Long non-coding RNA SPRY4-IT1 promotes proliferation and invasion by acting as a ceRNA of miR-101-3p in colorectal cancer cells

Abstract

Long non-coding RNAs are associated with a spectrum of biological processes such as gene regulation on transcriptional and post-transcriptional levels. Increasing evidence indicates that SPRY4-IT1 plays an important role in carcinogenesis, and the mechanisms whereby SPRY4-IT1 induces colorectal carcinoma progression remain largely unknown. The aim of this study is to evaluate the expression and function of SPRY4-IT1 in colorectal carcinoma. In this study, we analyzed SPRY4-IT1 expression levels in a series of colorectal carcinoma patients by quantitative reverse transcription polymerase chain reaction. Knockdown of SPRY4-IT1 by RNA interference was performed to explore its roles in cell proliferation, migration, and invasion. Our results found that SPRY4-IT1 was upregulated in human primary colorectal carcinoma tissues. Knockdown of SPRY4-IT1 inhibited colorectal carcinoma cell proliferation, migration, and invasion. Moreover, we confirmed that the expression of epithelial–mesenchymal transition–related genes was modulated through alteration of SPRY4-IT1 expression. SPRY4-IT1 could negatively regulate the expression of miR-101-3p in colorectal carcinoma cells. The bioinformatics prediction revealed putative miR-101-3p binding sites within SPRY4-IT1 transcripts. Above all, knockdown of SPRY4-IT1 could represent a rational therapeutic strategy for colorectal carcinoma.

Colorectal cancer (CRC) is more prevalent in developed countries. ¹ The accumulation of genetic and epigenetic alterations mediates CRC formation and progression by deregulating key signaling pathways. ² Thanks to the development of chemoradiotherapy in combination with conventional surgery, the averaged 5-year survival for patients with CRC are gradually increasing during past decades.^3,4 However, the exact molecular mechanisms contributing to CRC carcinogenesis remain unknown. There is an urgent need to understand the genetic alterations and molecular mechanisms of CRC.

Long non-coding RNAs (lncRNAs, >200 nucleotides in length) are important new members of the family of ncRNAs with limited or no protein-coding capacity. ⁵ Emerging evidence suggests that lncRNAs that have important biological functions are closely related to human cancer. ⁶ LncRNAs also function as a competing endogenous RNA (ceRNA) and sponge micro RNAs (miRNAs), thus regulating the expression of target messenger RNA (mRNA).^7,8 LncRNA SPRY4-IT1 is transcribed from the second intron of the SPRY4 gene and regulates the cell growth, invasion, and elevated rates of apoptosis. ⁹ However, the roles of lncRNA SPRY4-1T1 in CRC progression and the related mechanisms are still unclear. In this study, we explored the role of SPRY4-IT1 in the regulation of proliferation, migration, and invasion of CRC.

Materials and methods

Human tissue

CRC tissues and paired adjacent noncancerous tissues were obtained from 88 patients undergoing surgical procedures at First Affiliated Hospital, Henan University of Science and Technology. Both tumors and noncancerous tissues were subjected to histological analysis for diagnostic confirmation. The pathological type of each cancer was identified as adenocarcinoma. After resection, all samples were immersed immediately in RNAlater solution (Ambion, Austin, TX, USA) overnight and then stored at −80°C in order to avoid degradation of RNA. Prior to the use of these clinical materials for research purposes, written consents from all patients and approval of First Affiliated Hospital of Henan University of Science and Technology Ethics Review Committees were obtained.

Cell lines and transfection

Four CRC cell lines (LoVo, RKO, SW620, and SW480) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI 1640 or Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Grand Island, NY, USA) medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco) in humidified air at 37°C with 5% CO₂.

For transfection, cells were seeded into plates in order to reach 30%–50% confluence and transfected with small interfering RNA (siRNA) negative control (siRNA-NC: GGCTACGTCCAGGAGCGCA), si-SPRY4-IT1-1(CCCAGAATGTTGACAGCTGCCTCTT), and si-SPRY4-IT1-2(TGGAGGGTTATGGGAGCCTGTGAAT) using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. Silencing or overexpression was validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR).

