Sage Journals: Discover world-class research

Abstract

Development of colorectal cancer has been considered as a result of imbalance of pro- and anti-inflammatory intestinal microenvironment accompanied by macrophage recruitment. Despite macrophages are implicated in remodeling tumor microenvironment, the mechanism of macrophage recruitment is not fully elucidated yet. In this study, we reported clinical association of highly expressed pyruvate kinase M2 in colorectal cancer with macrophage attraction. The conditioned medium from Caco-2 and HT-29 cells with depleted pyruvate kinase M2 dramatically reduced macrophage recruitment, which is reversed by addition of, a critical chemotaxis factor to macrophage migration, rCCL2. Silencing of endogenous pyruvate kinase M2 markedly decreased CCL2 expression and secretion by real-time quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Endogenous pyruvate kinase M2 interacted with p65 and mediated nuclear factor-κB signaling pathway and mainly regulated phosphorylation of Ser276 on p65 nuclear factor-κB. In addition, inhibition of macrophage recruitment caused by pyruvate kinase M2 silencing was rescued by ectopic expression of p65. Interestingly, pyruvate kinase M2 highly expressed in colorectal cancer tissue, which is correction with macrophage distribution. Taken together, we revealed a novel mechanism of pyruvate kinase M2 in promoting colorectal cancer progression by recruitment of macrophages through p65 nuclear factor-κB–mediated expression of CCL2.

Keywords

Pyruvate kinase M2 macrophages colorectal cancer CCL2

Introduction

Colorectal cancer (CRC) still ranks as the fourth most frequently diagnosed cancer and fifth most frequent cause of cancer-related death,¹ despite tremendous efforts to improve treatment via multiple strategies. The tumor inflammatory microenvironment, including surrounding blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells, lymphocytes, small signaling molecules, and the extracellular matrix (ECM), is a major factor affecting the development of CRC as evidenced by the fact that patients with inflammatory bowel disease have much higher risk of CRC compared with their healthy counterparts.^2,3 However, being an important type of immune cells in tumor microenvironment, macrophages, widely distributed in all tissues, have been demonstrated to play a major role in the host innate immune response against pathogens.⁴ It has also been shown that macrophages infiltrated into tumor microenvironment correlate to a poor prognosis in the majority of cancers but positive associations between macrophages and disease prognosis have also been proposed.²

Since macrophages can adopt different phenotypes depending on the cellular microenvironment and polarize into type M1 and M2 macrophages mediated by various transcriptional regulators, including Krüppel-like factor (KLF), signal transducer and activator of transcription (STAT), nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and Hypoxia-inducible factor 1-alpha (HIF-1α),^2,5,6 generally speaking, lipopolysaccharide (LPS) and interferon gamma (IFN-γ) promote macrophages differentiation to a M1 phenotype, which are characterized by the expression of high levels of pro-inflammatory cytokines and promotion of a Th1 response, with strong anti-microbial and anti-tumor activity. In contrast, interleukin-4 (IL-4) and IL-13 are M2-polarizing agents that generate “alternatively activated” M2 macrophages, which are characterized by efficient phagocytic activity, with increased expression of mannose and galactose receptors switching on the Arg pathway to produce ornithine and polyamines and increased anti-inflammatory cytokine production. M2 macrophages are involved in the promotion of tissue remodeling and tumor progression and have immunoregulatory functions. Although the studies demonstrated that tumor-associated macrophages (TAMs) play an important role in remodeling tumor microenvironment, the molecular mechanisms that regulate macrophage recruitment is yet to be fully deciphered.

Pyruvate kinase M2 (PKM2), a rate-limiting glycolytic enzyme that catalyzes final step of glycolysis: the conversion of phosphoenolpyruvate (PEP) into pyruvate, is highly expressed in human cancer cells, including prostate cancer, CRC, and lung cancer. It plays an important role in tumor Warburg effect, a hallmark of tumor, which is characterized by a preference for aerobic glycolysis even when the oxygen content is available and this conversion of metabolic pathway is critical for tumor growth.^7–11 In addition to its well-known role in glycolysis, recent advances in promoting tumor progression by PKM2 via its non-metabolic functions. PKM2 has been demonstrated to play a crucial function in tumorigenesis,^10,12–15 cell cycling, angiogenesis,¹⁶ invasion,^17–19 and radiosensitivity.^20–23 Although these findings point out that PKM2 plays an important role in the tumor progression, its specific role in remodeling tumor microenvironment and the underlying mechanisms are unclear. Interestingly, macrophage is one of the major cellular components in the tumor microenvironment and abundance of macrophages has been correlated with poor prognosis in human cancers, such as breast, prostate, ovarian, cervical, and lung carcinoma,²⁴ which attracts us to gain further insights into the relationship between PKM2 expression level and macrophage infiltration, and the molecular mechanisms through which PKM2 regulates macrophage recruitment in CRC microenvironment.

