Sage Journals: Discover world-class research

Abstract

Arsenic trioxide (As₂O₃) has been used clinically as an anti-tumor agent. Its mechanisms are mostly considered to be the induction of apoptosis and cell cycle arrest. However, the detailed molecular mechanisms of its anti-cancer action through cell cycle arrest are poorly known. Furthermore, As₂O₃ has been shown to be a potential DNA methylation inhibitor, inducing DNA hypomethylation. We hypothesize that As₂O₃ may affect the expression of cell cycle regulatory genes by interfering with DNA methylation patterns. To explore this, we examined promoter methylation status of 24 cell cycle genes in breast cancer cell lines and in a normal breast tissue sample by methylation-specific polymerase chain reaction and/or restriction enzyme–based methods. Gene expression level and cell cycle distribution were quantified by real-time polymerase chain reaction and flow cytometric analyses, respectively. Our methylation analysis indicates that only promoters of RBL1 (p107), RASSF1A, and cyclin D2 were aberrantly methylated in studied breast cancer cell lines. As₂O₃ induced CpG island demethylation in promoter regions of these genes and restores their expression correlated with DNA methyltransferase inhibition. As₂O₃ also induced alterations in messenger RNA expression of several cell cycle–related genes independent of demethylation. Flow cytometric analysis revealed that the cell cycle arrest induced by As₂O₃ varied depending on cell lines, MCF-7 at G1 phase and both MDA-MB-231 and MDA-MB-468 cells at G2/M phase. These changes at transcriptional level of the cell cycle genes by the molecular mechanisms dependent and independent of demethylation are likely to represent the mechanisms of cell cycle redistribution in breast cancer cells, in response to As₂O₃ treatment.

Keywords

Breast cancer cell cycle genes DNA methylation arsenic trioxide DNA methyltransferase RBL1

Introduction

The cell cycle is an intricate and highly controlled process implicated in cell growth and division, DNA-damage response, and diseases including cancer.^1,2 Abnormalities in the expression of cell cycle regulatory genes resulting in higher proliferative capacity have been found in almost all human tumors, such as breast cancer.^3,4 The cell’s progression through G1, S, G2, and M phases of the cell cycle occurs in an orderly fashion and is controlled by the cooperative activity of a set of cell cycle regulatory genes.^5,6 These genes consist of those that encode cyclin-dependent kinases (CDKs) and the proteins that modulate their activity, cyclins, and cyclin-dependent kinase inhibitors (CKIs).⁶

The mechanisms governing cancer initiation and progression are the consequence not only of genetic alterations but also of epigenetic perturbations.^7–9 Aberrant changes in the promoter methylation pattern are the most common mechanism for the transcriptional inactivation of many genes and are found in different types of human tumors.¹⁰ A number of genes such as tumor suppressor genes, cell cycle control genes, DNA repair genes, and apoptosis-related genes are regulated by methylation of their promoter regions.¹¹ In proliferating cells, DNA methylation is laid down by DNA methyltransferases (DNMTs; DNMT1, DNMT3A, and DNMT3B). Inhibition of the expression of these proteins by DNA methylation inhibitors would lead to the progressive reduction in DNA methylation in newly divided cells.¹² DNA methylation inhibitors cause re-expression of methylation-silenced tumor suppressor genes resulting in the arrest of tumor growth and have emerged as an effective strategy against cancer.¹³ One of the recently identified DNA methylation inhibitors is arsenic trioxide (As₂O₃).^14,15 This multi-target drug represents an efficient treatment option for both new and relapsed cases of acute promyelocytic leukemia (APL)^16–19 and also has potential therapeutic value for the treatment of other malignant hematopoietic diseases and several solid tumors including breast cancer.^20–22 Its mechanisms have been intensively studied and are mostly considered to be the induction of cell apoptosis and cell cycle arrest.^23,24 Furthermore, As₂O₃ exposure has been shown to cause hypomethylation around the promoter region of several tumor suppressor genes leading to their re-expression in various cancer cells.^14,25 The mechanism of DNA hypomethylation after exposure to As₂O₃ is not clear. However, the arsenic metabolism may be associated with hypomethylation of promoter CpG islands in As₂O₃-treated cells. In a recent study using an APL cell line, we have shown that As₂O₃ by biotransformation into the intracellular methylated metabolites through arsenic methyltransferase (AS3MT) catalysis and by the suppression of DNMTs (DNMT1, DNMT3a, and DNMT3b) messenger RNA (mRNA) expression causes the consumption of methyl donors. The depletion of methyl groups led to the inability to maintain methylated cytosines in DNA, resulting in DNA demethylation.¹⁵

