure 1.

Resistance of the fluoroquinolone-resistant Escherichia coli to selected panel of antibiotics.

The phenotype of resistance of the 30 isolates is shown in Figure 2. All the 30 isolates were multidrug-resistant (showing resistance to ⩾3 classes of antibiotics). The MARI for the fluoroquinolone-resistant Escherichia coli ranged from 0.6 to 0.9.

Figure 2.

Phenotype of resistance and MARI of the fluoroquinolone-resistant Escherichia coli.

Distribution of the Plasmid-Mediated Quinolone Resistance (PMQR) Determinants

Table 4 shows the distribution and frequency of occurrence of the target PMQR determinants in the 30 fluoroquinolone-resistant Escherichia coli recovered from hospital wastewaters, All the fluoroquinolone-resistant Escherichia coli carried at least one of the PMQR determinants targeted, with qnrA gene dominating with 23/30 (76.7%) of the total isolates carrying it. The frequency of occurrence of the other PMQR determinants was qnrB 16/30 (53.3%), qnrS 19/30 (63.3%), aac(6′)-lb-cr 13/30 (43.3%) and the quinolone efflux pump (qepA) which was detected in 13/30 of the isolates representing 43.3%.

Table 4.

Distribution of PMQR determinants in fluoroquinolone-resistant Escherichia coli from hospital wastewater.

Isolate ID	Source	Hospital	qnrA	qnrB	qnrS	aac(6′)-lb-cr	qepA
E. coli H4	Ijebu Igbo	FH	+	+	+	+	−
E. coli H5	Ago Iwoye	VH	+	+	−	+	−
E. coli H6	Ago Iwoye	VH	−	+	+	+	+
E. coli H7	Ijebu Igbo	VH	+	+	+	−	−
E. coli H8	Ago Iwoye	NDH	+	−	+	−	+
E. coli H10	Ijebu Igbo	NDH	+	−	+	−	−
E. coli H11	Ijebu Igbo	BH	−	+	−	+	−
E. coli H12	Ijebu Igbo	FH	+	+	+	−	−
E. coli H13	Ago Iwoye	BH	−	−	+	−	−
E. coli H14	Ago Iwoye	NDH	+	−	−	+	+
E. coli H16	Ijebu Igbo	BH	+	+	+	−	−
E. coli H19	Ago Iwoye	FH	+	+	−	+	−
E. coli H21	Ijebu Igbo	BH	+	+	+	−	−
E. coli H22	Ago Iwoye	VH	+	−	+	+	−
E. coli H23	Ijebu Igbo	VH	+	−	−	+	−
E. coli H26	Ago Iwoye	VH	−	+	+	+	−
E. coli H27	Ijebu Igbo	VH	+	+	+	−	−
E. coli H30	Ijebu Igbo	FH	+	+	−	−	+
E. coli H31	Ijebu Igbo	VH	+	+	+	−	+
E. coli H32	Ijebu Igbo	FH	+	−	−	+	−
E. coli H33	Ijebu Igbo	VH	+	+	−	+	−
E. coli H34	Ago Iwoye	GH	+	+	+	−	+
E. coli H35	Ijebu Igbo	GH	+	+	−	+	+
E. coli H39	Ago Iwoye	NDH	+	−	+	−	+
E. coli H43	Ijebu Ode	BH	+	−	+	−	−
E. coli H44	Ijebu Ode	NDH	−	−	+	+	+
E. coli H45	Ago Iwoye	BH	+	−	+	−	+
E. coli H46	Ijebu Igbo	NDH	−	−	+	−	+
E. coli H49	Ago Iwoye	BH	−	−	−	−	+
E. coli H50	Ijebu Igbo	FH	+	−	−	−	+
Frequency			23 (76.7%)	16 (53.3%)	19 (63.3%)	13 (43.3%)	13 (43.3%)

+, detected; −, not detected.

Co-carriage of PMQR Genes by the Fluoroquinolone-Resistant E. coli

Table 5 shows the co-occurrence of PMQR genes by the fluoroquinolone-resistant Escherichia coli recovered from hospital wastewater in this study. The 30 fluoroquinolone-resistant Escherichia coli isolates carried at least one of the PQMR genes targeted. The combination of qnr genes (either of qnrA, qnrB or qnrS) + qepA was detected in 12 of the fluoroquinolone-resistant E. coli, while the combination of qnr genes (either of qnrA, qnrB or qnrS) + aac(6′)-lb-cr was detected in 13 isolates. Four isolates out of the 30 were observed to carry both aac(6')-lb-cr + qepA simultaneously. E. coli H49 was the only isolate that carried one PMQR determinant in this study.

