Abstract
This study aims to investigate the function of long non-coding RNA ZEB1-AS1, reveal its molecular mechanism in colorectal cancer cell growth, and evaluate its clinical significance in colorectal cancer patients. ZEB1-AS1 has reported in the development of several cancers, but the biological role of it in colorectal cancer has not been discussed. In this report, ZEB1-AS1 expression level was measured with quantitative real-time polymerase chain reaction in 63 pairs of colorectal cancer tissues and paired adjacent non-tumor colorectal tissues. The relationship between ZEB1-AS1 expression and overall survival was analyzed by virtue of Kaplan–Meier analysis. Subsequently, small interfering RNA or lentivirus vector–mediated lncRNA ZEB1-AS1 was transfected into colorectal cancer cell lines. Cell viability and apoptosis were examined. Later, nude mouse transplantation experiment was conducted to evaluate the effect of ZEB1-AS1 on colorectal cancer development in vivo. It turns out that ZEB1-AS1 is upregulated in colorectal cancer tissues and its expression is significantly associated with overall survival rate and recurrence-free survival. Upregulation of ZEB1-AS1 colorectal cancer promotes cell proliferation and inhibits cell apoptosis. In addition, cell cycle inhibitory protein p15 participates in the oncogenic function of ZEB1-AS1. Collectively, ZEB1-AS1 has asignificant effect on colorectal cancer pathological process and serves as a valuable prognostic biomarker for colorectal cancer.
Introduction
Colorectal cancer (CRC) is the third most common cancer around the world, with nearly 1.2 million new cases each year. In China, the morbidity of CRC tends to rise year by year.1,2 Colorectal canceration is a multi-step biological process, including polygenic alteration, the damage of cell proliferation, and apoptosis.3,4 Despite encouraging progress has been achieved in diagnosis, treatment as well as understanding of the molecular mechanisms of CRC, no improvement has been made in its survival rate in the last few years.5,6 Therefore, a novel understanding of molecular mechanism in relation to formulation and development of CRC is urgently needed.
By definition, long non-coding RNAs (lncRNAs) refer to a class of non-coding RNAs over 200 nucleotides with no protein-coding potential. 7 A growing body of evidence indicates that lncRNAs regulate gene expression and play a crucial role in the regulation of multiple biological processes by virtue of acting upon transcriptional, post-transcriptional, or epigenetic pathways.8–10 The expression of lncRNA is frequently dysregulated in tumor, and some lncRNAs participate in the process of recurrence, development, metastasis, and poor prognosis in cancers.11,12 For instance, upregulated expression of long non-coding RNA HOTAIR in CRCs is associated with poor prognosis. 13 LncRNA metastasis associated lung adenocarcinoma transcript 1 (MALAT1) acts as a novel biomarker in gastric cancer metastasis. 14 Given the close relationship between lncRNA and cancer, it is crucial to further explore the functions of lncRNA in CRC.
LncRNA ZEB1 anti-sense1 (ZEB1-AS1) is located in physical contiguity with ZEB1-AS1, and it was first reported in hepatocellular carcinoma. 15 Li has demonstrated that the high level of lncRNA ZEB1-AS1 (LV-ZEB1-AS1) expression in hepatocellular carcinoma leads to cancer metastasis and induces epithelial-to-mesenchymal transition (EMT) by regulating the expression of ZEB1, a significant transcription factor functioning in many cancers. 16 Similarly, recent studies have reported the relationship between ZEB1-AS1 and poor prognosis in esophageal squamous, glioma, and osteosarcoma patients.17–19 However, to our knowledge, the clinical significances and possible mechanisms of LV-ZEB1-AS1 in CRC remain unknown.
In this regard, this study identified the upregulation of ZEB1-AS1 in CRC tissues as well as the association between ZEB1-AS1 and clinicopathological features. Subsequently, the expression of ZEB1-AS1 was inhibited or overexpressed in CRC cell lines, and its functions in the tumorigenicity of CRC cell proliferation were explored through vivo and vitro experiments. Moreover, further mechanistic study indicated that ZEB1-AS1 regulates cell proliferation by suppressing p15 protein.
