Portulaca oleracea extract can inhibit nodule formation of colon cancer stem cells by regulating gene expression of the Notch signal transduction pathway

Abstract

To investigate whether Portulaca oleracea extract affects tumor formation in colon cancer stem cells and its chemotherapy sensitivity. In addition, to analyze associated genetic changes within the Notch signal transduction pathway. Serum-free cultures of colon cancer cells (HT-29) and HT-29 cancer stem cells were treated with the chemotherapeutic drug 5-fluorouracil to assess sensitivity. Injections of the stem cells were also given to BALB/c mice to confirm tumor growth and note its characteristics. In addition, the effect of different concentrations of P. oleracea extract was tested on the growth of HT-29 colon cancer cells and HT-29 cancer stem cells, as determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method. The effects of P. oleracea extract on the expression of β-catenin, Notch1, and Notch2 in the HT-29 cells were studied using reverse transcription polymerase chain reaction and Western blotting. The tumor volume of the HT29 cells was two times larger than that of HT29 cancer stem cells. Treatment with P. oleracea extract inhibited the proliferation of both HT-29 cancer cells and HT-29 cancer stem cells at doses from 0.07 to 2.25 µg/mL. Apoptosis of HT-29 cancer cells and HT-29 cancer stem cells was assessed by flow cytometry; it was enhanced by the addition of P. oleracea extract. Finally, treatment with P. oleracea extract significantly downregulated the expression of the Notch1 and β-catenin genes in both cell types. The results of this study show that P. oleracea extract inhibits the growth of colon cancer stem cells in a dose-dependent manner. Furthermore, it inhibits the expression of the Notch1 and β-catenin genes. Taken together, this suggests that it may elicit its effects through regulatory and target genes that mediate the Notch signal transduction pathway.

Keywords

Colon cancer stem cells Notch signal transduction pathway

Introduction

Tumor stem cells are a small proportion of tumor cells that can self-renew, infinitely proliferate, and have the potential for multi-directional differentiation; they can initiate cells associated with carcinogenesis to maintain growth of the tumor.¹ It was once believed that tumor stem cells only existed in hematological and lymphocytic malignancies; however, it is now known that tumor stem cells affect all solid tumors as well.^2,3

Some cells present in human colon crypts can self-renew and differentiate. Mediated by a series of genes that maintain a dynamic balance in the colon, these stem cells play an important role in the regeneration and restoration of the organ. External forces, such as mutations of the NOTCH signal pathway, can have long-term effects when they impact colon stem cells. During a prolonged period of time, oncogene mutations can accumulate, promoting the transformation of stem cells as well as the asymmetric division of stem cells and ultimately lead to the production of colon cancer stem cells (CSCs). CSCs have the same self-differentiation and self-renewal characteristics of normal colon stem cells.⁴ In clinical practice, stem cells are noted to not invade the tumor but rather are present during the earliest stages of colon cancer. In addition, cancer stem cells are present only at the primary tumor site and are not found at distant metastases. One possible role of cancer stem cells has been suggested as a potential predictor of a high risk of relapse in patients who have had resected colorectal cancer. These cells have been identified as predictors of a poor outcome and are implied to have a role in cancer progression and the development of metastases.^4,5 Currently, many molecular markers can be used to identify and isolate CSCs. Several studies have suggested that the CSC fraction may be identified by the expression of the CD133 surface marker, which is a 120 kDa transmembrane and cell surface protein that can be used to isolate and identify tumor-initiating cells from human colon cancers.^6,7 The most commonly used molecular marker is CD44, which also can be used to identify colon CSC.^8–11 Most CSCs have been reported to be insensitive to chemotherapy and radiotherapy, and these cells are thought to be involved in the development of resistance to chemotherapy. Therefore, these cells may be an important target for the prevention and treatment of colon cancer.⁴