NF-κB, composed of homodimers and heterodimers of the Rels family proteins, is activated by phosphorylation of different site on p65, accompanied with nuclear translocation, which plays a key function in the regulation of its transcriptional activity,^25,26 it has also been demonstrated that CCL2 expression is strongly dependent on NF-κB activation in various cells.^27–29 Phorbol myristial acetate (PMA)-induced and tumor necrosis factor alpha (TNF-α)-induced NF-κB activation in various cells leads to IκBα degradation and p65 translocation to nucleus,²⁶ which further binds to the promoter and contributes to transactivity of target genes. Nevertheless, the signaling pathways upstream of NF-κΒ that led to CCL2-mediated macrophage recruitment have not yet been illustrated.

In this article, we showed the mechanism of how PKM2 promotes macrophage recruitment by modulating NF-κB-mediated expression of CCL2 in CRC cells. PKM2 interacts with p65 and contributes to phosphorylation of pSer276 on NF-κB, which further contributes to CCL2 transactivity, leading to macrophage recruitment in tumor microenvironment. These results revealed the underlying mechanism of PKM2 in tumor progression and may provide effective approaches to explore anti-tumor therapies.

Materials and methods

Chemicals and reagents

Chemical reagents were from Sigma (St. Louis, MO, USA); ProLong anti-fade reagent was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA); TRIzol and lipofectamine 3000 were from Invitrogen; All-in-One First-Strand cDNA Synthesis Kit and All-in-One™ qPCR Mix were from GeneCopoeia (Rockville, MD, USA). PKM2 siRNA was synthesized from Genepharma (Shanghai, China).

Cell culture and transfection

Caco-2, HT-29, and macrophages were purchased from American Type Culture Collection (ATCC) and cultured according to the manufacturer’s recommendations. Small interfering RNA (siRNA)-targeted PKM2 (5′-CCAUAAUCGUCCUCACCAA-3′) was transfected into cells using Lipofectamine 3000 according to the manufacturer’s instructions. Experiments were performed at 60 h after transfection.

Establishment of stable short hairpin RNA lines

PKM2 targeting short hairpin RNA (shRNA) were purchased from GenePharma (Shanghai, China). A final concentration of 5 µg/mL Polybrene was supplemented to the cells of interest for 2 h before infecting them with virus. Following this, the lentiviral particle solution was removed from the cells and replaced with fresh full media for 24 h before selection of a stable cell line in puromycin. Successful diminution of PKM2 expression was verified by real-time polymerase chain reaction (RT-qPCR) and western blotting analysis.

Western blot analysis

Immunoblotting was performed as described in our pervious study.²⁶ Briefly, the whole cell was harvested in 2× sodium dodecyl sulfate (SDS) loading buffer on ice, and total protein was further subjected to SDS–polyacrylamide gel electrophoresis (PAGE), subsequently transferred to nitrocellulose (NC) filter membrane and probed with antibodies against α-tubulin (ABclonal), PKM2 (ABclonal), CCL2(ABclonal). After incubating with primary antibodies at 4°C for overnight, the membranes were washed with phosphate-buffered saline with Tween-20 (PBST; 0.05% Tween-20) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 1 h. Proteins were detected by enhanced chemiluminescence substrates (PerkinElmer).

RNA extraction and real-time quantitative polymerase chain reaction

Real-time quantitative polymerase chain reaction (RT-qPCR) was conducted as described as in our laboratory.²⁶ The total RNA was isolated using TRIzol. RNA was subjected to complementary DNA (cDNA) synthesis and RT-qPCR using All-in-One First-Strand cDNA Synthesis Kit and All-in-One™ qPCR Mix (GeneCopoeia) according to the manufacturer’s protocol.

human CCL2 (hCCL2): CAGCCAGATGCAATCAATGCC, TGGAATCCTGAACCCACTTCT

human GAPDH (hGAPDH): GAGAGACCCTCACTGCTG, GATGGTACATGACAAGGTGC³⁰

Chemotaxis assay

Macrophage migration assay was performed as described.²⁶ Briefly, trypsinized cell suspensions were added to the upper chamber of 8 µm pore transwell inserts (Cat No. 353097, BD) for 2 h to allow attachment to the membrane, and then, transwells were moved to 24-well plates containing 0.7 mL cell-conditioned medium and incubated for 4 h further. Cells in the upper chamber were removed with a cotton swab after fixed in 4% paraformaldehyde and stained with crystal violet, and migrated cells in the lower chamber were quantified using 12–15 random fields.

