Abstract
Two captive vulturine guineafowl (Acryllium vulturinum) were presented with lethargy, hyporexia, weight loss, and progressive neurologic signs. One of the guineafowl was seropositive for Sarcocystis falcatula (1:50 dilution). Both guineafowl died within 5 d of presentation. Histologic examination revealed nonsuppurative meningoencephalitis with gliosis, associated with occasional schizonts in the neuropil. Using fresh-frozen brain tissue, PCR was performed to amplify the ITS1 RNA region and portions of the 18S ribosomal RNA gene (18S gene) and the 28S ribosomal RNA gene (28S gene). Analysis of nucleic acid sequences from the resulting amplicons indicated that Sarcocystis calchasi was the likely cause of disease. To our knowledge, S. calchasi–associated disease has not been reported previously in the order Galliformes.
Sarcocystis spp. are protozoa in the phylum Apicomplexa, and have an obligatory 2-host life cycle. 3 The life cycle involves a definitive host, often a carnivore or omnivore, and an intermediate host, often an omnivore or herbivore, that is infected by ingesting sporocysts by the fecal-oral route or by an invertebrate mechanical vector.1–3 S. calchasi has been identified as the causative agent of pigeon protozoal encephalitis (PPE) in Germany, with raptors of Accipiter spp. identified as definitive hosts.9,11,12,14 Outside Europe, S. calchasi–associated encephalitis has been identified in Japan and the United States in the orders Columbiformes, Piciformes, Psittaciformes, and Suliformes.1,4,8,13,15–19 S. calchasi–associated disease could not be experimentally induced in chickens (Gallus gallus f. domestica). 10 To our knowledge, S. calchasi–associated disease has not been reported previously in the order Galliformes.
Case 1 was a captive, 3.5-y-old, female vulturine guineafowl (Acryllium vulturinum) that was presented after being found unable to stand. The bird was seronegative for antibody against Newcastle disease virus (NDV; Paramyxoviridae, Orthoavulavirus, Avian orthoavulavirus 1; <1:8 dilution; hemagglutination-inhibition assay for avian paramyxovirus serotype 1, National Veterinary Services Laboratory [NVSL], Ames, IA, USA) and Marek disease virus (MDV; Herpesviridae, Mardivirus; agar gel immunodiffusion assay, NVSL). Lead (<0.02 ppm) and zinc (2 ppm) assays on whole blood were below the level of detection (LOD) and clinically insignificant (Louisiana Animal Disease Diagnostic Laboratory, Baton Rouge, LA, USA). An indirect immunofluorescence assay (indirect IFA) for S. falcatula was positive (1:50 dilution; Avian and Wildlife Laboratory, University of Miami, Miami, FL, USA). Treatment included ponazuril (Marquis, Merial; 20 mg/kg PO q12h). Despite treatment, the guineafowl’s clinical signs progressed to include falling to the left on day 2, left lateral recumbency with normal head posture on day 3, torticollis on day 4, and death on day 5. Also on day 4, case 2, a 2.5-y-old, male vulturine guineafowl, which was co-housed with case 1 in an aviary with other birds, was presented with lethargy, hyporexia, and weight loss. Case 2 died within 8 h of presentation.