At present, there are no effective methods for the suppression of CSCs. Previous studies have found some natural products can prevent as well as treat colon cancer; for example, the extract from the edible vegetable Portulaca oleracea has been shown to inhibit a number of different cancer cell types. However, at present no study has yet determined the effect of P. oleracea extract on CSCs. In addition, the Notch signaling pathway has been reported to be overexpressed in colon CSCs, where it was found to play a role in colon CSC viability, tumorigenicity, and self-renewal. Notch receptors are single-pass transmembrane proteins composed of functional extracellular, transmembrane, and intracellular domains. Interaction between Notch and its ligands initiates a signaling cascade that regulates differentiation, proliferation, and apoptosis. NOTCH signaling is reported to be 10- to 30-fold higher in CSCs compared to commonly used colon cancer cell lines.^5,12,13 Therefore, the purpose of this study was to determine whether P. oleracea can inhibit CSCs and whether the effects observed were mediated by the Notch signal transduction pathway.

Materials and methods

CSC culture

CSCs were cultured and separated as previously described.^8,9 Briefly, cells from the HT29 human colon cancer cell line were cultured in RPMI-1640 medium with 10% fetal bovine serum (FBS) until they reached 90% confluence, at which point the cells were collected. Next, the cells were centrifuged and the supernatant was removed. The cells were resuspended with serum-free DMEM/F12 medium (containing 20 ng/mL epidermal growth factor, 10 ng/mL basic fibroblast growth factor, 5 µg/mL insulin, 0.4% bovine serum albumin, and 2% B27), counted, and then cultured in six-pore suspension culture plates at a concentration of 1 × 10⁴ cells/mL at 37°C and 5% CO₂. After 3–7 days in culture, growth of the glomus cells could be visualized. After 30 min at 37°C, the cells were precipitated, and the supernatant was removed (containing a small amount of individual cells and cell debris). Serum-free DMEM/F12 was added for an expanded culture. After centrifuging the glomus cells, digestion and passage, as well as cultivation, was performed for several generations to purify the cells. Finally, the cells were collected and resuspended at a concentration of 2 × 10⁵ cells/mL for Hoechst 33342 staining.

Flow cytometric analysis of CD133 and CD44

Flow cytometric analysis was performed as previously reported.^8,9 HT-29 colon cancer cells and HT-29 cancer stem cells were first scattered and digested with ethylenediaminetetraacetic acid (EDTA)-containing trypsin, before quickly diluting and mixing with DMEM/F12 medium. After centrifuging, the cells were resuspended in 300 µL of phosphate-buffered saline (PBS) and a homogenous mixture was obtained. The first group of cells was used as a blank/control. The second group was treated with 10 µL of anti-CD44-APC in the dark for 15 min at 4°C. The third group was treated with 10 µL of Fcr Block for 15 min at 4°C, and then treated with 10 µL of anti-CD133-APC for 20 min at 4°C (all procedures were carried out in the dark), before washing with PBS. All cells were resuspended in 400 µL of PBS and then used for flow cytometry experiments to detect expression of the surface markers CD44 and CD133.

Chemotherapy drug sensitivity assay

HT-29 colon cancer cells and HT-29 cancer stem cells were plated in 96-well cell culture plates at a concentration of 5,000 cells/well. After cell adherence was noted, the chemotherapeutic drug 5-FU (fluorouracil) was added at different concentrations for 72 h (each concentration was tested in triplicate) and 20 mL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution was added. The medium was discarded after 4 h and 150 µL of dimethyl sulfoxide (DMSO) was added and mixed with oscillating movement. Optical density (OD) values were measured at the 570 nm wavelength and the IC50 values (the half maximal inhibitory concentration) were calculated for all cells.

Proliferation assessment of HT-29 CSCs and HT-29 colon cancer cells

HT-29 cells and HT-29 stem cells were scattered and digested with EDTA-containing trypsin into single cell suspensions, and 1640 medium containing 10% serum was quickly added to stop the digestion. After washing twice with PBS, the cells were resuspended with PBS, mixed, and pipetted into six-well plates at a concentration of 1 × 10⁶ cells/mL. Cells were cultured for 96 h, cell growth was recorded, and photographs were taken with an olympus ix3 inverted fluorescence microscope.