Enzyme-linked immunosorbent assay

Enzyme-linked immunosorbent assays (ELISAs) for detecting the concentration of CCL2 were performed according to the manufacturer’s protocols using 48 h cell-conditioned media from CRC cells controlled for cell number and media volume.

Immunoprecipitation

Cell lysate was used for immunprecipitation (IP) as described with modification;²⁶ after wash with cold phosphate-buffered saline (PBS) twice, cells were lysed with IP lysis buffer (50 mM Tris–HCl, pH: 7.5; 150 mM NaCl; 1 mM ethylenediaminetetraacetic acid-2Na (EDTA-2Na); 10% Triton X-100; 0.5 mM Na₄P₂O₇·10H₂O; 1 mM C₃H₇Na₂O₆P 5(H₂O); 1 mM Na₃VO₄) for 10 min on ice, subsequently harvested and incubated with primary antibody, as indicated, for overnight at 4°C; protein A/G was added into cell lysis buffer for further 1 h to pull down the antibody combined proteins and the complex was analyzed by western blotting.

Immunohistochemistry

Immunohistochemical procedures were used according to a protocol from Cell Signaling Technology (Danvers, MA, USA). The information of CRC tissue microarray was supplied in Supplementary Table S1. All tissues stained for immune cells and intracellular molecules were fixed with 10% formalin except for those stained for macrophages with CD68 antibody.

Luciferase assay

Transient transfection was conducted in triplicate in 24-well plates, the NF-κB luciferase reporter vector was obtained from Stratagene (Cat# 219077, PathDetect, Stratagene, La Jolla, CA); CCL2-Luc plasmid was constructed by Angen Biotech Co., Ltd (Guangzhou, China). Luciferase activity was determined on triplicate samples and each experiment was repeated at least three times.

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed as described in our previous study using the ChIP-IT Express Enzymatic Chromatin Immunoprecipitation Kit (Active Motif, Shanghai, China) according to the manufacturer’s protocol. RT-qPCR of co-immunoprecipitated genomic DNA fragments was performed with the following promoter-specific primers: CCL2-NF-κB sense: 5′-ATTCTTCCCTCTTTCCCCCCCC-3′ and CCL2-NF-κB antisense: 5′-TCCGCTGAGTAAGTGCAGAGCC-3′; cycling parameters for 20 µL reactions were 95°C for 10 min, followed by 40 cycles of 95°C, 20 s; 60°C, 30 s; 72°C, 30 s. Fold enrichment in the bound fractions relative to input was calculated as previously described.

Statistics

All statistical analysis was done using GraphPad Prism V software (San Diego, California). A p value less than 0.05 was considered statistically significant.

Results

Clinical association of PKM2 expression with macrophage recruitment in CRC

We detected PKM2 expression and macrophage recruitment in CRC tissues and matched normal tissue using immunohistochemistry (IHC) with antibody against PKM2 and a marker of macrophages CD68, respectively. As shown in Figure 1(a) of one representative experiment, the results from IHC indicated that PKM2 is upregulated in CRC tissue compared with paired adjacent control group. In addition, highly expressed PKM2 was observed in three CRC cell lines, including HT-29 and Caco-2, compared with the normal human colon epithelial cell line NCM460, at least with up to 10-fold increase in the CRC tissues (Figure 1(b)), and we further evaluated potential associations between PKM2 expression and macrophage recruitment. Tumor with increased PKM2 expression had significantly abundant macrophages. When relative expression level of PKM2 was plotted against of CD68 in each tumor sample, a significant positive correlation was found (Figure 1(c)). All these data provided strong evidence that high expression of PKM2 was closely associated with macrophage infiltration in CRC.

Figure 1.

Expression of PKM2 is elevated in colorectal cancer tissue with macrophage recruitment. (a) IHC analysis of PKM2 expression in human colorectal cancer tissue and macrophage distribution between tumor and adjacent normal tissue. Original magnification = 200× (up, bar = 50 µm) and 400× (down, bar = 40 µm). (b) RT-PCR analysis of PKM2 expression at mRNA level in various colorectal cancer cell lines. (c) analysis of the relationship between macrophage number and PKM2 expression from colorectal cancer by IHC and real time PCR, respectively.