Materials and methods
CRC tissue samples
A total of 63 pairs of primary CRC tissues and adjacent non-tumor tissue samples were collected from patients in the Second Affiliated Hospital of Nanjing Medical University between 2009 and 2015. These patients did not receive any prior treatment before surgery. All tissue samples were kept in liquid nitrogen at −196°C until RNA extraction. Written informed consent was obtained from all patients before participation in this study. The research was approved by the Clinical Ethics Committee of the Second Affiliated Hospital of Nanjing Medical University, China.
RNA extraction, reverse transcription, and quantitative real-time polymerase chain reaction analysis
RNA was obtained from CRC specimens or CRC cell lines using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). A volume of 1 µg RNA was reversely transcribed into complementary DNA (cDNA) by a Reverse Transcription Kit (Toyobo, Osaka, OSA, Japan). Subsequently, quantitative real-time polymerase chain reaction (qRT-PCR) was conducted on an ABI 7500 (Applied Biosystems, Foster, CA, USA). All the procedures were carried out in accordance with the manufacturer’s instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference gene and ΔCT values were normalized to GAPDH levels. All procedures were repeated for three times. Primers used in this study are referred in Table 1.
Primer sequences used in this study.
GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
CRC cell lines
Human CRC cell lines used in this study included SW480, DLD-1, HCT116, SW620, and human colonic epithelial cells (HcoEpiC), which were acquired from American Type Culture Collection (ATCC, Manassas, VA, USA). SW480 and HCT116 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Carlsbad, CA, USA). DLD-1, SW620, and HcoEpiC were cultured in RPMI-1640 (Gibco) medium. All cell lines were supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen, Shanghai, China) at 37°C in 5% CO2 cell culture incubator.
Cell transfection
Small interfering RNA (siRNA) against ZEB1-AS1 (si-ZEB1-AS1, si-ZEB1-AS1′), siRNA against p15 (si-p15), and non-specific control siRNA (si-NC) were purchased from Invitrogen. The sequences of these siRNAs are as follows—si-ZEB1-AS1: UCAAUGAGAUUGAACUUCAGCUGGA, si-ZEB1-AS1′: UUUAGGAAGGAAUUCAUGGCCUGUG), and si-p15: CGCCUCUUCGAAUUUAAAUUU. Recombinant lentivirus particles were also used to establish stable sh-ZEB1-AS1 clones. Sequence for ZEB1-AS1 short hairpin RNA (shRNA) is as follows—5′-GATTTGCTCCTTTAGAGCCTCATATTGAGGAGATATCACCCTCTAAACGTGATTTTTACTCGAGG-3′. All cells were transfected by Lipofectamine 3000 (Invitrogen) and harvested after 48 h for further studies.
Overexpressed ZEB1-AS1 related lentivirus vectors (LVs) were purchased from Cyagen Biosciences (Guangzhou, China). Cells at 30%–50% confluence were transfected with lentivirus on six-well plates in accordance with the manufacturer’s recommendations (Cyagen Biosciences). Cells were continuously cultured for 1 week to select the stably expressing cell lines by qRT-PCR.
Thiazolyl blue tetrazolium bromide and colony formation assay
Thiazolyl blue tetrazolium bromide (MTT) assay: Cytotoxicity Assay Kit (Beyotime, Beijing, China) was used to monitor cell viability. CRC cells transfected with inhibited or overexpressed ZEB1-AS1 were placed on 96-well plates with six replicate wells (3000 cells/well). Colony formation assay: About 800 cells were put in six-well plates and cultured in media with 10% FBS for 2 weeks. Finally, these cells were fixed by 4% paraformaldehyde and stained by 0.1% crystal violet (Beyotime). There appeared visible colonies that could be counted. Experiments were repeated for three times and performed in accordance with the manufacturer’s recommendations.