RNA extraction and qRT-PCR

Total RNA was extracted from approximately 0.1 g of placenta tissue or cells that were treated with TRIzol reagent (Invitrogen, Life Technologies). A Reverse Transcription Kit (Takara Biotechnology Co., Ltd.) was used for the synthesis of complementary DNA (cDNA) by adding 1 mg total RNA to the RT Reaction Mix. The amplification of cDNA was done by Power SYBR Green (Takara) in a total volume of 20 µL reaction mix for qRT-PCR. According to the manufacturer’s instruction, the reverse transcription was performed at 37°C for 15 min and 85°C for 5 s. In order to normalize the results for the qRT-PCR, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expressions were used. The sequence of the primers are as follows: SPRY4-IT1 (forward: 5′-AGCCACATAAATTC AGCAGA-3′, reverse: 5′-CGATGTAGTAGGATTCCTT TCA-3′) and GAPDH (forward: 5′-GACTCATGACCAC AGTCCATGC-3′, reverse: 5′-AGAGGCAGGGATGATG TTCTG-3′). An ABI 7500 was used to carry out the qRT-PCR and data collections. All experiments were performed three times independently, and the average was used for comparison.

Cell proliferation assays

An amount of 3000 cells per well were allowed to grow in 96-well plates with 5 replicate wells 48 h after transfection. After 6 h of culture, as well as at 24, 48, 72, and 96 h after starting the culture, the cells were treated with 100 μg 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) by adding it to the medium. The cells were incubated at 37°C for another 4 h, then the medium was removed, and dimethylsulfoxide (DMSO) was added for 10 min to lyse the cells. Finally, the absorbance was measured at 490 nm. All experiments were performed in triplicate.

Migration and invasion assay

Cell migration or invasion assays were performed using a 24-well Transwell chamber (Costar, Boston, MA, USA) with or without Matrigel coating. After 48 h, cells (4 × 10⁴) were detached and seeded into the upper chamber of an 8-μm pore size insert in the 24-well plate and cultured for another 12 h. The cells were allowed to migrate or invade the bottom chamber containing 15% FBS. The nonmigratory cells on the surface of the upper membrane were removed with a cotton tip, and the migratory or invasive cells attached to the lower membrane surface were fixed with 4% paraformaldehyde and stained with crystal violet. The number of migratory and invasive cells was counted in five randomly selected high-power fields under a microscope. The presented data represent three individual wells.

Western blot analysis

Cells were lysed in lysis buffer in the presence of aprotinin, leupeptin, phenylmethanesulfonyl fluoride (PMSF; Sigma), and phosphatase inhibitor cocktails II and III (Sigma). Proteins were quantified by Bradford method. Then, protein extracts were fractionated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (GE Healthcare, Piscataway, NJ, USA). The membrane was incubated with the following primary antibodies: anti E-cadherin, anti-N-cadherin, anti-vimentin (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-β-actin antibody (Cell Signaling Technology, Inc., Danvers, MA, USA). Binding of the primary antibody was detected using an enhanced chemiluminescence kit (Amersham ECL; Pierce, Biotechnology, Inc.).

Luciferase assay

The luciferase assays were carried out using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Briefly, cells were co-transfected with miR-101-3p or miR-control and wild-type or mutant SPRY4-IT1 fragment, using Lipofectamine 2000 (Invitrogen). Cells were collected and lysed for luciferase detection 48 h after transfection. The relative luciferase activity was normalized against the Renilla luciferase activity.

Statistical analysis

All the data were expressed as mean ± standard deviation (SD) and all the statistical analyses were performed using SPSS statistical software package (SPSS Inc., Chicago, IL, USA). Furthermore, p < 0.05 was considered statistically significant.

Results

LncRNA SPRY4-IT1 is highly expressed in CRC tissues

First, we analyzed the levels of SPRY4-IT1 in 88 CRC tumor and paired noncancerous tissues via qRT-PCR. The relative expression of SPRY4-IT1 in CRC tissues compared with normal tissues is shown in Figure 1(a). Compared with normal tissue, the SPRY4-IT1 expression level was significantly increased in 70.45% of CRC tissue samples (62/88), indicating that SPRY4-IT1 might play an oncogenic role in CRC. Furthermore, a correlation analysis of SPRY4-IT1 expression with clinicopathological parameters revealed that the SPRY4-IT1 expression level was predominantly increased in late-stage tumor tissues and positively correlated with tumor size.

Figure 1.