PKM2 in CRC cell triggers macrophage attraction

Given that our pervious finding demonstrated positive relationship between high expression of PKM2 and macrophage recruitment in CRC. However, the involvement of PKM2 in macrophage recruitment has not been well determined. We chose Caco-2 and HT-29 cells as models for studying CRC cells-secreted chemotaxis and focused on the functional role of PKM2 in recruitment of macrophages. SiRNA transfection strategy was performed to knockdown endogenous PKM2 in Caco-2 and HT-29 cells for 18 h, subsequently replaced medium with fresh serum-free medium for another 30 h and collected supernatant to further monitor the effect of PKM2 in CRC on macrophage recruitment via transwell assay.

The results from western blot and RT-PCR assay showed that siRNA–PKM2 transfection had a significant effect in reducing PKM2 expression of protein and messenger RNA (mRNA) level in Caco-2 and HT-29 cells; α-tubulin serves as an internal control (Figure 2(a)); the in vitro transwell assays results displayed that the conditioned medium (CM) from PKM2-depleted intestinal epithelial cells (IECs), including Caco-2 and HT-29 cells, dramatically attenuates migration of macrophages compared with paired control (Figure 2(b) and (c)). To further confirm the role of PKM2 described above, we used specific shRNA targeted to PKM2 to generate PKM2-knockdown (Lv-shPKM2) stable cells, for investigation. As shown in Figure 1s (a) and (b), PKM2–shRNA treatment led to a similar decrease in PKM2 expression at protein levels in HT-29 and Caco-2 cells and CM suppressed the migration of macrophages, respectively. Moreover, the CM from ectopic expression of PKM2 plasmid in HT-29 and Caco-2 contributed to macrophage migration (Figure 2(d)–(f)). Taken together, these results implied that specific chemokines mediated by PKM2 in IECs contribute to the recruitment of macrophages.

Figure 2.

The conditioned medium (CM) from colorectal cancer cells HT-29 and Caco-2 cells silenced endogenous PKM2 by siRNA which significantly reduced macrophage migration. (a) RT-PCR and western blotting were performed to validate knockdown efficiency. (b) Transwell assay was performed to minor macrophage migration. (c) Cell number was calculated and analyzed by t-test based on the results of (b). (d) HT-29 and Caco-2 cells were transfected with plasmids as indicated and verified by western blotting (left panel). (e) Transwell assays were performed as described in (b: left panel) and analyzed in (f ).

PKM2 contributes to macrophage recruitment by regulation of CCL2 expression and secretion

Since PKM2 knockdown in CRCs significantly attenuates the phenomenon of macrophage recruitment, we speculated that depletion of PKM2 in CRCs might alter the levels of secreted cytokines. The multiple studies have illustrated that CCL2/CCR2 axis signaling–mediated crosstalk between TAMs and tumor cells plays a critical role in macrophage recruitment in hepatocellular carcinoma and prostate cancer.^31–33 In light of this, we conducted western blotting and RT-qPCR assay to analyze the levels of key cytokines CCL2 secreted into medium. As expected, PKM2–shRNA treatment or siRNA–PKM2 transfection into HT-29 and Caco-2 cells caused a significant reduction in expression of mRNA and protein levels in CCL2 (Figure 3(a) and (b)).

Figure 3.

Silencing of PKM2 significantly inhibited CCL2 expression and secretion. (a) RT-PCR and (b) western blot were used to detect CCL2 expression treated as indicated group. (c) ELISA was performed to detect concentration of CCL2 in supernatant from group as indicated. (d) Transwell assays were performed to minor macrophage migration as described above from group as indicated and analyzed by one-way ANOVA.

Specifically, to further confirm our results, we measured cytokine secretion in HT-29 and Caco-2 cells depleted of endogenous PKM2 by shRNA targeting PKM2. ELISA was performed to assess the effect of PKM2 on CCL2 content in supernatant (Figure 3(c)). The results indicated that knockdown PKM2 in CRCs significantly reduced about 70% lower in supernatant compared with control group. Inversely, overexpression of PKM2 increased about twice in CCL2 secretion (Figure 1s (c)). In addition, we tried to verify the hypothesis that CRC cell–derived CCL2 mediated by PKM2 contributes to macrophage recruitment, the results from transwell assays indicated that addition of rCCL2 could have reversed reduction in macrophage migration caused by depleted PKM2 (Figure 3(d)). Collectively, these results showed that CCL2 is a critical factor for PKM2-dependent macrophage migration.

