Abstract
Triptolide, which has been used to treat inflammatory diseases, has also been reported to inhibit proliferation of cancer cells. However, it can cause severe nephrotoxicity, limiting its clinical use. Here, nephrotoxicity of triptolide was observed in vivo and in vitro. Heat shock protein 72 (HSP72) was upregulated during kidney injury in rats. HSP72 partially protected human kidney proximal tubule cell lines HK-2 and HKC from triptolide-induced injury. Phospho-Raf, phospho-MEK and phospho-ERK were elevated in HK-2 cells that overexpressed HSP72 after either heat shock or triptolide treatment, and downregulated when HSP72 was repressed by siRNA. The participation of the MEK/ERK1/2 pathway was confirmed by exposure of the cells to the MEK inhibitor U0126. Collectively, our results suggested that HSP72 plays a protective role by means of the MEK/ERK pathway, against triptolide-induced kidney injury.
Triptolide, a diterpenoid triepoxide purified from the traditional medicinal herb Tripterygium wilfordii Hook. f. (TWHF), has been used in the treatment of autoimmune diseases including rheumatoid arthritis and encephalomyelitis, 1,2 due to its various advantages, such as inhibitory effects on a variety of proinflammatory cytokines and mediators and on the expression of adhesion molecules by endothelial cells. 3 Furthermore, because triptolide inhibits both Ca(2+)-dependent and Ca(2+)-independent pathways and affects T cell activation through inhibition of interleukin-2 transcription at a site different from the target of cyclosporin A, it can act as an immunosuppressive agent in organ and tissue transplantation.
Moreover, several reports have indicated that triptolide has several attractive features as an antitumor agent. It inhibits the proliferation of cancer cells in vitro and reduces the growth and metastasis of tumors in vivo. 4,5 In addition, in clinical trials in China, triptolide treatment achieved a total remission rate of 71% for mononuclocytic leukemia, and 87% for granulocytic leukemia, which was more effective than any other chemotherapeutic agent available at the time. 6 Triptolide may target multiple molecules that lead to cell cycle arrest and apoptosis induction that inhibits the growth of primary and metastatic tumors. For instance, triptolide induced human pancreatic cancer cells to undergo apoptosis by up-regulating the expression of apoptosis-associated caspase-3 and bax gene. 7,8 Cell cycle was arrested in G0-G1 phase in gastric cancer cells by suppression of several cell cycle promoting factors, such as cyclin A/cdk2, cyclin B/cdc2, cyclin D1, and c-myc, as well as the phosphorylated (nonfunctional) form of pRb. 9,10 It has been shown that triptolide affected pathways are critical to cell survival. Triptolide enhanced PS-341-induced apoptosis by means of PI3k/Akt/NF-kappaB pathways in human multiple myeloma cells. 11 Meanwhile, triptolide mediated sensitization of lung cancer cells to Apo.2L/TRAIL-induced apoptosis requires activation of ERK2. 12
However, during the broad application of triptolide in the Chinese clinical trials, severe side effects were observed. Acute renal failure (ARF) is a major complication of triptolide treatment that limits its use and increases the cost of treatment. 13,14 Of toxicity reports associated with triptolide treatment, 54.2% indicated nephrotoxicity, and 37.6% of the nephrotoxicity cases died from ARF. Further investigation showed that nephrotoxicity induced by triptolide is a complex phenomenon characterized by an increase in serum creatinine and blood urea nitrogen concentration, and severe proximal renal tubular necrosis followed by deterioration and renal failure. Dysfunction of glucose absorption, a parameter of kidney functions, attributed to triptolide treatment has not been reported. And the precise toxic mechanism remains unclear.
Heat shock proteins (HSPs), a type of molecular chaperone, are highly conserved proteins that function not only during heat stress, but also under normal cellular conditions. They are rapidly induced in cells in response to abrupt and adverse changes in the environment. 15–17 Mammalian HSPs are classified into 4 families according to their approximate molecular masses and degrees of homology.