(a) SPRY4-IT1 was detected in CRC tissues and adjacent noncancerous tissues by qRT-PCR. (b) qRT-PCR showing expression level of SPRY4-IT1 in CRC cell lines.

SPRY4-IT1 is overexpressed in human CRC cell lines

We also evaluated the expression of SPRY4-IT1 in a panel of human CRC cell lines by qRT-PCR. The expression of SPRY4-IT1 was observed to be high in CRC cell lines. As shown in Figure 1(b), qRT-PCR results revealed that LoVo and SW480 cells showed higher expression of SPRY4-IT1; however, RKO showed lower expression of SPRY4-IT1. Thus, we used LoVo and SW480 cells as a model to investigate the effect of SPRY4-IT1 on cell proliferation, migration, and invasion.

SPRY4-IT1 regulates cell proliferation of CRC cells

To further examine whether SPRY4-IT1 is involved in CRC progression, in vitro functional analyses were performed. Knockdown of SPRY4-IT1 by RNA interference (RNAi) significantly decreased proliferation of SW480 and LoVo cells (Figure 2(a) and (b)).

Figure 2.

(a) MTT assay showing knockdown of SPRY4-IT1 inhibited cell proliferation of SW480 cells. (b) MTT assay showing knockdown of SPRY4-IT1 inhibited cell proliferation of LoVo cells.

SPRY4-IT1 regulates CRC cell invasion and epithelial–mesenchymal transition

Cell motility and invasiveness ability strongly correlate with cancer metastasis. Therefore, we next investigated the effect of SPRY4-IT1 on these characteristics of CRC cells. We found that SPRY4-IT1 knockdown dramatically decreased their migration and invasion capabilities. Quantification of invading cells revealed a significant decrease in the number of invading cells for both cell lines after SPRY4-IT1 knockdown (Figure 3(a) and (b)). To measure the effect of silencing SPRY4-IT1 expression on epithelial–mesenchymal transition (EMT) of CRC cells, western blot was performed to examine the expression of EMT-related markers in LoVo and SW480 cells after transfection with si-SPRY4-IT1. As expected, SPRY4-IT1 knockdown remarkably increased the expression of E-cadherin and meanwhile greatly decreased the expression of N-cadherin and vimentin in LoVo and SW480 cells, in comparison with control groups (Figure 4(a) and (b)). The results indicated that downregulation of SPRY4-IT1 obviously blocked the EMT process.

Figure 3.

(a) Inhibition of migration and invasion of SW480 cells by SPRY4-IT1 siRNA. (b) Inhibition of migration and invasion of LoVo cells by SPRY4-IT1 siRNA.

Figure 4.

(a) Knockdown of SPRY4-IT1 reverses EMT in SW480 cells. (b) Knockdown of SPRY4-IT1 reverses EMT in LoVo cells.

SPRY4-IT1 inhibited miR-101-3p expression in CRC cells

To investigate whether miR-101-3p was involved in the inhibitory effect of SPRY4-IT1 on CRC cells, we applied the online software starBase v2.0. The prediction showed that SPRY4-IT1 contains binding sequences complementary to miR-101-3p seed regions. For further confirmation, we used the luciferase assay to detect the association between SPRY4-IT1 and miR-101-3p. The results showed that overexpression of miR-101-3p reduced the luciferase activity of the pMIR luciferase reporter containing wild-type SPRY4-IT1 (WT-SPRY4-IT1) but not mutant reporter (MUT-SPRY4-IT1) vector (Figure 5(a)). Next, we measured the levels of miR-101-3p expression in various CRC cell lines. As shown in Figure 5(b), the expression of miR-101-3p was obviously decreased in LoVo and SW480 cell lines, indicating the opposite result to SPRY4-IT1 expression. In addition, we cloned the SPRY4-IT1 into pcDNA3.1 vector and co-transfected into LoVo and SW4803 cells with or without miR-101-3p overexpression. The results showed that overexpression of SPRY4-IT1 inhibited the miR-101-3p expression (Figure 5(c)). All these data demonstrated that SPRY4-IT1 associated with the miR-101-3p and may function as a ceRNA.

Figure 5.