On postmortem examinations, cases 1 and 2 had no macroscopic lesions. Histologic examination of case 1 revealed moderate nonsuppurative meningoencephalitis with multifocal perivascular lymphoid cuffing and glial nodules in the cerebrum, midbrain, and optic lobes; moderate lymphohistiocytic optic nerve meningitis with mild gliosis in the tract; moderate lymphohistiocytic thyroiditis; and ovarian follicular degeneration with focal coelomitis. The cerebellum and brainstem were not examined. Case 2 had severe nonsuppurative meningoencephalitis with multifocal perivascular lymphoid cuffing, microglial nodule formation, neuronal necrosis, axonal degeneration, and white matter vacuolation primarily in the brainstem, cerebellum, and midbrain, and to a lesser degree in the cerebrum and optic lobes (Fig. 1). Occasional protozoan schizonts were present in areas of inflammation. In some of the schizonts, merozoites were oriented around a central residual body (Fig. 1). Mild perivascular lymphoid cuffing was noted in the optic nerve and meninges of the optic nerve. No lesions were evident in skeletal muscle or heart of either bird. Immunohistochemical (IHC) stains using monoclonal antisera against S. neurona (Michigan State University Veterinary Diagnostic Laboratory [MSU-VDL], East Lansing, MI, USA) were negative for sections of brain from cases 1 and 2. In addition, sections of brain from case 1 were IHC-negative for NDV antigen (California Animal Health & Food Safety Laboratory, Davis, CA, USA), avian influenza A virus (IAV) antigen, West Nile virus (WNV) antigen, and eastern equine encephalitis virus (EEEV) antigen (MSU-VDL). Finally, brain tissues from cases 1 and 2, frozen at −80°C for 21 mo, were PCR-negative for NDV, IAV, WNV, and EEEV (MSU-VDL).

Fatal Sarcocystis calchasi–associated meningoencephalitis in captive vulturine guineafowl, case 2.
Brain tissues from cases 1 and 2, which were frozen at −80°C for 10 d, were tested for Sarcocystis spp. DNA using PCR assays. Extraction of DNA was performed using 200 µL of a 10% homogenate of brain tissue in Bovarnick buffer and the DNeasy blood and tissue kit (Qiagen) as directed by the manufacturer. Two conventional PCR assays were used that targeted either the 18S ribosomal RNA gene (18S gene) or the internal transcribed spacer 1 (ITS1) region, including portions of the flanking 18S and 28S genes. Both assays detect numerous species of Sarcocystis. The forward and reverse primers for the 18S gene were GAATTCTGGCATCCTCCTGA and CCTACG GAAACCTTGTTACG, respectively. For the ITS region, the forward and reverse primers were TGCGGAAGGATCATTCA CAC and CCAAGACATCCATCGCTGAAA, respectively. The chemistry used was AmpliTaq Gold 360 master mix (Thermo Fisher), and the PCR cycling conditions for both PCR assays were 1 cycle at 94°C for 4 min, followed by 45 cycles of 94°C for 45 s, 50°C for 45 s, 72°C for 75 s, and a final extension step of 72°C for 5 min. The amplicons produced were 1,002 bp or 973 bp from the 18S gene and 812 or 774 bp from the ITS1 and flanking regions, for cases 1 and 2, respectively. The amplicons were submitted to the Research Technology Support Facility at MSU for Sanger sequencing in each direction.
BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for analysis of the derived sequences. For the 18S gene, there was a 100% match where the sequences from each case overlapped, and the overlapped sequence was most similar (99.9%) to corresponding sequences from Sarcocystis species halieti, lutrae, corvusi, columbae, and sp. ex Columba livia. It is important to note that, after the deposit of nucleic acid sequences from S. sp. ex Columba livia in GenBank, that organism was determined to be S. calchasi.9,11 For the ITS region, the derived sequences from each case were a 100% match where they overlapped, and the overlapped sequence was most similar to corresponding sequences from several submissions of S. calchasi and from S. sp. ex Columba livia (99.26–99.22%). The next highest similarity was to S. wobeseri (93.16–92.92%). Taken together, the nucleic sequence analyses indicate that the Sarcocystis infecting the 2 guineafowl was S. calchasi.