The cytosolic 70-kDa heat shock proteins (HSP70s) are present in cells as 2 different, but closely related gene products: the stress-inducible HSP72 (known as HSP70), and the constitutively expressed HSP73 (known as the 70-kDa heat shock cognate protein, HSC70). 15 HSP70 protects cells including cancer cells against injury and death. 18 Furthermore, the induction of HSPs is thought to play a protective role in ischemic acute renal failure. Some findings suggest that HSP72 can attenuate cisplatin (CDDP)-induced nephrotoxicity. The protective effects of HSP72 are associated with an increased Bcl-2/Bax ratio and decreased apoptosis. 19 Although the underlying mechanism of this protection may or may not involve their chaperone roles, 20 HSPs show direct interference with cell death pathways, including apoptosis and necrosis. 21
The involvement of HSP72 in the reaction of kidney proximal tubule cells to triptolide treatment is unknown. We presumed HSP72 was crucial in leading to a protective reaction during nephrotoxicity induced by triptolide. MEK/ERK pathway, which is a key pathway for cells’ survival, 21 is activated by HSP72 and may be involved into this protection. In the present study, we treated rats and 2 human proximal tubule cell lines, HK-2 and HKC cells, with triptolide, and examined the expression of HSP72. We analyzed the relationship between the expression of HSP72 and triptolide-induced kidney injury. Finally, we investigated the role of the MEK/ERK cascade in protection of human kidney proximal tubule cells by HSP72 from the injury induced by triptolide.
Materials and Methods
Animal Treatment
Sprague-Dawley rats were housed in animal rooms set to a temperature of 23 ± 2°C with a relative humidity of 40–60% and artificial lighting for 12 hours a day. The animals received a nutritious granule diet (provided by the Center for Experiment Animals, the Fourth Military Medical University) and free access to water. Five rats were housed in each cage and allowed to adjust to the environment for 2 weeks.
Four-week-old rats were randomly divided into 4 groups of 5 animals per sex. And were treated by oral gavage using stainless steel needles with either distilled water (Group 1 control) or triptolide at doses of 30, 100, and 300 mg/kg/day (Groups 2–4) for 7 days. Triptolide was dissolved in distilled water. All animals were fasted 24 hours before treatment.
Biochemical Examination
Biochemical analysis of serum samples was performed using an automatic chemistry analyzer (Roche Integra 400 Plus, Germany). Biochemical parameters measured were albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (BIL-T), total proteins (TP), blood urea nitrogen (BUN), creatinine (CRE), and glucose (GLU).
Cell Culture and Treatments
HK-2 cells and HKC cells, which are both immortalized proximal tubule cell lines derived from normal adult human kidney, were provide by Professor Falei Zheng in Beijing Union Medical College. Cells between 5th and 15th generation were cultured in DMEM medium with 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin (GiBco BRL Grand Island, NY), 95% air with 5% CO2, at 37°C. For treatment of heat shock (HS), cells were incubated in water bath at 43°C for 30 minutes.
Knockdown Assays
HK-2 and HKC cells were transfected with small interfering RNA (siRNA) targeting HSP72 at a concentration of 100 nmol/L with siPORT NeoFX Transfection (Ambion). Control cells were transfected with negative control siRNA. At 24 hours post-transfection, cells were equilibrated for 24 hours in serum-free DMEM before heat shock (HS) (43°C for 30 minutes) or normothermia (37°C for 30 minutes). Preliminary observations had demonstrated that HSP72 expression reached a peak 8 hours after HS. Therefore, 8 hours after each thermal treatment, cells were collected to assess HSP72 expression. Three sequences of the human HSP72 gene were selected as targets for RNAi:
Si1 (start 474): CAGGTGATCAACGACGGAGAC Si2 (start 1961): GAAGGACGAGTTTGAGCACAA Si3: (start 492): CGACGGAGACAAGCCCAAGGT Unrelated negative control sequence: AAG GCTCCTCAGAAACAGCTC
Western Blotting
HK-2 and HKC cells were treated as described above. To harvest proteins, cells were trypsinized and centrifuged at 1000 rpm at 4°C for 5 minutes. Pellets were lysed in 125 mM Tris, 4% (w/v) SDS, 20% (v/v) glycerol, 100 mM DTT and 0.2% (w/v) bromophenol blue. Whole cell lysates were separated by 12% SDS-PAGE and transferred to PVDF membranes (Amersham Bioscience, Munich, Germany). Membranes were blocked in Tris-buffered saline containing 0.01% Triton (v/v) and 5% (w/v) non-fat dry milk for 1 hours at 4°C, followed by incubation in the same buffer containing first antibody (see below) or control anti-tubulin (1:10 000) antibody overnight at 4°C. Secondary antibodies were ECL anti-rabbit IgG or ECL anti-rat IgG peroxidase linked antibodies (1: 10 000). Chemiluminescence signals were detected with X-ray film. Bands were scanned and quantified with the program QuantityOne (BioRad, Munich, Germany). Anti-ERK1/2, anti-MEK1/2, anti-Raf, anti-phospho-ERK1/2 (Thr202/Tyr204), anti-phospho-MEK1/2 (Ser217/Ser221), and anti-phospho-c-Raf (Ser338) were purchased from Cell Signaling Technology (Beverly, MA). Anti-SGLT1 and anti-SGLT2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
MEK/ERK Inhibitor Treatment
U0126 (Calbiochem), a specific MEK/ERK inhibitor, was prepared as a 10 mM stock solution in DMSO. For analysis of MEK-ERK pathway inhibition, cultured cells were treated with the inhibitor in the final concentration of 50 μM with 5% DMSO for 4 hours. Control cells were treated with 5% DMSO alone.