Flow cytometry analysis
Cell apoptosis assay: CRC cells transfected with inhibited or overexpressed ZEB1-AS1 were used in this experiment. They were treated with two fluorescent dyes in accordance with the manufacturer’s recommendations: fluorescein isothiocyanate (FITC)–Annexin V and propidium iodide (PI). Finally, the cells were analyzed by means of a flow cytometer (FACScan; BD Biosciences, Franklin Lakes, NY, USA). Cell cycle assay: CRC cells transfected with inhibited or overexpressed ZEB1-AS1 were used in this experiment. Subsequently, the cells were stained with PI using the Cycletest™ Plus DNA Reagent Kit (BD Biosciences) and were then analyzed using a flow cytometer (FACScan). Experiments were repeated for three times and performed in accordance with the manufacturer’s recommendations.
Western blot analysis
SW480 and DLD-1 were lysed by lysis buffer which contained two protease inhibitors (phenylmethylsulfonyl fluoride (PMSF) and ribonuclease inhibitor (RNH); Abcam, CA, USA). Proteins were quantified by Bradford method. Protein extracts (40 µg) were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to 0.22-µm nitrocellulose membranes (Sigma, CA, USA). The membrane was incubated with anti-p15 or GAPDH antibody (Abcam). GAPDH antibody was used as a control.
In vivo experiments
Four-week-old athymic BALA/C mice were obtained from the Chinese Academy of Sciences (Shanghai, China) and fed in a pathogen-free facility. DLD-1 cells (1 × 107) transfected with sh-ZEB1-AS1 or empty vector were subcutaneously injected into either flanks of nude mice. Finally, tumor growth was monitored in terms of tumor volume every 3 days, and tumor weights were calculated on day 15 post-injection.
Immunohistochemistry
Xenograft tumors taken from nude mice were immunostained for hematoxylin and eosin as well as p15. Immunohistochemical staining was conducted on 4-mm sections of paraffin-embedded tissue samples. After incubating with rabbit anti-p15 antibody (1:100) and then fluorescent secondary antibody, the cells were washed and stained with 4′,6-diamidino-2-phenylindole or PI (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for later analysis.
Statistical analysis
All results were analyzed by SPSS version 18.0 or GraphPad prism for data analysis (La Jolla, CA, USA). Data were presented as mean ± standard deviation (SD) from three independent experiments. The differences between groups were tested by t test, Fisher’s exact test, or the χ2 test, and the survival rates were examined by the Kaplan–Meier method. p < 0.05 suggests the differences were statistically significant (*p < 0.05, **p < 0.01).
Results
ZEB1-AS1 expression is upregulated in CRC and associated with poor prognosis in CRC patients
To explore the functions of ZEB1-AS1 in CRC, qRT-PCR was performed to detect the expression of ZEB1-AS1 in 63 pairs of CRC tissues and their adjacent non-tumor tissues, which showed that ZEB1-AS1 expression was significantly higher in CRC tissues than that in adjacent tissues (p < 0.01, Figure 1(a))

ZEB1-AS1 is overexpressed in CRC tissues and associated with poor prognosis in CRC patients. (a) ZEB1-AS1 expression levels in CRC and adjacent non-tumor tissues (N = 63) were analyzed by qRT-PCR. (b and c) High expression of ZEB1-AS1 resulted in short overall survival (OS) and low recurrence-free survival (RFS) rate (*p < 0.05, **p < 0.01).
Subsequently, to further detect the relationship between ZEB1-AS1 expression and clinicopathological characteristics of CRC, 63 CRC patients were classified into two groups: a high-expression group and a low-expression group according to the median expression level of ZEB1-AS1. The correction between ZEB1-AS1 and clinical significance of CRC was evaluated. Noticeably, the results exhibited that overexpression of ZEB1-AS1 is associated with depth of tumor invasion (p < 0.05), microvascular invasion (p < 0.01), and lymph node metastasis (p < 0.01, Table 2). In contrast, other clinicopathological factors, including gender, age, location, tumor size, histologic differentiation, and tumor stage were not significantly correlated with ZEB1-AS1 expression. Kaplan–Meier analysis was used to investigate the relationship between ZEB1-AS1 expression and the prognosis of CRC patient. The result indicated that patients with higher ZEB1-AS1 expression had poorer overall survival (OS) and lower recurrence-free survival (RFS) rate compared to patients with lower ZEB1-AS1 expression (Figure 1(b) and (c)).