Table 5.

Co-carriage of PMQR genes in fluoroquinolone-resistant E. coli isolated from hospital wastewater.

PMQR gene combination	Frequency	Percentage (%)
qnr (either of qnrA, qnrB or qnrS) + aac(6′)-lb-cr	13/30	43.3
qnr (either of qnrA, qnrB or qnrS) + qepA	12/30	40
aac(6′)-lb-cr + qepA	4/30	13.3

Discussion

The fluoroquinolone antibiotics have found numerous uses in the treatment of infections owing to their high level of tolerance, low toxicity, quick rate of absorption and also their broad spectrum of activity. These have made their consumption over the years to be skyrocketing, as they have been used extensively in veterinary practices, animal husbandry and the treatment of human infections. This comes with an attendant repercussion, as the rate of resistance to these synthetic agents keeps rising without showing any sign of abating.^22,23 The Nigerian environment is not spared of this menace, that has been gaining attention globally. This is because there is no restriction to the purchase of antibiotics and antimicrobial agents in Nigeria, making the misuse and abuse of antibiotics a way of life. This study is a follow-up to our ongoing research on the carriage of PMQR determinants in E. coli from different reservoirs and matrices in Nigeria. Other studies within the context of this framework have focused on PMQR determinants in E. coli from sources including water, wastewater and isolates from the clinical environment.

Most healthcare institutions in Nigeria, with the exception of a few ones lack appropriate wastewater treatment facilities, and as a result, their wastewater is discharged untreated into the environment. This ends up being washed into adjoining surface water, and the resultant effects on humans, plants, and the microbial community remains a tall order, as the integrity of the environment and public health is compromised as a result. This study focused on the resistotyping and detection of PMQR determinants in Escherichia coli isolated from wastewater generated by six selected healthcare institutions located in Ijebu-Ode, Ijebu-Igbo and Ago-Iwoye, which are major towns located in Ogun state in the Southwestern part of Nigeria.

In this present study, there was a high level of resistance to the tested antibiotics. Apart from ampicillin, nalidixic acid and ceftriaxone, which all the fluoroquinolone-resistant Escherichia coli showed resistance to, there was also a high level of resistance to the other tested antibiotics. The least level of resistance was to imipenem, a carbapenem antibiotic. The high level of resistance to antibiotics in this study could be attributed to a wide range of factors which could include the fact that wastewater samples from the hospital environment is potentially high in antimicrobial compounds and antibiotic residues, making it an ideal ecosystem for antibiotic-resistant bacteria, a view also shared by Mehanni et al.²⁴ while evaluating the consequences of using treated wastewater from healthcare institutions for irrigation.

The high frequency of occurrence of plasmid-mediated quinolone resistance (PMQR) genes in Enterobacterales has been established in many studies. There are several determinants constituting this class of genes and they include: the pentapeptide repeat family proteins (qnr), which mitigate the deleterious effects of quinolone antibiotics on the DNA gyrase and topoisomerase (IV) of the bacteria; aminoglycoside acetyltransferases (aac(6′)-Ib-cr) and the quinolone efflux pumps, qepA and oqxAB.^8,12 Poirel et al.²⁵ reported that the qnr determinants, which have been reported to be chromosome-borne in some species of environmental bacteria are plasmid-borne in the Enterobacterales. Their major function are the protection of DNA gyrase and topoisomerase IV from the toxic and deleterious effects of fluoroquinolones. These genes belong to the pentapeptide class of the protein family, and have been detected in bacteria from several reservoirs and compartments including humans, animals, and the environment. In this study, three genes of the qnr family (qnrA, qnrB, and qnrS) were targeted for detection in the 30 fluoroquinolone-resistant E. coli. The most predominant of the qnr genes in this study was qnrA, which was detected in 76.7% of the isolates, while 53.3% and 63.3% of the fluoroquinolone-resistant isolates carried qnrB and qnrS respectively. There are several studies that have reported the detection of the qnr family of the plasmid-mediated quinolone resistance genes from hospital wastewater and aquatic bodies.