MTT Assay
Cells were plated at 5 × 104 cells/well in 96-well plates. Twenty-four hours later, cells were exposed to triptolide at 3, 10, or 30 nM for 24 hours, 48 hours, or 72 hours. Triptolide was dissolved in PBS. Control cells were treated with vehicle alone. Twenty microliters 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (5 g/L) was added to each well and incubated for 4 hours before each end point. Supernatant was then removed, 100 μL DMSO was added, then shaken for 10 minutes until the crystal was dissolved. Cell growth state was completed using A 490 nm value (mean ± SD) as the ordinate.
Measurement of Lactate Dehydrogenase (LDH) Release
HK-2 and HKC cells were seeded into 24-well plates at 1 × 105 cell/mL, and allowed to grow for 24 hours. Cell viability after incubation was estimated by determining the release of LDH from the cells, measured as LDH activity in media. LDH was measured spectrophotometrically by NADH oxidation at 440 nm.
N-acetyl-β-D-glucosaminidase (NAG) Activity Assay
NAG activity was determined as liberation of 4-methylumbelliferone at pH 4.5 from 4-methylumbelliferyl-N-acetyl-β-D-glucosaminide by NAG. One unit of NAG activity was defined as catalyzing the liberation of 1 μmol of 4-methylumbelliferone per minute at 37°C. Protein was measured at 400 nm by a modified method of Bradford using Bio-Rad Protein Assay (Bio-Rad, Richmond, CA).
Glucose Uptake Assay
Glucose uptake was performed as previously described with minor modification. 23 In brief, cells were cultured in 6-well plate for 24 hours, then HS for 30 minutes, followed by exposure to triptolide and U0126 for 30 minutes. After pretreatment, cells were detached by 0.25% (w/v) trypsin and suspended in Kreb’s Ringer HEPES and 2-deoxy-D-[H3]glucose (2 μCi/rxn) was added for 10 minutes at 37°C. The reactions were quenched with ice-cold 200 μM phloretin (Calbiochem), washed to separate cells from remaining radioactivity, and cells were solubilized with 1 M NaOH before measurement of radioactivity transported into cells with a scintillation counter (LS6500, Beckman Coulter). Finally, samples were assayed for 2-[14C] DOG uptake as disintegrations per minute per milligram protein. Protein concentration was determined by BCA assay.
Statistical Analysis
The data were analyzed by SPSS software. Quantitative data were assessed using the method of Bartlett’s test (one side). If homogeneous, the data were analyzed with Dunnett’s multiple comparison test (one side); if not homogeneous, data were analyzed with Steel’s test (one side). Results were considered statistically significant when P < .05.
Results
Nephrotoxicity of Triptolide in Rats and Kidney Proximal Tubule Cell Lines
We investigated nephrotoxicity of triptolide both in vivo and in vitro. In vivo, throughout the administration period, no significant clinical signs were observed. There was no difference in food consumption and body weight between control group and triptolide-treated groups and no dramatic difference in each parameter was found between male and female rats. However, severe alterations in kidney function were found after rats were orally administrated triptolide. After 7 days of treatment, BUN in the blood serum increased significantly compared with the control (P < .01), in the groups receiving 100 mg/kg and 300 mg/kg. Similarly, CRE in the blood serum increased significantly (P < .01), in a dose-dependent manner, with triptolide treatment. Decrease of glucose concentration in blood indicated possible malfunction of glucose uptake in kidney after rats were treated by triptolide in dosage of 300 mg/kg for 7 days. However, no changes in liver parameters were observed after treatment (Table 1).