(a) The wild-type or mutant miR-101-3p-binding sites in SPRY4-IT1 were inserted into pMIR-report luciferase vector. Luciferase activity was detected in CRC cells co-transfected with miR-101-3p or negative control (miR-control) and reporter plasmids containing WT-SPRY4-IT1 (wild type) or MUT-SPRY4-IT1 (mutant type). The normalized luciferase activity in the miR-control group was used as the relative luciferase activity. (b) Expression levels of miR-101-3p in different CRC cell lines were determined by qRT-PCR. (c) The co-transfection of miR-101-3p and SPRY4-IT1 by pcDNA3.1. The expression of miR-101-3p was detected by qRT-PCR. All tests were at least performed three times. Data were expressed as mean ± SD (*p < 0.05, **p < 0.01).

Discussion

Recent studies have indicated that many lncRNAs have been shown to aberrantly express in human cancers.^10,11 In CRC, the functions and molecular mechanisms of many lncRNAs have not been well characterized. Therefore, the identification of CRC-associated lncRNAs and investigation of their molecular and biological functions are urgent. SPRY4-IT1 (GenBank accession ID AK024556) is derived from the intronic region of the Sprouty4 gene and is predicted to contain several long hairpins in its secondary structure. ¹² Elevated expression of SPRY4-IT1 was involved in cell proliferation, migration, and apoptosis of various tumors. ¹³ SPRY4-IT1 was previously reported to be upregulated in melanoma cells, and knockdown of its expression led to inhibition of cell proliferation and invasion. Moreover, aberrant expression of SPRY4-IT1 was also found to contribute to the abnormal condition of trophoblast cells HTR-8/Svneo.^14,15 However, the influence of SPRY4-IT1 on CRC has been not reported. In this study, we explored the expression pattern of SPRY4-IT1 in CRC tissues and cell lines and investigated the effects of SPRY4-IT1 expression on CRC cell phenotypes in vitro. First, we measured the expression level of SPRY4-IT1 in clinical CRC tissues by qRT-PCR. We confirmed that SPRY4-IT1 is extremely upregulated in most of CRC tissues, compared with normal tissues, indicating that SPRY4-IT1 may primarily participate in CRC. Besides, SPRY4-IT1 was obviously upregulated in a panel of CRC cell lines. The qRT-PCR results revealed that LoVo and SW480 cells showed higher expression of SPRY4-IT1, and RKO showed lower expression of SPRY4-IT1.

We then determined whether SPRY4-IT1 expression influences tumor-like characteristics such as proliferation and apoptosis. Our results showed that knockdown of SPRY4-IT1 by siRNA in LoVo and SW480 cells was shown to significantly inhibit CRC cell proliferation, suggesting that SPRY4-IT1 may affect CRC progression by affecting cell proliferation.

Although SPRY4-IT1 is involved in metastasis of different cancers, little is known about the underlying molecular mechanism. EMT is an essential process for tumor invasion and metastasis. ¹⁶ In this study, we identified that knockdown of SPRY4-IT1 expression can suppress migratory and invasive phenotype of LoVo and SW480 cells. In accordance with this, knockdown of SPRY4-IT1 expression increased the expression levels of E-cadherin and meanwhile greatly decreased the expression of vimentin, indicating that SPRY4-IT1 affects CRC metastasis partly via the EMT.

The lncRNAs contain miRNA-responsive elements (MRE) and function as miRNA sponges to regulate endogenous miRNAs, thus reducing the miRNA-induced repression of their target mRNAs.^17,18 Inspired by the “competitive endogenous RNAs” regulatory network and emerging evidence that suggests that lncRNAs may participate in this regulatory circuitry, we hypothesized that SPRY4-IT1 may also serve as a ceRNA, and therefore, we searched for potential interactions with miRNAs. In support of this notion, we employed bioinformatics analysis and luciferase assays to validate the direct binding ability of the predicted miRNA response elements on the full-length SPRY4-IT1 transcript. As expected, we discovered that miR-101-3p could form complementary base pairing with SPRY4-IT1 and induce translational repression of a RLuc-SPRY4-IT1 reporter gene. To serve as an endogenous “sponge,” the abundance of SPRY4-IT1 should be comparable to or higher than miR-101-3p. MiR-101-3p acts on the “seed region” of a target gene to exert multiple biological effects. Our study showed that ectopic overexpression of SPRY4-IT1 inhibited miR-101-3p expression.

In summary, we have shown that SPRY4-IT1 exerted a crucial role in the proliferation and metastasis of CRC, indicating that SPRY4-IT1 may become a novel promising candidate for the therapy for CRC.