Correlation of the expression of ZEB1-AS1 with clinicopathological characteristics of CRC.
ZEB1-AS1: ZEB1 anti-sense1; CRC: colorectal cancer.
ZEB1-AS1 expression in CRC cell lines
The levels of ZEB1-AS1 expression in SW480, DLD-1, HCT116, SW620, as well as HcoEpiC were examined. The results indicated that ZEB1-AS1 expression was palpably greater in SW480 (p < 0.01) and DLD-1 cell lines (p < 0.01, Figure 2(a)). To explore the function of ZEB1-AS1 in CRC and rule out off-target effects, two different siRNAs, namely, si-ZEB1-AS1 and si-ZEb1-AS1′ were transfected into SW480 and DLD-1. qRT-PCR assays showed that the expression of ZEB1-AS1 was significantly restrained in both si-ZEB1-AS1 (p < 0.01) and si-ZEB1-AS1′ (p < 0.05, Figure 2(b)). To guarantee the efficiency of interference, si-ZEB1-AS1 was used in further studies.

The effect of ZEB1-AS1 knockdown is verified in CRC cells by qRT-PCR. (a) The expression levels of ZEB1-AS1 in four types of CRC cell lines and one human colonic epithelial cell (HcoEpiC). (b) The effects of ZEB1-AS1 knockdown in SW480 and DLD-1 cells with si-NC, si-ZEB1-AS1, and si-ZEB1-AS1′ (*p < 0.05, **p < 0.01).
The suppression of CRC cell proliferation and induction of apoptosis by knockdown of ZEB1-AS1
MTT assay demonstrated that downregulating ZEB1-AS1 palpably inhibited cell viability both in SW480 and DLD-1 cell lines compared to empty vector control group (Figure 3(a) and (b)). The results of colony formation assay also showed that the proliferation ability of sh-ZEB1-AS1 group was significantly decreased, compared to the negative control group (Figure 3(c) and (d)).

Knockdown of ZEB1-AS1 suppresses CRC cell growth. The proliferation of DLD-1 and SW480 transfected with sh-ZEB1-AS1 or empty vector was detected by (a and b) MTT assay and (c and d) colony forming growth assays (*p < 0.05, **p < 0.01).
Later, flow cytometry was also employed to inspect the effect of si- ZEB1-AS1 on CRC cell proliferation or apoptosis. Compared with the negative control group, the proportions of apoptotic CRC cells were significantly higher in the treated group (Figure 4(a) and (b)). Furthermore, si-ZEB1-AS1 generated a distinct accumulation of CRC cells in G1 phase (p < 0.05) and a significant decrease in S phase (p < 0.05) compared with si-NC (Figure 4(c) and (d)).

Inhibition of ZEB1-AS1 expression induces CRC cells apoptosis. (a and b) Downregulation of ZEB1-AS1 induced apoptosis in SW480 and DLD-1 cell lines. (c and d) Cell cycle assay of SW480 and DLD-1 cells transfected with si-NC or si-ZEB1-AS1 (*p < 0.05, **p < 0.01).
Overexpressed ZEB1-AS1 promotes CRC cells proliferation
To further verify the function of ZEB1-AS1, ZEB1-AS1 was overexpressed by lentivirus infection in SW620. It turned out that the expression of ZEB1-AS1 in SW620 was significantly upregulated (Figure 5(a)). MTT and colony formation assays also showed that overexpressed ZEB1-AS1 served to enhance CRC cell growth (Figure 5(b) and (c)). Flow cytometry analysis indicated an accelerated cell cycle (Figure 5(e) and (f)) compared with NC. These results suggested that overexpressed ZEB1-AS1 could promote CRC cell proliferation.