The cytotoxicity of triptolide in HK-2 and HKC cells was assessed by MTT reduction, LDH release and NAG activity. After exposure to triptolide at 3 nM, 10 nM, or 30 nM, for 24 hours, 48 hours or 72 hours, MTT reduction was assayed (Figure 1A and B). In both HK-2 and HKC cells, MTT uptake decreased gradually from 24 hours to 72 hours after triptolide treatment (P < .01). Dose-dependent increase of LDH release and NAG activity after triptolide treatment were also observed (Figure 1C–F). All these results showed cytotoxicity of triptolide to kidney proximal tubule cells.
Induction of HSP72 by HS Protects Kidney Proximal Tubule Cells From Triptolide-Induced Kidney Injury
Because HSP70 family proteins may have a protective effect on nephrotoxicity, we evaluated the alteration of HSP72 expression in triptolide-treated rat kidneys. As shown in Figure 2A, expression of HSP72 in the rat kidney cortex increased strikingly after 7 days of triptolide administration at dosages of 30, 100, and 300 mg/kg. We next investigated the antagonistic effect of HSP72 on nephrotoxicity in HK-2 and HKC cells. To increase cellular HSP72 levels in a physiologically relevant way, HK-2 cells were pretreated with mild heat shock (43°C for 30 minutes) followed by recovery for 16 hours. HS produces a greater induction of HSP72 than triptolide. Nevertheless, combination of HS and triptolide has a lower effect on HSP72 expression than each treatment alone (Figure 2B and C). In other treated cells, cells were either transformed by HSP72 RNAi, or exposed to triptolide, followed by HS. In control cells, mild heat treatment led to a marked HSP72 build-up, while accumulation of HSP72 in cells expressing HSP72 siRNA was strongly reduced. Heat-shocked HK-2 and HKC cells exposed to triptolide at 100 μg/mL for 48 hours showed high MTT uptake, indicating high cell survival (Figure 2D and E). MTT uptake was lower in cells treated with triptolide only. This suggested that increased expression of HSP72 significantly inhibited cell death. Conversely, cells in which HSP72 was suppressed by siRNA, showed a decrease in survival after treatment with triptolide. These results showed that preinduction of HSP72 may protect cells from triptolide-induced injury.
HS or Triptolide Treatment Activates the MEK/ERK Signaling Pathway in Kidney Proximal Tubule Cells
HSPs may be part of the protection against stress that is regulated by the MAP kinase pathway. Thus, HSP72 accumulation during the heat shock pretreatment or the triptolide injury might be associated with accelerated MAP kinase activity. To investigate the role of HSP72 in stress protection of kidney proximal tubule cells, we evaluated the effect of HSP72 overexpressed by preheating, or repressed by siRNA, on MAP kinase activity. First, the alterations in HSP72 expression were confirmed by immunoblotting (Figure 2B). The same technique showed that Raf, MEK, and ERK levels did not change dramatically when HSP72 was either overexpressed or depleted. However, phospho-Raf and phospho-MEK were elevated in HK-2 cells with induction of HSP72 after HS or treatment with triptolide, and both decreased when HSP72 was knocked down in HK-2 cells (Figure 3). Similarly, overexpression of HSP72 after either HS or treatment of triptolide increased the activity of ERK, and activity was repressed when HSP72 expression was suppressed. This suggested a role for HSP72 in the activation of Raf/MEK/ERK.
MEK/ERK Pathway Protects Kidney Proximal Tubule Cells From Triptolide-Mediated Toxicity
To investigate the relationship of HSP72 and the MEK/ERK pathway, we treated HK-2 cells with the MEK/ERK inhibitor U0126 for 4 hours. No effect was seen on the expression of HSP72 (data not shown). We next investigated the protective effect of heat shock pretreatment on cell survival after triptolide or U0126 treatment. The MTT uptake, LDH release and NAG activity data in Figure 4 show that HS could protect kidney cells from triptolide-induced injury. However, blocking the ERK pathway with 50 μM U0126 abolished this protective effect. After exposure to 30 nM triptolide for 24 hours, MTT uptake, and thus cell survival, was markedly lower in cells in which the ERK pathway was inhibited by U0126. LDH release was higher after ERK activity was blocked, and similarly, NAG activity increased after inhibition of the ERK cascade. These results suggested MEK/ERK pathway plays a crucial role in the protective function of HSP.