PKM2 interacts with p65 and activates NF-κB signaling pathways in CRCs

Multiple studies displayed that NF-κB may play a vital role in transactivation of inflammatory factors,^34–38 we sought to further explore whether PKM2-dependent expression of CCL2 could be attributed to activation of NF-κB signaling pathway. In light of this, HT-29 and Caco-2 of CRC cells were treated with PKM2–shRNA and analyzed with western blotting for the activation of NF-κB. As a shown in Figure 4(a), NF-κB p65 phosphorylation at Ser276 was significantly inhibited in HT-29 cells with PKM2 knockdown. The similar results were obtained in Caco-2 cells; most importantly, we found that endogenous PKM2 co-precipitated with p65 in HT-29 CRC cells by co-immunoprecipitation assay (Figure 4(b)). Taken together, these data suggested that PKM2 interacts with p65, which further promotes p65 transactivity.

Figure 4.

The binding of p65 to CCL2 promoter required PKM2. (a) Phosphorylation of p65 on Ser276 was significantly inhibited in HT-29 and Caco-2 cells with depleted PKM2 as indicated. (b) Immunoprecipitation assay was used to detect interaction of PKM2 with p65. (c) ChIP assay was performed to detect the effect of PKM2 on the binding of p65 to CCL2 promoter. (d) Luciferase assay was performed as described in the Materials and methods section to detect the effect of PKM2 on CCL2 transactivity. (e and f) The transwell assays were performed to minor macrophage migration attracted by the conditioned medium from group as indicated, and the cell number was counted and analyzed by one-way ANOVA. (g) Model of PKM2 mediated CCL2-induced macrophage migration. PKM2 interacts with p65 and induces transcription of p65 and in turn leads to activation of the CCL2 promoter and CCL2 secretion into the supernatant of the tumor cells. Tumor-derived CCL2 induces macrophage migration, remodeling a microenvironment favors tumor progression and growth. Thus, the non-metabolic function of PKM2 in remodeling tumor microenvironment was showed by modulated CCL2-induced macrophage recruitment.

PKM2 is required for binding of p65 NF-κB to CCL2 promoter

Multiple studies have reported that NF-κB signaling has a central role in the transactivation of CCL2,^39–43 which attracted us to examine whether PKM2-dependent expression of CCL2 could be attributed to the upregulation of NF-κB signaling. Luciferase activities were highly significantly upregulated in all p65 expression groups compared to control group, while the group treated with siPKM2 and p65 plasmid were decreased compared to paired control. All these data indicated that p65 is required for p65 to regulate CCL2 expression. In addition, ChIP analysis was applied to examine the interaction of p65 with CCL2 promoter. As shown in Figure 4(c) and (d), the results indicated that depletion of PKM2 in HT-29 cells significantly decreases binding of p65 to CCL2 promoter about 60% and lowers about 75% in Caco-2 cells, indicating PKM2 has a significant role in p65 NF-κB-mediated transactivation of CCL2.

Overexpression of p65 could reverse inhibition of CCL2 expression and macrophage migration in HT-29 cells with PKM2 depletion

To further address that PKM2-dependent CCL2 expression is attributed to upregulation of p65 NF-κB signaling, we tried to analyze whether overexpression of p65 could ameliorate inhibition of CCL2 expression caused by PKM2 depletion via delivering p65 plasmid into lentivirus established stable cell (lv-shPKM2). As shown in Figure 4(e), attenuation of CCL2 expression and secretion in PKM2-depleted HT-29 and Caco-2 cells was rescued by ectopic expression of p65 by western blotting and ELISA, which further increased macrophage migration by transwell assay analysis (Figure 4(e) and (f)). Summary, these data indicated that PKM2 plays a vital role in the regulation of NF-κB p65–mediated CCL2 gene expression and macrophage attraction.

Discussion

The alteration of tumor microenvironment, composed of cancer cells, inflammatory cells, and inflammatory mediator, is a hallmark of tumor. It plays an important role in tumor development and progression. As an important type of immune cells in tumor microenvironment, macrophages, widely distributed in all tissues, have been demonstrated to play a major role in the host innate immune response against pathogens. However, as shown in Figure 4(g), in this study, we presented that the non-metabolic functional PKM2 in CRC cells contributes macrophage recruitment via NF-κB signaling pathway–mediated CCL2 expression; while PKM2 interacts with p65 and is primary for phosphorylation of Ser276 on p65 NF-κB. Moreover, overexpression of p65 overcame inhibition of CCL2 expression and secretion caused by PKM2 depletion. Collectively, PKM2 may serve a critical role in macrophage recruitment.