Diwan et al.²⁶ in their study on the detection of quinolone resistance genes in E. coli from hospital wastewater in India, reported the detection of qnrB in two (6.7%) of the 30 isolates. This is a far cry from the 53.3% carriage of qnrB in the same number of isolates in this study. In another sharp disagreement with this study, only one (3.3%) of the isolates in their study carried qnrA, which was detected in 76.7% of the isolates in this present study. In another study on wastewater from the hospital environment, Ranjbar et al.²⁷ also reported a lower detection of qnrB and qnrS in their study compared to the frequency of the genes in this current study, whereas qnrA was not detected in their own isolates. The reported high incidence of qnr determinants in this study compared to other studies could be as a result of the abuse, misuse and over-the-counter availability of the antibiotics in Nigeria, making it very easy for the populace to self-administer without prescription.

Another quinolone resistance gene of interest, which is not directly responsible for mediating resistance to fluoroquinolones), but plays an extensive role in mediating quinolone resistance in bacteria is aminoglycoside acetyltransferase (aac(6′)-Ib-cr). They are responsible for initiating the modification of fluoroquinolones via the process of acetylation. This gene is a variant of the original aminoglycoside acetyltransferase, which shows activity against the aminoglycoside antibiotics. The mechanism of acetylation is made possible as a result of the amino nitrogen on the piperazinyl ring as reported by Robicsek et al.²⁸ Some studies have reported that the level of resistance conferred on bacteria by the gene is very low, however, it become heightened or elevated with the carriage of qnr determinants by the same cell. They have also been discovered to have a very high frequency of occurrence in quinolone-resistant bacteria from different compartments as reported by Strahilevitz et al.²⁹ Shaheen et al.³⁰ and de Jong et al.³¹ In this study however, this was not the case as 13 (43.3%) of the 30 Escherichia coli isolates carried aac(6′)-Ib-cr, making it one of the least occurring PMQR genes in this study. Osińska et al¹ and Zurfuh et al.² while working on sewage and surface water samples reported the predominance of aac(6′)-Ib-cr when compared with qnr genes, a trend which does not align with the observation from this present study, as the qnr genes were more predominant than aac(6′)-Ib-cr.

The first mention of the quinolone efflux pump-encoding gene (qepA) was in a study by Yamane et al.³² According to their reports, the gene confers the ability to reduce the accumulation of fluoroquinolones in the cell as with most efflux pumps. The gene has been gaining more attention because it has been reported to be carried by many Gram negative bacteria groups globally. In this study, 43.3% of the quinolone-resistant isolates were detected to carry the gene. The proportion of the gene in this study is very high compared to other studies carried out on clinical and environmental isolates. In a study carried out on wastewater from a hospital in India, 10% of the isolates recovered carried qepA as reported by Diwan et al.²⁶ while Yang et al.³³ reported that 3.3% of 2297 blood culture isolates obtained between 2004 and 2011 were detected to harbor qepA. As reported by Osinka et al.¹ and Zurfuh et al.² the frequency of occurrence of qepA is always lesser than that of aac(6′)-Ib-cr, and this same trend was evident in this study.

The co-occurrence of the PMQR determinants in the Escherichia coli from this study raises a serious concern as 29 out of 30 fluoroquinolone-resistant isolates genotyped in this study carried at least two PMQR determinants suggesting that E. coli from untreated wastewater from healthcare institutions could be potential reservoirs of fluoroquinolone-resistant isolates carrying a high burden of PMQR genes. This could expose other bacteria groups in receiving water bodies or other environments to the likelihood of picking up these genes via horizontal transfer, thus further complicating the fight against resistant bugs. More attention should be focused on studies involving the detection of PMQR determinants in isolates from non-clinical sources as a larger number of studies on quinolone resistance in bacteria have focused on isolates from human clinical samples, hence the dearth of reported studies on PMQR determinants in non-clinical samples. This trend aligns with the findings of Joel et al.³⁴ who reported the co-carriage of PMQR determinants by E. coli from animal waste obtained from a Teaching and Research farm in Nigeria. The samples in both studies might not be related, but it gives an insight into the difficult situation inherent in dealing with fluoroquinolone resistance in bacteria, as these isolates are armed with so many resistance mechanisms.

Limitations of the Study

The major limitation from this study was the need to restrict the number of samples to 72 after six months of sampling, because of the limitation of funds. More funds would have given us the chance of more sampling duration yielding more isolates and giving a more robust and detailed data. In addition to this, getting the approval of the healthcare institutions was also very challenging and time-consuming.