HS or Triptolide Maintains Glucose Uptake Function by Means of the MEK/ERK Pathway in Kidney Proximal Tubule Cells
Uptake of glucose is one of the important functions of renal proximal tubule cells. In HK-2 and HKC cells, a decrease in glucose uptake was observed after cells were treated with triptolide (Figure 5A and B). Pretreatment with HS partially prevented the decrease of glucose uptake induced by triptolide. However, HS did not alleviate the reduction of glucose uptake after cells were cultured with U0126 to block the MEK/ERK pathway. Furthermore, both HK-2 and HKC cells exposed to triptolide showed a marked reduction in glucose uptake when the MEK/ERK pathway was blocked with U0126, compared with cells not treated with U0126. Knockdown of HSP72 expression did not affect glucose uptake.
We conducted Western blot analyses to test the effect of HSP72 on the expression of the SGLT Na+/glucose cotransporter proteins. As shown in Figure 5C, triptolide decreased SGLT1 and SGLT2 protein levels. On one hand, this repression was attenuated by HS, on the other hand, knock down HSP72 expression by RNAi blocked the protection induced by HS. Moreover, U0126 partially blocked HS effects on SGLT expression. Taken together, these data demonstrated that HSP72 protects the glucose uptake function of HK-2 cells by means of the MEK/ERK signaling pathway.
Discussion
The herbal medicine Tripterygium wilfordii has been used for more than 200 years in China. Several clinical trials have confirmed its efficacy in the treatment of rheumatoid arthritis and other autoimmune diseases. 1,2 One of its main active components, triptolide, shows anti-inflammatory, anticancer, immunosuppressive, and antifertility effects, all potentially attractive therapeutic features. 3–5 However, because of its severe toxicities, for instance a tendency to cause acute kidney failure, its clinical uses have been limited and the molecular mechanisms of its toxicities have remained unclear.
The readily inducible protein HSP72 can protect a variety of cells, including renal tubule cells, from thermal, toxic, and ischemic injuries. 24 Transfection of LLC-PK1 cells with HSP72 offers protection against CDDP-induced kidney tubule damage, 25 and increased levels of intracellular HSP72 correlate with resistance to CDDP in tumor cell lines. 26 Geranylgeranylacetone (GGA) ameliorated ischemic acute renal failure by means of induction of HSP70. Expression of HSP72 increased when cells were injured by gentamicin (GM) 27 and increased expression may protect cells from GM-induced damage. Conversely, HS may protect kidney cells from GM-induced injury. 28 However, whether overexpression of HSP72 could protect kidney proximal tubule cells from triptolide induced cytotoxicity was unknown.
In this study, oral administration of triptolide at dosages of 30, 100, or 300 mg/kg/day for 7 days resulted in kidney injury in rats. The values of urea nitrogen and creatine in blood serum increased pronouncely dose-dependently. This indicated renal dysfunction after treatment of triptolide in vivo. In vitro, reduction of MTT uptake and elevation of LDH release and NAG activity in human proximal tubule cells after triptolide treatment were observed. Taken together, these results suggested cytotoxic effect of triptolide in kidney. Furthermore, HSP72 expression increased in parallel with the degree of renal injury. Overexpression of HSP72 by HS may relieve triptolide toxicity in proximal tubule cells. We also found that knockdown of HSP72 expression by RNAi reduced the protective effects of HSP72, suggesting that HSP72 plays a crucial protective role in triptolide-induced kidney injury. Pre-induction of HSP72 by HS may provide a therapeutic strategy against nephrotoxicity induced by triptolide.
Both MAPK and HSP family members function in stress-related pathophysiological cell states, and play critical roles in maintaining normal cellular properties. The importance of MAPK signaling pathways, including extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 in intracellular signaling have been well established. ERK is one of the most thoroughly described members of the MAPKs. A variety of HSP72 effects on MAPK activation in response to various stimuli have been found. For example, HSP72 inhibits lipopolysaccharide (LPS)-induced production of inflammatory cytokines in a MAPK-independent manner. Moreover, HSP72 elevated by HS prevents cell death by suppressing JNK. 29,30
The ERK cascade functions in cellular proliferation, differentiation, and survival and is inappropriately activated by various stress stimuli as well, including heat stress, ischemia, and reactive oxygen species. Interactions between members of the HSP family and ERK MAPKs are well established. The ERK signaling pathway induces HSP70 expression by acting on the phosphorylation of HSF1. 3 On the other hand, inactivation of ERK represses HSP70 in response to divergent stressors. 31–33 In this study, however, we found overexpression of HSP72 by HS elevated phosphorylation of Raf, MEK1/2, and ERK1/2. Conversely, deletion of HSP72 expression by siRNA targeting decreased phophorylation of Raf, MEK1/2, and ERK1/2. HSP90 (called HSP83 in Drosophila), another member of HSP family, has been reported to bind and activate Raf-1 by means of phophorylation. 34 Whether HSP72 binds, directly or indirectly, to Raf to activate MEK/ERK is remained for further investigation.