Despite multiple studies have reported that the metabolic functions of PKM2, catalyzed the final step of glycolysis, is highly expressed in series of human cancer, the structural conversion between tetramer to dimer switch of PKM2 determined its various function. In addition to its glycolytic function, PKM2 also presented non-metabolic function in master of cell cycle, gene expression, and co-activator; these findings point to a crucial role for expression of PKM2 in tumor development and progression. As shown in this study, the transwell assay results indicated that the CM from knockdown of endogenous PKM2 in CRC cells diminished the migration ability of macrophages, implies that PKM2-dependent specific chemokines derived by CRC cells induce macrophage recruitment within tumor microenvironment. Moreover, the results from RT-qPCR, ELISA, and western blotting demonstrated that depletion of PKM2 in HT-29 and Caco-2 cells resulted in inhibition of CCL2 expression and secretion, further attenuating migration of macrophages, which is reversed by addition of rCCL2.

Next, we further tried to interrogate the precise mechanism underlying the role of PKM2 in regulating macrophage recruitment, activation of classical NF-κB signaling pathway in tumor microenvironment drawn our attentions. As expected, PKM2 is responsible for p65 NF-κB phosphorylation at Ser276 and is reported that phosphorylation of p65 NF-κB at Ser276 may represent nuclear translocation. Most importantly, PKM2 interacted with p65; these results indicated that PKM2 might play a major role in p65 NF-κB nuclear translocation. Although whether PKM2 directly interacted with p65 at Ser276 is still unclear, further investigation will be performed to address the mechanism. Interestingly, our evidences from ChIP assay displayed that silencing PKM2 dramatically diminished the binding of p65 NF-κB to CCL2 promoter, subsequently inhibiting CCL2 transactivity. Collectively, PKM2 may activate canonical p65 NF-κB signaling pathway through p65 interaction and Ser276 phosphorylation, subsequently induce CCL2 transactivity, which is strongly supported by the fact that ectopic expression of p65 NF-κB could rescue inhibition of macrophage recruitment caused by PKM2 depletion in HT-29 cells and the expression and secretion of CCL2 was largely recovered. Taken together, the results described above in CRC cell, including HT-29 and Caco-2 cells, PKM2 may play an important role in regulating macrophage recruitment via p65 NF-κB signal pathway.

In this study, we focused mainly on the role of non-metabolic PKM2 in recruitment of macrophages, as macrophages have important roles in many steps of tumor progression, including angiogenesis and tumor immunity. Further discussion was needed to address the mechanism for the process of polarization. Our results aid in extending the role of PKM2 in favor of tumor progression and suggest the rationale for anti-PKM2 therapy in CRC.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was supported by Major Program of Science and Technology Program of Guangzhou (No. 201300000087), Research Fund of Public Welfare in Health Industry of National Health and Family Planning Commission of China (No. 201402015 and No. 201502039), National Key Technology R&D Program (No. 2013BAI05B05), and Key Clinical Specialty Discipline Construction Program and Youth science fund of Kunshan traditional chinese medical (2015QNJJ05), China Postdoctoral fund (2015M582368).

References

Azzoni

Bottarelli

Campanini

. Distinct molecular patterns based on proximal and distal sporadic colorectal cancer: arguments for different mechanisms in the tumorigenesis. Int J Colorectal Dis 2007; 22(2): 115–126.

Edin

Wikberg

Dahlin

. The distribution of macrophages with a M1 or M2 phenotype in relation to prognosis and the molecular characteristics of colorectal cancer. PLoS ONE 2012; 7(10): e47045.

Wang

Zheng

. Dynamic changes and functions of macrophages and M1/M2 subpopulations during ulcerative colitis-associated carcinogenesis in an AOM/DSS mouse model. Mol Med Rep 2015; 11(4): 2397–2406.

Braster

Bögels

Beelen

. The delicate balance of macrophages in colorectal cancer; their role in tumour development and therapeutic potential. Immunobiology 2017; 222: 21–30.

Martinez

Gordon

. The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep 2014; 6: 13.

Pansa

Lamberti

Cogno

. Contribution of resident and recruited macrophages to the photodynamic intervention of colorectal tumor microenvironment. Tumour Biol 2016; 37: 541–552.