Conclusion

This present study is germane as it has provided more insight into the carriage of PMQR determinants by E. coli from the non-clinical settings, in this case untreated hospital wastewater. There was varying level of resistance by the isolates to the tested antibiotics. qnrA was the predominant PMQR gene detected in the isolates with a percentage occurrence of 76.7%, followed by qnrS (63.3%), qnrB (53.3%), aac(6′)-lb-cr (43.3%), and qepA (43.3%). The least occurring PMQR determinant in the E. coli obtained in this study was the quinolone efflux pump (qepA), which was detected in 40% of the isolates selected for PMQR genotyping. There was co-occurrence of PMQR genes in all but one of the fluoroquinolone-resistant E. coli, and this is quite very alarming. Effective treatment methods for wastewater generated from healthcare institutions need to be put in place to prevent the spread of antibiotic-resistant “bugs” from hospital wastewater discharges into the environment. There is a need however, to carry out more research on more non-clinical environments to know the exact contribution of these sources to the scourge of antibiotic resistance.

Footnotes

Acknowledgements

The authors want to appreciate the management of the selected hospitals for being very supportive during the entire sample collection process.

ORCID iD

Abimbola O. Adekanmbi

Oluwatimileyin J. Akinbola

Author Contributions

OAB and AOA developed the original idea and the protocol. OAB, AOA and OJA performed the laboratory experiments. All authors were involved in the collection of data for the study. AOA and OAB wrote the preliminary draft. All authors carried out the analysis of the data. All authors read, revised and approved the manuscript for publication.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The study was funded by the authors.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement

All the data generated or analyzed during the execution of this study are included in this published article.

References

Osińska

Harnisz

Korzeniewska

. Prevalence of plasmid-mediated multidrug resistance determinants in fluoroquinolone-resistant bacteria isolated from sewage and surface water. Environ Sci Pollut Res Int. 2016;23(11):10818-10831.

Zurfuh

Poirel

Nordmann

, et al. Occurrence of the plasmid-borne mcr-1 colistin resistance gene in extended spectrum β-lactamase-producing Enterobacteriaceae in river water and imported vegetable samples in Switzerland. Antimicrob Agents Chemother. 2016;60:2594-2595.

Ranjbar

Farahani

. The prevalence of plasmid-mediated quinolone resistance genes in Escherichia coli isolated from hospital wastewater sources in Tehran, Iran. Iran J Public Health. 2017;46(9):1285-1291.

Aminul

Anwar

Molla

MMA

Miah

MRA

. Evaluation of antibiotic resistance patterns in clinical isolates of Klebsiella pneumoniae in Bangladesh. Biosaf Heal. 2021;3:301-306.

Lamikanra

Crowe

Lijek

, et al. Rapid evolution of fluoroquinolone-resistant Escherichia coli in Nigeria is temporarily associated with fluoroquinolone use. BMC Infect Dis. 2022;11:312.

Mutiyar

Mittal

. Risk assessment of antibiotic residues in different water matrices in India: key issues and challenges. Environ Sci Pollut Res. 2014;21(12):7723-7736.

Banjo

Adekanmbi

Oyelade

. Occurrence of CTX-M, SHV and TEM β-lactamase genes in extended spectrum beta-lactamase (ESBL)-producing bacteria recovered from wastewater of a privately-owned hospital in Nigeria and a hand-dug well within its vicinity. Gene Rep. 2020;21:100970.

Adekanmbi

Akinpelu

Olaposi

Oyelade

. Extended spectrum beta-lactamase encoding gene-fingerprints in multidrug resistant Escherichia coli isolated from wastewater and sludge of a hospital treatment plant in Nigeria. Int J Environ Stud. 2021;78(4):140-211.

Adelowo

Caucci

Banjo

, et al. Extended spectrum beta-lactamase (ESBL)-producing bacteria isolated from hospital wastewaters, rivers and aquaculture sources in Nigeria. Environ Sci Pollut Res. 2018;25:2744-2755.

10.

Singh

Singhal

Kumar

Virdi

. Public health implications of plasmid-mediated quinolone and aminoglycoside resistance genes in Escherichia coli inhabiting a major anthropogenic river of India. Epidemiol Infect Mar. 2022;28(150):1-21.

11.

Rodríguez-Martínez

Cano

Velasco

Martínez-Martínez

Pascual

. Plasmid-mediated quinolone resistance: an update. J Infect Chemother. 2011;17(2):149-182.

12.

Awad

Kim

Abd El-Azeem

SAM

, et al. Veterinary antibiotics contamination in water, sediment, and soil near a swine manure composting facility. Environ Earth Sci. 2014;71:1433-1440.

13.

Jacoby

Strahilevitz

Hooper

. Plasmid-mediated quinolone resistance. Microbiol Spectr. 2014;2:664-689.