In vivo tumorigenesis assay of HT-29 CSCs and HT-29 colon cancer cells

Bilateral stem cell injections were performed in the subscapularis of BALB/c mice, and the inguinal and axillary nodal status of HT29 stem cells and HT29 cells were noted with respect to tumorigenesis. A total of 20, average body weight of 20 g, female BALB/c nude mice were used for each cell line. The first group was set as negative control. The second group was treated with Xeloda as a positive control. The third, the fourth, and the fifth groups were treated with P. oleracea in doses of 50, 100, and 200 mg, respectively. The physical condition of the BALB/c mice was observed after injecting the stem cells; the experiment was ended by sacrificing the mice or by the presence of a tumor with a diameter over 20 mm. Autopsies were performed to determine tumorigenesis in specific locations of the animal’s body and photographs were taken. Tumor incidence was calculated at each location of interest. Calculations of tumor volume and the growth rate were performed according to the following formulas

Tumor volume (m m^{3}) = 1 / 2 a b^{2} (where a is the tumor diameter and b is the tumor minor diameter)

Tumor growth rate = \frac{(measurement of tumor size at the time point starting tumor size - starting tumor size)}{starting tumor size}

Research on the effects of P. oleracea extract on HT-29 stem cells and HT-29 cells

P. oleracea extract identification and concentration determination

The compound was extracted according to the manufacturer’s protocol and is summarized as follows: 50 g of decocted P. oleracea was pulverized for approximately 3 min, boiled, and refluxed for 1.5 h with 10 times the volume of 50% ethyl alcohol. P. oleracea was filtered using a 200-mesh sieve filtration system and the residue was extracted twice in the manner described above. The filtrates were combined three times to reach a final volume of 100 mL and incubated in a heated water bath (temperature 95°C). Vacuum distillation was performed to transform the concentrated solution into oil, which was dissolved in 50 mL of ultrapure water and centrifuged at 12000g for 20 min. The supernatant was retained and the sample solution was read at 510 nm.

Proliferation assessment of HT-29 cells and HT-29 stem cells

HT-29 CSCs and HT-29 stem cells were seeded in 21 wells of a 96-well plate at a concentration of 5 × 10³ cells/mL; 100 µL of medium was added to each well that did not contain cells. The P. oleracea ethyl alcohol extract was dissolved in complete medium after adding DMSO (concentration of <0.01%). After 24 h and normal cell culture conditions, cells from each of the 21 wells were divided into seven treatment groups. Each group was cultured in triplicate and P. oleracea–containing medium was added at 200 µL to a final concentration that was dependent on the treatment group, as follows: 0 (control group), 0.07, 0.14, 0.28, 0.56, 1.12, and 2.25 µg/mL (experimental group). Cells were then placed in an incubator at 37°C and 5% CO₂. After incubation for 24 or 72 h, MTT reaction liquid was added into the wells at a ratio of 100 µL:10 µL MTT. Following another 1-h period in the 37°C incubator, the absorbency at 450 nm (A value) was determined with a microplate reader. The following equation was used: inhibition rate = [1 − (A value/drug adding group − A value/blank control group)/(A value/drug group − A value/blank control group)] × 100%.

Flow cytometry assay for apoptosis after treatment of cells with P. oleracea

HT-29 cancer cells and HT-29 cancer stem cells were scattered and digested with EDTA-containing trypsin into single cell suspensions as previously described. The complete solution with P. oleracea ethyl alcohol was added at 2.25 µg/mL.