Overexpression of ZEB1-AS1 in SW620 promotes CRC cell proliferation. (a) The expression of ZEB1-AS1 was significantly increased after being transfected with ZEB1-AS1 overexpressed lentivirus. (b) MTT assay showed overexpressed ZEB1-AS1 could markedly raise SW620 proliferation rate. (c and d) Colony forming growth assay suggested that high expression of ZEB1-AS1 could markedly raise SW620 proliferation rate. (e and f) Flow cytometry analysis demonstrated that overexpressed ZEB1-AS1 could significantly decrease SW620 accelerated cell cycle (*p < 0.05, **p < 0.01).
Inhibition of CRC cell proliferation in vivo by downregulation of ZEB1-AS1 expression
To study the effect of ZEB1-AS1 on CRC progress in vivo, 4-week-old male nude mice were purchased from the Chinese Academy of Sciences (Shanghai, China) and were fed in a pathogen-free facility. DLD-1 cells (1 × 107) transfected with sh-ZEB1-AS1 or empty vector were subcutaneously injected into either flank of nude mice. The tumor growth was monitored. On day 15 post-injection, it turned out that the sh-ZEB1-AS1 tumor growth group was markedly smaller than the control group (Figure 6(a)). Correspondingly, tumor weight and tumor/body weight ratio also significantly decreased compared with the control group (Figure 6(b) and (c))

Downregulating ZEB1-AS1 expression inhibits CRC cell growth in vitro. (a) DLD-1 cells (1 × 107) transfected with sh-ZEB1-AS1 or empty vector were injected into either flanks of nude mice and harvested after 15 days. (b and c) The results of tumor weight and tumor weight/body ratio. (d) H&E staining of xenograft tumors. (e) The protein expression of p15 in xenograft tumors was detected by immunohistochemistry. (f and g) The mRNA expression of p15 and ZEB1-AS1 in xenograft tumors was tested by qRT-PCR (*p < 0.05, **p < 0.01).
On the basis of the results of knockdown and overexpressed groups, it is demonstrated that ZEB1-AS1 could promote CRC cell proliferation both in vitro and vivo.
The oncogenic function of ZEB1-AS1 potentially controlled by silencing of p15
Anti-apoptotic gene Bcl-2, pro-apoptotic gene Bax, as well as cell cycle inhibitors (p15, p16, p21, and p27) are important tumor suppressor genes in the occurrence and development of tumor. In this study, the association between these tumor suppressor genes and the carcinogenesis of ZEB1-AS1 to CRC by qRT-PCR was revealed. The result indicated that the inhibition of ZEB1-AS1 resulted in the palpably increased expression of p15 both in SW480 and DLD-1 cells (p < 0.01, Figure 7(a)). Subsequently, a western blot assay was performed to confirm whether p15 was needed for the ZEB1-AS1-mediated effects on CRC cells (p < 0.05, Figure 7(b) and (c)). In addition, the expression of p15 in tumors of nude mice was assessed by immunohistochemistry (IHC; Figure 6(d) and (e)), and the expression of p15 and ZEB1-AS1 in xenograft tumors was also examined by qRT-PCR (p < 0.05, Figure 6(f) and (g)). These results all pointed to the conclusion that downregulation of ZEB1-AS1 expression resulted in a palpable increase in the expression of p15 in both SW480 and DLD-1 compared to control group.

Knockdown of ZEB1-AS1 upregulates the expression levels of p15 in both mRNA and protein. The expression of p15 was significantly increased in SW480 and DLD-1 detected by (a) qRT-PCR and (b and c) western blot analysis (*p < 0.05, **p < 0.01).