14.

Braz

Melchior

Moreira

. Escherichia coli as a multifaceted pathogenic and versatile bacterium. Front Cell Infect Microbiol. 2020;21(10):548492.

15.

Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing. In: Tertel

Jenkins

CEM

Leirer

Martin

, eds. 99th CLSI Supplement M100. Clinical and Laboratory Standards Institute; 2024; 1–416.

16.

Gugliandolo

Lentini

Spanò

Maugeri

. Conventional and molecular methods to detect bacterial pathogens in mussels. Lett Appl Microbiol. 2010;52(15-21):15-21.

17.

Janezic

Ferry

Hendricks

, et al. Phenotypic and genotypic characterization of Escherichia coli isolated from untreated surface waters. Open Microbiol J. 2013;7(1):9-19.

18.

Tsai

Yan

. Prevalence of plasmid-mediated quinolone resistance determinants qnrA, qnrB, and qnrS among clinical isolates of Enterobacteriaceae in a Taiwanese hospital. Antimicrob Agents Chemother. 2007;51(4):1223-1227.

19.

Kim

Park

Kim

Jacoby

Hooper

. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother. 2009;53(639-645):639-645.

20.

Kirby-Bauer

. Antimicrobial sensitivity testing by agar diffusion method. J Clin Pathol. 1996;44:493-528.

21.

Krumperman

. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl Environ Microbiol. 1983;46(1):165-170.

22.

Baggio

Ananda-Rajah

. Fluoroquinolone antibiotics and adverse events. Aust Prescr. 2021 Oct;44(5):161–164. doi: 10.18773 austprescr.2021.035. Epub 2021 Oct 1. PMID: 34728881; PMCID: PMC8542490.

23.

Rahman

Hollis

. The effect of antibiotic usage on resistance in humans and food-producing animals: a longitudinal, one health analysis using European data. Front Public Health. 2023;11:1170426.

24.

Mehanni

Gadow

Alshammari

, et al. Antibiotic-resistant bacteria in hospital wastewater treatment plant effluent and the possible consequences of its reuse in agricultural irrigation. Front Microbiol. 2023;14:18.

25.

Poirel

Rodriguez-Martinez

Mammeri

Liard

Nordmann

. Origin of plasmid-mediated quinolone resistance determinant QnrA. Antimicrob Agents Chemother. 2023;49(8):3523-3525.

26.

Diwan

Chandran

Tamhankar

Stalsby Lundborg

Macaden

. Identification of extended spectrum β-lactamase and quinolone resistance genes in Escherichia coli isolated from hospital wastewater from central India. J Antimicrob Chemother. 2012;67:857-859.

27.

Ranjbar

Behnood

Memariani

Najafi

Moghbeli

Mammina

. Molecular characterisation of quinolone-resistant Shigella strains isolated in Tehran, Iran. J Glob Antimicrob Resist. 2016;5:26-30.

28.

Robicsek

Sahm

Strahilevitz

Jacoby

Hooper

. Broader distribution of plasmid-mediated quinolone resistance in the United States. Antimicrob Agents Chemother. 2005;49:3001-3003.

29.

Strahilevitz

Jacoby

Hooper

Robicsek

. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev. 2009;22:664-689.

30.

Shaheen

Nayak

Foley

Boothe

. Chromosomal and plasmid-mediated fluoroquinolone resistance mechanisms among broad-spectrum-cephalosporin-resistant Escherichia coli isolates recovered from companion animals in the USA. J Antimicrob Chemother. 2013;68(5):1019-1024.

31.

de Jong

Muggeo

El Garch

Moyaert

de Champs

Guillard

. Characterization of quinolone resistance mechanisms in Enterobacteriaceae isolated from companion animals in Europe (ComPath II study). Vet Microbiol. 2018;216:159-167.

32.

Yamane

Wachino

Suzuki

, et al. New plasmid-mediated fluoroquinolone efflux pump, qepA, found in an Escherichia coli clinical isolate Escherichia coli. Antimicrob Agents Chemother. 2007;51:3354-3360.

33.

Yang

Nam

Lee

. Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea. Can J Infect Dis Med Microbiol. 2014;25(3):163-169.

34.

Joel

Akinlabi

Olaposi

Olowomofe

Adekanmbi

. High carriage of plasmid-mediated quinolone resistance (PMQR) genes by ESBL-producing and fluoroquinolone-resistant Escherichia coli recovered from animal waste dumps. Mol Biol Rep. 2024;16(1):424.