Wong

Ojo

Yan

. PKM2 contributes to cancer metabolism. Cancer Lett 2015; 356(2 Pt A): 184–191.

Yang

. Nuclear PKM2 regulates the Warburg effect. Cell Cycle 2013; 12(19): 3154–3158.

Warner

Carpenter

Bearss

. Activators of PKM2 in cancer metabolism. Future Med Chem 2014; 6(10): 1167–1178.

10.

Yang

Xia

Cao

. EGFR-induced and PKCepsilon monoubiquitylation-dependent NF-kappaB activation upregulates PKM2 expression and promotes tumorigenesis. Mol Cell 2012; 48(5): 771–784.

11.

Yang

Zheng

Xia

. ERK1/2-dependent phosphorylation and nuclear translocation of PKM2 promotes the Warburg effect. Nat Cell Biol 2012; 14(12): 1295–1304.

12.

Yang

Xia

Hawke

. PKM2 phosphorylates histone H3 and promotes gene transcription and tumorigenesis. Cell 2012; 150(4): 685–696.

13.

Sun

Zhu

Zhang

. Knockdown of PKM2 suppresses tumor growth and invasion in lung adenocarcinoma. Int J Mol Sci 2015; 16(10): 24574–24587.

14.

Taniguchi

Sugito

Kumazaki

. MicroRNA-124 inhibits cancer cell growth through PTB1/PKM1/PKM2 feedback cascade in colorectal cancer. Cancer Lett 2015; 363(1): 7–27.

15.

Jiang

Yang

. PKM2 regulates chromosome segregation and mitosis progression of tumor cells. Mol Cell 2014; 53(1): 75–87.

16.

Liu

Yin

. Regulatory circuit of PKM2/NF-kappaB/miR-148a/152-modulated tumor angiogenesis and cancer progression. Oncogene 2015; 34(43): 5482–5493.

17.

Fan

Shen

Tao

. PKM2 regulates hepatocellular carcinoma cell epithelial-mesenchymal transition and migration upon EGFR activation. Asian Pac J Cancer Prev 2014; 15(5): 1961–1970.

18.

Zhang

. MicroRNA-122 affects cell aggressiveness and apoptosis by targeting PKM2 in human hepatocellular carcinoma. Oncol Rep 2015; 34(4): 2054–2064.

19.

Liu

Liang

Liu

. M2 isoform of pyruvate kinase (PKM2) is upregulated in Kazakh’s ESCC and promotes proliferation and migration of ESCC cells. Tumour Biol 2016; 37: 2665–2672.

20.

Wang

. Knockdown of PKM2 enhances radiosensitivity of non-small cell lung cancer. Cell Biochem Biophys 2015; 73: 21–26.

21.

Yang

Xia

. Nuclear PKM2 regulates beta-catenin transactivation upon EGFR activation. Nature 2011; 480(7375): 118–122.

22.

Zhang

Chen

. Nuclear PKM2 contributes to gefitinib resistance via upregulation of STAT3 activation in colorectal cancer. Sci Rep 2015; 5: 16082.

23.

Papadaki

Sfakianaki

Lagoudaki

. PKM2 as a biomarker for chemosensitivity to front-line platinum-based chemotherapy in patients with metastatic non-small-cell lung cancer. Br J Cancer 2014; 111(9): 1757–1764.

24.

Jimenez-Garcia

Herranz

Higueras

. Tumor suppressor ARF regulates tissue microenvironment and tumor growth through modulation of macrophage polarization. Oncotarget 2016; 7: 66835–66850.

25.

Reber

Vermeulen

Haegeman

. Ser276 phosphorylation of NF-kB p65 by MSK1 controls SCF expression in inflammation. PLoS ONE 2009; 4(2): e4393.

26.

Zou

Zeng

. PKD2 and PKD3 promote prostate cancer cell invasion by modulating NF-kappaB- and HDAC1-mediated expression and activation of uPA. J Cell Sci 2012; 125(Pt 20): 4800–4811.

27.

Ueda

Okuda

Ohno

. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol 1994; 153(5): 2052–2063.

28.

Fantuzzi

Spadaro

Purificato

. Phosphatidylcholine-specific phospholipase C activation is required for CCR5-dependent, NF-kB-driven CCL2 secretion elicited in response to HIV-1 gp120 in human primary macrophages. Blood 2008; 111(7): 3355–3363.

29.

Goebeler

Gillitzer

Kilian

. Multiple signaling pathways regulate NF-kappaB-dependent transcription of the monocyte chemoattractant protein-1 gene in primary endothelial cells. Blood 2001; 97(1): 46–55.