Real-time fluorescence quantitative polymerase chain reaction assay for the expression of Notch1, Notch2, and β-catenin messenger RNA

HT29 colon cancer cells were cultured in McCoy’s 5A medium with 10% FBS, while HT29 stem cells were cultured in RPMI-1640 medium with 10% FBS. Both cell strains were seeded at a concentration of 5 × 10⁵ cells/mL in complete medium-containing 10 cm dishes, with two dishes for each strain. After 24 h under normal conditions, complete medium that contained the following concentrations of P. oleracea extract was added: 0 µg/mL (control group) or 2.25 µg/mL (experiment group). After 72 h in an incubator at 37°C and 5% CO₂, the cells were washed twice with pre-cooled PBS. RNA was reverse-transcribed to complementary DNA (cDNA) (real-time polymerase chain reaction (PCR)) using the primers shown in Table 1. Ribosome 18S (18S rRNA) was used as an internal reference.

Table 1.

Primers used for the quantitative RT-PCR assay.

Gene		Primer sequence	Length (bp)
Notch1	Notch1 (+)	CCGCAGCACTATTGAGAACA	213
	Notch1 (−)	ATCCATGTGTAGCCGTAGCC	213
Notch2	Notch2 (+)	TAATACGACTCACTATGAGA	229
	Notch2 (−)	ATTTAGGTGACACTATCTGT	229
β-catenin	β-catenin (+)	AAGTTCTTGGCTATTACGCA	203
	β-catenin (−)	ACAGCACCTTCAGCACTATG	203
18s rRNA	18s rRNA (+)	TTTGTTGGTTTTCGGAACTGA	198
	18s rRNA (−)	CGTTTATGGTCGGAACTACGA	198

RT-PCR: reverse transcription polymerase chain reaction.

Western blot assays for the expression of β-catenin, Notch1 and Notch2 proteins

HT-29 colon cancer cells and HT-29 cancer stem cells were treated with 2.25 µg/mL of P. oleracea extract, a cell scraper was used to lift cells in the primary culture solution, total protein was extracted, and a Western blot assay was prepared, according to the manufacture’s protocol. The total grey value in the resulting Western blots were measured with Band scan Analysis software, which allowed for a quantitative comparative analysis. Measurements were normalized to β-actin.

Statistical analysis

Student’s t-tests were used to compare sets of data obtained from each groups of BALB/c nude mice. For all other experimental data, we analyzed the results with SPSS statistical software version 13.0 (SPSS, Chicago, IL, USA). p values are reported in the figure legends, with the second decimal rounded to the nearest figure. Statistical significance was considered at a p < 0.05 level.

Results

Characteristics and identification of HT-29 stem cells

After serum-free cultivation, HT-29 colon cancer cells formed spindle-shaped cells, while HT-29 CSCs showed spherical growth. After staining with Hoechst 33342, the nuclei of HT29 colon cancer cells showed significantly less staining compared to the HT-29 CSCs (Figure 1(a) and (b)). The positive expression rate of CD133 and CD44 in HT-29 cells was 44.6% and 0.6%, respectively (Figure 1(c)). Conversely, the expression rate of CD133 and CD44 in cultured and purified HT-29 stem cells was 92.6% and 97.8%, respectively, and was significantly increased (p < 0.001) compared to HT-29 colon cancer cells (Figure 1(d)). Additionally, results of the in vivo experiments showed that HT-29 stem cells grew significantly faster than the HT-29 cells. Moreover, the volume of tumors formed by HT-29 cells was twice as large as those formed by HT-29 stem cells (Figure 1(e); p < 0.05). Finally, the growth rate of HT-29 stem cells was highest in blood vessel–rich regions of the mice (axillary and inguinal lymph nodes) compared to subcutaneous areas (p < 0.05). By contrast, the growth rate of HT-29 cells was slow, and a continuous measurement data comparisons analysis revealed that the difference was statistically significant (p < 0.001). Finally, the results of a drug sensitivity assay for the chemotherapeutic drug 5-FU showed that the IC50 of HT-29 cells was 1.394 µg/mL, compared to 13.087 µg/mL in the HT-29 stem cells.