We presumed that inactivation of the MEK/ERK pathway might abrogate the protective effects of HSP72 on HK-2 cells exposed to triptolide. Our results showed that triptolide inhibited the survival of human kidney tubule cells, and an increase in LDH release and NAG activity indicated cell membrane damage as a cause of triptolide cytotoxicity in proximal tubule cells. Although a protective function for HSP72 was demonstrated, this was abrogated by U0126 inhibition of MEK phosphorylation, as indicated by increased LDH release and NAG activity with U0126 treatment. Similar results were found after expression of HSP72 was blocked by siRNA. These results point to a protective role for HSP72 that involves the MEK/ERK pathway, against triptolide-induced nephrotoxicity. Activation of ERK2 is required for triptolide mediated apoptosis in lung cancer cells. 12 Dudeja et al recently reported 18 that HSP70 inhibited apoptosis in cancer cells by attenuation of cytosolic calcium and stabilization of lysosomes. This could be another mechanism for elevation of HSP72 to protect kidney cells from tripolide-induced injury.
Glucose re-absorption is 1 of the kidney proximal tubule functions. 35 Cotransport of glucose and sodium ions across the apical surface of the cells provides the energy for a facilitative transporter in the basal membrane. The 2 Na+-glucose transporters, SGLT1 and SGLT2, have very closely related amino acid sequences (almost 60% identity), although their properties differ significantly. 36,37 Inhibition of MEK with either PD-98059 or U-0126 markedly reduced insulin-stimulated glucose uptake in 3T3-L1 adipocytes in a dose-dependent manner. In this study, glucose concentration in blood serum of rats decreased by treatment of triptolide. Moreover, triptolide incubation inhibited HK-2 and HKC cells from accumulating glucose. These results suggest triptolide can decrease glucose re-absorption in kidney proximal tubule cells, resulting in the decrease serum glucose concentration. Furthermore, incubation of U0126 abolished HS-induced rescue of glucose uptake in HK-2 and HKC cells after triptolideinduced cytotoxicity. Moreover, Western blot analysis of cell membrane fractions demonstrated that rescue of SGLT1 and SGLT2 protein levels by HS was blocked by incubation with U0126, indicating a role for activation of the MEK/ERK pathway on the expression of Na+/glucose cotransporter proteins. Previous reports demonstrated that several proinflammatory cytokines markedly upregulated SGLT1 expression, 38 and that SGLT1-mediated glucose uptake protected intestinal epithelial cells against LPS-induced apoptosis. 39 IL-6 increased SGLT activity through ROS, and its action is associated with the STAT3, PI3K/Akt, MAPKs, and NF-κB signaling pathways in renal proximal tubule cells. 40 Functional effects of HSP72 on SGLT expression have not been clarified. Our present study showed that overexpression of HSP72 could partially rescue SGLT expression that was blocked by triptolide treatment. This protective effect was inhibited either by HSP72 RNAi knock down, or by U0126. Therefore, HSP72 may protect the glucose uptake function of proximal tubule cells by modulating the MEK/ERK pathway and thereby regulating the number of cotransporters in the plasma membrane. This occurs through regulation of exocytosis and endocytosis. 41 In any case, our finding that the activity of the MEK/ERK pathway is upregulated by HSP72 may be relevant to HSP72-mediated renal protection.
In summary, this study investigated the nephrotoxicity of triptolide. Overexpression of HSP72 by HS relieved triptolide-induced effects on proximal tubule cell lines. siRNA targeting of HSP72 reduced most of the protective effects produced by HS, including Raf, MEK, and ERK phosphorylation and cell survival, suggesting a significant protective role of HSP72 in triptolide-induced renal injury. Blocking the MEK/ERK pathway with U0126 abrogated the protective function of HSP72. Taken together, the data implicate HSP72 in a protective role against triptolide-triggered nephrotoxicity, through involvement of the MEK/ERK signaling pathway.
Footnotes
Figures and Table
Acknowledgements
Zhipeng Wang and Haifeng Jin contributed equally to this work.