Our 2 cases expand the known intermediate host profile of S. calchasi given that this infection has not been reported in birds of the order Galliformes, to our knowledge. Antemortem diagnosis of Sarcocystis spp. infection, in these cases, was assisted by serology; case 1 was indirect IFA–positive to S. falcatula, but seronegative to NDV and MDV, with plasma lead levels below the LOD. It is known that S. neurona antigen can cross-react serologically to S. falcatula, and, although it has not been investigated fully, it would seem plausible that S. calchasi can do so as well (Cray C, pers. comm., 2020 Dec 08). Moreover, with IHC staining, it has been reported that there is no cross-reactivity between S. falcatula and S. calchasi. 15 In these cases, ponazuril therapy failed. This therapeutic outcome is not surprising because, although S. falcatula is considered sensitive to ponazuril and its metabolite toltrazuril, treatment of experimental S. calchasi infection in domestic pigeons (syn. rock pigeon; Columba livia) with toltrazuril is reported to be ineffective. 7
Postmortem diagnosis of S. calchasi–associated meningoencephalitis was based on histologic and molecular findings. Involvement of NDV, IAV, WNV, and EEEV was ruled out in both cases by IHC staining and PCR on brain tissue. Case 1 had significant neurologic signs, moderate meningoencephalitis, and no schizonts present in histologic sections; however, the brainstem and cerebellum were not available for histologic examination. Case 2 had nonspecific clinical signs with severe meningoencephalitis and occasional schizonts present in the cerebellum and brainstem. Despite the quick, fatal timeline, it is surprising that case 2 did not have more severe clinical signs associated with the brain lesions. IHC staining in our report corroborates that S. calchasi schizonts do not react with S. neurona antibodies.15,16 Both birds were positive by PCR and nucleic acid sequencing for S. calchasi. Our molecular findings are consistent with experimental inoculation studies in domestic pigeons in which PCR for S. calchasi has been found to be more sensitive than histologic examination for identifying the specific cause of the meningoencephalitis in some cases. 6
The route of exposure for the 2 vulturine guineafowl is uncertain. Cases 1 and 2 were a pair of birds that were moved to a new aviary building 19 d prior to illness; the indoor spaces had a hard roof, but the outdoor spaces were mesh-topped. The guineafowl were housed with birds of the orders Coraciiformes (Coracias cyanogaster) and Musophagiformes (Tauraco leucotis), and adjacent to birds of the orders Columbiformes (Turtur tympanistria and Streptopelia capicola), Cuculiformes (Coua cristata), and Falconiformes (Falco mexicanus). None of these co-housed birds were tested for exposure to Sarcocystis spp., and none of these birds later developed any nonspecific or neurologic clinical signs. The F. mexicanus was euthanized because of degenerative orthopedic disease 5 mo after the 2 sarcocystosis cases, and no evidence of Sarcocystis infection was identified on histopathology, which included evaluation of the gastrointestinal tract, cardiac muscle, and skeletal muscle. None of the other co-housed birds have died since this disease event.
It is reported that hawks of the genus Accipiter are definitive hosts for S. calchasi from Europe and Sarcocystis sp. ex Accipiter cooperii, a species closely related to S. columbae, in the United States.5,11,14 Free-ranging hawks were suspected to be associated with fatal S. calchasi infections in another North American zoologic collection, 16 and, historically, free-ranging A. cooperii (Cooper’s hawk) had been seen perching and flying near the outdoor portion of the guineafowl aviary of our report. These A. cooperii could have been the source of infection in these cases. It is notable that the adjacent-housed doves were unaffected; S. calchasi–associated disease is well documented in other species of this order.4,8,13,16,17,19 Given that guineafowl are ground-feeders and the doves were fed above the ground, we speculate that transmission was via fecal contamination of the guineafowl feed or consumption of a mechanical, invertebrate vector, such as a cockroach, which were known to be present in this aviary. 2 Improved exclusion of definitive hosts of S. calchasi from areas in which susceptible animals are housed, serologic screening of co-housed birds in mixed-species aviaries, and integrated pest management to remove mechanical vectors may all be strategies that could help mitigate the risk of S. calchasi–associated disease in avian collections.
Footnotes
Acknowledgements
We thank Cathy Minogue and Christie Buie of Northwest ZooPath for data retrieval and image layout, respectively. We also thank Leroy Brown of Histology Consulting Service for initial slide preparations.
Declaration of conflicting interests
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The authors received no financial support for the research, authorship, and/or publication of this article.