Figure 1.

Comparison of characteristics of HT-29 cells and HT-29 stem cells. Representative images are shown of Hoechst 33342 staining for (a) HT-29 cells and (b) HT-29 stem cells. Magnification is 400× for both, and the scale bar = 20 µm. The expression of CD133 and CD44 is measured by flow cytometry and is shown for (c) HT-29 stem cells and (d) HT-29 cells, p < 0.001. Mice received bilateral injections to the subscapularis with either HT-29 cells or HT-29 stem cells. Tumor growth was assessed and compared with respect to both (e) growth rate and volume p < 0.05.

P. oleracea extract inhibited the proliferation of HT-29 cancer stem cells and HT-29 colon cancer cells in a dose-dependent manner

The results of a proliferation assay showed that HT-29 cancer cells proliferated more slowly than HT-29 stem cells (Figure 2(a)). P. oleracea extract exerted an inhibitory effect on the proliferation of HT-29 colon cancer cells and HT-29 cancer stem cells after 72 h at concentrations ranging from 0.07 to 2.25 µg/mL, and the level of inhibition was found to increase with the dosage (Figure 2(b)). Interestingly, P. oleracea extract had a significantly more potent effect on HT-29 colon cancer cells than on HT-29 CSCs, based on repeated measurement data comparisons analysis of different treatment concentrations (p < 0.001). However, for both cell types, as the concentration increased, the difference in the rate of proliferation inhibition was reduced.

Figure 2.

Proliferation assay for HT-29 cells and HT-29 stem cells and the effect of P. oleracea extract. (a) HT-29 cells and HT-29 stem cells were cultured for 96 h and growth was recorded. Representative images are shown for the proliferation assay for both cell types at 1, 48, and 96 h (×400). (b) Stem cells were treated with varying concentrations of P. oleracea extract, as indicated, and the effect on proliferation of both cell types was measured after 72 h of culture. The inhibition rate was determined by an MTT assay, and the ratio was calculated as indicated in the “Methods” section. An increased inhibition ratio is associated with increased inhibition of proliferation p < 0.001

The effect of P. oleracea ethyl alcohol extract on apoptosis, as measured by flow cytometry

Treatment with P. oleracea extract (2.25 µg/mL) resulted in a significant increase in apoptosis in both HT-29 cancer stem cells and HT-29 colon cancer cells (Figure 3; p < 0.05 and p < 0.025, respectively) compared to untreated controls. Taken together with the previous section, this result suggests that P. oleracea extract can inhibit the proliferation of cancer stem cells by inducing apoptosis.

Figure 3.

Analysis by flow cytometry of the effects of P. oleracea ethyl alcohol extract on apoptosis in HT-29 cells and HT-29 cell stem cells. Cells were stained for markers of cell viability: propidium iodine (PI) and Annexin V (AV). Viable cells are AV and PI negative. Increased uptake of AV is correlated with apoptosis. Double staining with AV and PI is consistent with late apoptosis or dead cells. (a) Untreated HT-29 cells and (b) HT-29 cells treated with 2.25 µg/mL P. oleracea. (c) Untreated HT-29 stem cells and (d) HT-29 stem cells treated with 2.25 µg/mL P. oleracea. (e) Quantification of flow cytometry data shown in (a)–(d). AV-positive cells were considered apoptotic (upper and lower right quadrants).

Expression of Notch1, Notch2, and β-catenin messenger RNA in HT-29 colon cancer cells and HT-29 CSCs with and without treatment with P. oleracea extract

At baseline, the expression of Notch1, Notch2, and β-catenin messenger RNA (mRNA) was lower in HT-29 colon cancer cell lines than in HT-29 CSCs. While the differences in the expression of Notch1 and β-catenin were statistically significant, the differences in Notch2 were not significant (Table 2).

Table 2.

Expression of Notch1, Notch2, and β-catenin mRNA in HT-29 cells and HT-29 stem cells (mean ± SD).