Partial induction of the oncogenic efficiency of ZEB1-AS1 by silencing p15
To further prove that ZEB1-AS1 can promote CRC cell proliferation by silencing p15, a rescue assay was designed in this study. DLD-1 cells were co-transfected with si-NC, si-ZEB1-AS1, or si-ZEB1-AS1 + si-p15. qRT-PCR showed that si-ZEB1-AS1 + si-p15 group could partly decrease the messenger RNA (mRNA) level of p15 compared with si-ZEB1-AS1 group (Figure 8(a)). In the meantime, MTT and colony formation assays also demonstrated that the inhibitory function of si-ZEB1-AS1 was partly reversed by si-p15 (Figure 8(b)–(d)). These findings indicate that ZEB1-AS1 may partly exert tumor suppression function through increasing p15 expression.

Sliencing of p15 is partly involved in the oncogenic efficiency of ZEB1-AS1. (a) ZEB1-AS1 expression levels in DLD-1 cells which were transfected with si-NC, si-ZEB1-AS1, or si-ZEB1-AS1 + si-p15 tested by qRT-PCR. (b) MTT assay and (c and d) colony forming growth assay were used for detection (*p < 0.05, **p < 0.01).
Discussion
The expression levels of lncRNAs are abnormal in most cancers, including CRC compared with normal tissues, and certain lncRNAs are associated with the occurrence and development of tumors. Recent researchers have highlighted the functions of lncRNAs in CRC progression,20–22 but there are only a limited number of lncRNAs well characterized in CRC. In this study, the association between LV-ZEB1-AS1 and CRC was revealed.
This article first found that the level of ZEB1-AS1 expression was observably upregulated in CRC tissues compared to non-tumor counterparts, which indicated that ZEB1-AS1 may be crucial in CRC development. In addition, the high expression of ZEB1-AS1 was closely related to the depth of invasion (p < 0.05), microvascular invasion (p < 0.01), and lymph node metastasis (p < 0.05). CRC patients who express high level of ZEB1-AS1 have lower OS than those with low ZEB1-AS1 expression. In addition, both overexpressed and silenced ZEB1-AS1 experiments in vitro and in vivo revealed that upregulated ZEB1-AS1 expression could remarkably promote the proliferation capacity of CRC cells and decrease the apoptosis of CRC cells.
Since no research has been carried out on the function of ZEB1-AS1 in CRC, this article attempts to explore the molecular mechanism of ZEB1-AS1. Based on qRT-PCR assays, this article investigated the cell cycle inhibitors (p15, p16, p21, and p27), anti-apoptotic protein Bcl-2, as well as pro-apoptotic protein Bax. The outcome showed that p15 was remarkably upregulated by ZEB1-AS1 knockdown. Western blot analysis and IHC of the nude mice tumor xenografts also revealed this result.
P15 protein, one of the most significant tumor suppressor genes of cell cycle, plays a significant role in negatively regulating cell proliferation in cells by inhibiting the activity of cyclin-dependent kinase 4/6 (CDK 4/6).23–25 It arrests cells in the G1 phase and inhibits its further progress through to the S phase where they synthesize DNA.26,27 It has been confirmed that p15 is misregulated in various cancers such as cervical cancer, 28 gastric cancer, 29 CRC, 30 and hepatocellular carcinoma. 31 Recent studies have indicated that lncRNAs could regulate p15 expression in cancers. For example, long non-coding RNA PVT1 promotes cell proliferation in gastric cancer through regulating p15 and p16. 32 Besides, lncRNA LINC00982 serves to inhibit cell proliferation via regulating p15 in gastric cancer. 33 In this study, the results indicate that ZEB1-AS1 may partially downregulate p15, leading to the promotion of CRC cell growth.
In summary, our article was the first to identify that ZEB1-AS1 is upregulated in CRC and associated with poor prognosis for CRC patients. These results confirmed its prognostic value for CRC patients. Meanwhile, upregulation of ZEB1-AS1 could promote CRC cells proliferation partially by silencing p15 expression. Because ZEB1-AS1 plays a crucial role in CRC progression, it holds promise as a useful marker and potential therapeutic target in CRC.
Footnotes
Compliance with ethical standards
Informed consent was obtained from all patients. Our study was approved by the Research Ethics Committee of Nanjing Medical University, China.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Science Foundation for Young Scientists of China (Grant No. 81100253).