30.

Low-Marchelli

Ardi

Vizcarra

. Twist1 induces CCL2 and recruits macrophages to promote angiogenesis. Cancer Res 2013; 73(2): 662–671.

31.

Yao

Yuan

. Targeting of tumour-infiltrating macrophages via CCL2/CCR2 signalling as a therapeutic strategy against hepatocellular carcinoma. Gut 2017; 66: 157–167.

32.

Kitamura

Qian

B-Z

Soong

. CCL2-induced chemokine cascade promotes breast cancer metastasis by enhancing retention of metastasis-associated macrophages. J Exp Med 2015; 212(7): 1043–1059.

33.

Moreno

Bannerman

. Conditional ablation of astroglial CCL2 suppresses CNS accumulation of M1 macrophages and preserves axons in mice with MOG peptide EAE. J Neurosci 2014; 34(24): 8175–8185.

34.

Alberti

Pinciroli

Valeri

. Ligand-dependent EGFR activation induces the co-expression of IL-6 and PAI-1 via the NFkB pathway in advanced-stage epithelial ovarian cancer. Oncogene 2012; 31(37): 4139–4149.

35.

Al-Halabi

Bou Chedid

Abou Merhi

. Gallotannin inhibits NFkB signaling and growth of human colon cancer xenografts. Cancer Biol Ther 2011; 12(1): 59–68.

36.

Kast

. Aspirin, TNF-alpha, NFkB, and survival in multiple myeloma: the importance of measuring TNF-alpha. Inflammopharmacology 2006; 14(5–6): 256–259.

37.

Rayet

Gelinas

. Aberrant rel/nfkb genes and activity in human cancer. Oncogene 1999; 18(49): 6938–6947.

38.

Sanchez-Fidalgo

Villegas

Rosillo

MÁ

. Dietary squalene supplementation improves DSS-induced acute colitis by downregulating p38 MAPK and NFkB signaling pathways. Mol Nutr Food Res 2015; 59(2): 284–292.

39.

Sarkozi

Corazza

Osterkamp

J-P

. Synergistic induction of CCL2/MCP-1 expression driven by oncostatin M and IL-1beta in human proximal tubular cells depends on STAT3 and p65 NFkappaB/RelA. Physiol Rep 2015; 3(2): e12298.

40.

Deng

Yuan

. Transcriptional regulation of increased CCL2 expression in pulmonary fibrosis involves nuclear factor-kappaB and activator protein-1. Int J Biochem Cell Biol 2013; 45(7): 1366–1376.

41.

Kim

Takahashi

Lee

. Methylmercury induces CCL2 expression through activation of NF-kappaB in human 1321N1 astrocytes. J Toxicol Sci 2012; 37(6): 1275–1278.

42.

Wolter

Doerrie

Weber

. c-Jun controls histone modifications, NF-kappaB recruitment, and RNA polymerase II function to activate the ccl2 gene. Mol Cell Biol 2008; 28(13): 4407–4423.

43.

Chen

Chiang

Lin

. Dual regulation of tumor necrosis factor-alpha-induced CCL2/monocyte chemoattractant protein-1 expression in vascular smooth muscle cells by nuclear factor-kappaB and activator protein-1: modulation by type III phosphodiesterase inhibition. J Pharmacol Exp Ther 2004; 309(3): 978–986.

Specific tumor-derived CCL2 mediated by pyruvate kinase M2 in colorectal cancer cells contributes to macrophage recruitment in tumor microenvironment

Abstract

Keywords

Introduction

Materials and methods

Chemicals and reagents

Cell culture and transfection

Establishment of stable short hairpin RNA lines

Western blot analysis

RNA extraction and real-time quantitative polymerase chain reaction

Chemotaxis assay

Enzyme-linked immunosorbent assay

Immunoprecipitation

Immunohistochemistry

Luciferase assay

Chromatin immunoprecipitation (ChIP) assay

Statistics

Results

Clinical association of PKM2 expression with macrophage recruitment in CRC

PKM2 in CRC cell triggers macrophage attraction

PKM2 contributes to macrophage recruitment by regulation of CCL2 expression and secretion

PKM2 interacts with p65 and activates NF-κB signaling pathways in CRCs

PKM2 is required for binding of p65 NF-κB to CCL2 promoter

Overexpression of p65 could reverse inhibition of CCL2 expression and macrophage migration in HT-29 cells with PKM2 depletion

Discussion

Footnotes

Declaration of conflicting interests

Funding

References