	HT-29 cells	HT-29 stem cells	p
β-catenin	1.16 ± 0.17	2.34 ± 0.28	0.003
Notch1	1.01 ± 0.01	1.66 ± 0.03	0.000
Notch2	1.11 ± 0.11	1.16 ± 0.10	0.584

SD: standard deviation.

After treatment with P. oleracea extract (2.25 µg/mL), the expression of Notch1 and β-catenin in both HT-29 cells and HT-29 stem cells was significantly downregulated. Conversely, treatment with P. oleracea extract caused a slight increase in the expression of Notch2, although this difference was not statistically significant (Table 3).

Table 3.

Expression of Notch1, Notch2, and β-catenin mRNA in HT-29 cells and HT-29 stem cells after treatment with P. oleracea (mean ±SD).

	HT-29 cells	+P. oleracea	p	HT-29 stem cells	+P. oleracea	p
β-catenin	1.16 ± 0.17	0.003 ± 0.0004	0.000	2.34 ± 0.28	0.003 ± 0.001	0.000
Notch1	1.01 ± 0.01	0.004 ± 0.001	0.000	1.66 ± 0.03	0.003 ± 0.0003	0.000
Notch2	1.11 ± 0.11	1.93 ± 0.30	0.32	1.16 ± 0.10	1.37 ± 0.067	0.053

SD: standard deviation.

Results of Western blotting analyses for β-catenin, Notch1, and Notch2

Treatment with P. oleracea extract decreased the expression of Notch1, Notch2, and β-catenin protein in HT-29 cells and HT-29 stem cells (Table 4, Figure 4).

Table 4.

Relative expression of Notch1, Notch2, and β-catenin proteins in HT-29 cells and HT-29 stem cells after treatment with P. oleracea compare to β-actin.

	β-catenin	Notch1	Notch2
HT-29 stem cells	1.64	1.26	0.69
HT-29 stem cells + P. oleracea	0.16	0.41	0.03
P	0.027	0.032	0.050
HT-29 cells	0.70	0.45	0.17
HT-29 cells + P. oleracea	0.55	0.32	0.05
p	0.002	0.011	0.035

Figure 4.

Representative Western blots for the expression of proteins in the Notch signal transduction pathway after treatment with P. oleracea.

Discussion

In this study, stem cells were isolated from tumor cells by culturing them in serum-free medium. Tumor cells cannot grow in these conditions, whereas CSCs have the ability to auto-synthesize.^14,15 Our results showed spherical growth of the isolated HT-29 stem cells and staining with Hochest 33342 revealed a phenomenon in which dye was excluded from the nuclear compartments. In addition, we observed positive expression of CD133 and CD44, at 92.6% and 97.8% respectively, suggesting that these were correctly identified as CSCs. Importantly, HT-29 cancer stem cells were much less sensitive to 5-FU in this study than HT-29 colon cancer cells: the IC50 of HT-29 colon cancer cells was 1.394 µg/mL, compared to 13.087 µg/mL in HT-29 stem cells. These findings suggest that at conventional doses, CSCs are resistant to chemotherapeutic drugs, consistent with other findings.¹⁶ Taken together, our results suggest that isolated HT-29 stem cells had the general characteristics of CSCs.

CSCs play an important role in the occurrence, development, recurrence, and metastasis of colon cancer, leading to the hypothesis that they may be an important target for cancer prevention and treatment. Unfortunately, CSCs are insensitive to chemotherapy drugs, such as 5-FU, and the toxicity associated with chemotherapeutic treatment of these cells is high. Therefore, it is of great importance to explore new methods to inhibit CSCs.

The results of this study show that P. oleracea extract can inhibit the proliferation of both colon cancer cells and CSCs in a dose-dependent manner. When treated with lower concentrations of P. oleracea, the inhibition rate was higher in colon cancer cells than in CSCs by more than a twofold difference. This result implies that the colon cancer cell line was more sensitive to the P. oleracea extract than the CSC lines. The mechanism underlying this finding requires further study. In addition, P. oleracea extract induced apoptosis in both cell types. The dosage used in this study was a comparatively low dose of P. oleracea extract. A report by Al-Sheddi et al.,¹⁷ utilized doses of 250-1000 µg/mL to inhibit the liver cancer cell line HepG2 and lung cancer cell line A-549, the lowest dose being 100 times higher than the highest dose in this study.

Many previous studies have found beneficial effects of P. oleracea on cancer cells. Research by Ji et al.¹⁸ showed that P. oleracea extract inhibits the proliferation, invasion, and metastasis of the liver cancer cell line HCCLM3. Another study by Gu et al.¹⁹ found that both fresh and dry P. oleracea extract inhibited liver cancer cell proliferation and had anti-oxidant effects. Research by Farshori et al.²⁰ reported that P. oleracea extract can inhibit the liver cancer cells. Finally, a study by Zhao et al.²¹ found that P. oleracea extract can inhibit cervical cancer cells. However, this is the first study to show that P. oleracea has a similar influence on colon cancer cell lines as well as CSCs.

Given the importance of preventing and treating colon cancer at the cellular level, a number of different avenues have been explored for inhibiting CSCs. Aside from immunological therapy, chemotherapy and other standard treatments, some investigators have reported on the merits of using natural drugs or foods to prevent and treat this disease. For example, a study by Min et al.²² found that the leaves of Sasa quelpaertensis can inhibit CSCs and influence gene expression related to stem cell development. In another study, Kumar et al.²³ found that grape seed extract can inhibit the effect of CSCs. Similarly, in this study, alcohol was used to extract the flavone content of P. oleracea, and this extract was found to inhibit colon cancer and CSCs. These findings suggest that P. oleracea extract could represent a potential option in the prevention and treatment of colon cancer, as well as for adjuvant therapy.

The Notch signal transduction pathway is an important regulator gene for the development of CSCs.^12,13 Preliminary results have shown that tea polyphenol can inhibit and regulate the genetic effects of the Notch signal transduction pathway.²⁴ The target genes of the Notch signal transduction pathway are closely related to CSCs and include Notch1, Notch2, and β-catenin. We found that the expression of Notch1 and β-catenin mRNA was significantly higher in CSCs than in colon cancer cell lines. This suggests that Notch1 and β-catenin gene expression decrease when CSCs mature; however, the reason for this is unclear and requires further study. Importantly, we found that treatment with P. oleracea extract inhibited the expression of Notch1 and β-catenin mRNA by close to 10-fold. Taken together, it is possible that alterations in the Notch signal transduction pathway underlie the inhibitory effects of P. oleracea on proliferation, as well as the increase in apoptosis, of CSCs. At present, there are only a limited number of studies on P. oleracea extract; therefore, our next study will continue to explore the possible mechanisms underlying these suppressive effects on CSCs.

In conclusion, the results of this study show that P. oleracea extract can inhibit CSCs at the cellular level in a dose-dependent manner. Moreover, P. oleracea extraction can significantly inhibit the expression of Notch1 and β-catenin mRNA and influences regulatory genes and target genes of the Notch signal transduction pathway. These findings provide a new potential basis for the prevention and treatment of colon cancer at ****the level of CSCs.

Footnotes

Acknowledgements

Heiying Jin and Li Chen are Joint First Authors.

Declaration of conflicting interest

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: Grant support: This study was funded by the National Nature Science Foundation of China (No.30572447, 30973837, 81273944) and Jiangsu Nature Science Foundation (BK20151081).

References

Kucia

Reca

Miekus

. Trafficking of normal stem cells and metastasis of cancer stem cells involve similar mechanisms: pivotal role of the SDF-1-CXCR4 axis. Stem Cells 2005; 23(7): 879–889.

Setoguehi

Taga

Kondo

Cancer stem cells persist in many cancer cell lines. Cell Cycle 2004; 3(4): 414–415.

Patrawala

Calhoun

Sehneider-Broussard

. Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2- cancer cells are similarly tumorigenic. Cancer Res 2005; 65(14): 6207–6219.

Dhawan

Ahmad

Srivastava

. Cancer stem cells and colorectal cancer: an overview. Curr Top Med Chem 2011; 11(13): 1592–1598.

Ricci-Vitiani

Fabrizi

Palio

. Colon cancer stem cells. J Mol Med 2009; 87(11): 1097–1104.

O’Brien

Pollett

Gallinger

. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 2007; 445(7123): 106–110.

Ricci-Vitiani

Lombardi

Pilozzi

. Identification and expansion of human colon-cancer-initiating cells. Nature 2007; 445(7123): 111–115.

Todaro

Alea

Di Stefano

. Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4. Cell Stem Cell 2007; 1(4): 389–402.

Vermeulen

Todaro

de Sousa Mello

. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci U S A 2008; 105(36): 13427–13432.

10.

Dalerba

Dylla

Park

. Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A 2007; 104(24): 10158–10163.

11.

Kemper

Prasetyanti

De Lau

. Monoclonal antibodies against Lgr5 identify human colorectal cancer stem cells. Stem Cells 2012; 30(11): 2378–2386.

12.

Jin

Zhang

Wang

. Expression and clinical significance of Notch signaling genes in colorectal cancer. Tumor Biol 2012; 33(3): 817–824.

13.

Qiao

Wong

BC.

Role of Notch signaling in colorectal cancer. Carcinogenesis 2009; 30(12): 1979–1986.

14.

Kondo

Setoguchi

Taga

Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A 2004; 101(3): 781–786.

15.

Al-Hajj

Wicha

Benito-Hernandez

. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003; 100(7): 3983–3988.

16.

Reya

Morrison

Clarke

. Stem cells, cancer, and cancer stem cells. Nature 2001; 414(6859): 105–111.

17.

Al-Sheddi

Farshori

Al-Oqail

. Portulaca oleracea seed oil exerts cytotoxic effects on human liver cancer (HepG2) and human lung cancer (A-549) cell lines. Asian Pac J Cancer Prev 2015; 16(8): 3383–3387.

18.

Zheng

Xia

. Inhibition of invasion and metastasis of human liver cancer HCCLM3 cells by portulacerebroside A. Pharm Biol 2015; 53(5): 773–780.

19.

Zheng

Yuan

. Comparison on hypoglycemic and antioxidant activities of the fresh and dried Portulaca oleracea L. in insulin-resistant HepG2 cells and streptozotocin-induced C57BL/6J diabetic mice. J Ethnopharmacol 2015; 23: 214–223.

20.

Farshori

Al-Sheddi

Al-Oqail

. Cytotoxicity assessments of Portulaca oleracea and Petroselinum sativum seed extracts on human hepatocellular carcinoma cells (HepG2). Asian Pac J Cancer Prev 2014; 15(16): 6633–6638.

21.

Zhao

Gao

Cai

. Antitumor activity of Portulaca oleracea L. polysaccharides against cervical carcinoma in vitro and in vivo. Carbohydr Polym 2013; 96(2): 376–383.

22.

Min

Lim

Kim

. Sasa quelpaertensis leaf extract inhibits colon cancer by regulating cancer cell stemness in Vitro and in Vivo. Int J Mol Sci 2015; 16(5): 9976–9997.

23.

Kumar

Raina

. Functional modification of adipocytes by grape seed extract impairs their pro-tumorigenic signaling on colon cancer stem cells and the daughter cancer cells. Oncotarget 2014; 5(20): 10151–10169.

24.

Jin

Tan

Liu

. The study of effect of tea polyphenols on microsatellite instability colorectal cancer and its molecular mechanism. Int J Colorectal Dis 2010; 25(12): 1407–1415.