One of the mechanisms that have been proposed through which As₂O₃ eliminates APL and other cancer cells is the accumulation of cells in the phase of cell cycle and the subsequent mitotic arrest–associated apoptosis or mitotic catastrophe.^26–30 However, the cell cycle regulation mechanism of As₂O₃ has not yet been clarified, especially in solid tumors.³¹ These reports led us to hypothesize that the induction of DNA hypomethylation is one of the molecular mechanisms underlying the As₂O₃-promoted cell cycle arrest in breast cancer cells mediated by changes in the expression level of cell cycle–related genes. To provide preliminary support of this hypothesis, we first analyzed the promoter methylation status of 24 genes key to cell cycle regulation in different types of breast cancer cell lines and in a normal breast tissue sample, by methylation-specific polymerase chain reaction (MSP) and/or restriction enzyme–based methods, and then examined whether As₂O₃ could demethylate and restore the expression of hypermethylated genes.

Materials and methods

Cell lines

In this study, we used three different types of human breast cancer cell lines, which may mirror some of the substantial genomic and transcriptional abnormalities and biological heterogeneity found in breast tumors: MCF-7 cells (ER⁺, PR^±, and HER2⁻) exhibits low levels of invasion and belongs to the luminal subtype of human breast cancer cell lines; MDA-MB-231 cell line (ER⁻, PR⁻, and HER2⁻) is highly invasive and placed in the basal-B subtype; and MDA-MB-468 cells (ER⁻, PR⁻, and HER2⁻) have an intermediate invasive activity and belong to the basal-A subtype.^32–34

These cell lines were obtained from the National Cell Bank of Iran, Pasteur Institute of Iran (NCBI, Tehran, Iran). All cell lines were cultured in RPMI 1640 medium (Invitrogen, Auckland, New Zealand); supplemented with 10% fetal bovine serum (FBS; Invitrogen), 2 g/L sodium bicarbonate (Sigma, St. Louis, MO, USA), and 1% penicillin/streptomycin (Biosera, Ringmer, East Sussex, UK) in a humidified incubator at 37°C in 5% CO₂; and harvested with 0.25% trypsin–0.03% EDTA.

As₂O₃ treatment and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay

As₂O₃ was provided by Sina Darou (Tehran, Iran). For As₂O₃ treatment, the relevant amounts of stock solution (5 mM) of As₂O₃ were added to a culture medium to attain the desired concentrations. The cells were cultured in the absence and presence of varying concentrations of As₂O₃, ranging from 1 to 5 µM concentrations.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to determine the inhibitory effect of As₂O₃ on proliferation and cell viability. The cells at a density of 5000 cells/100 µL/well were seeded into 96-well plates (SPL Life Sciences, Pocheon, Korea) overnight and then treated with the desired concentrations (1, 2, 3, 4, and 5 µM) of As₂O₃ for 24, 48, and 72 h. After treatment, the media were replaced with 100 µL of MTT solution (0.5 mg/mL) (Sigma) and the cells were further incubated at 37°C for 3 h. Precipitated formazan was solubilized with 100 µL of dimethyl sulfoxide (DMSO), and the optical densitometry was measured at a wavelength of 570 nm in an enzyme-linked immunosorbent assay (ELISA) reader. The percentage of cell viability was calculated as (%) = (OD_exp/OD_con) × 100, where OD_exp and OD_con are the optical densities of treated and untreated cells, respectively.

Flow cytometric analysis of cell cycle distribution

Cellular DNA content and cell cycle distribution were determined by flow cytometric analyses before and after treatment of cultured cells with different concentrations of As₂O₃ for 48 h. Briefly, 1 × 10⁶ trypsinized cells from control (untreated) and treated cells were harvested, washed with cold phosphate-buffered saline (PBS), and then fixed in cold 70% ethanol to store at 4°C overnight. Next, fixed cells were pelleted by centrifugation and were resuspended in stain solution containing PBS, propidium iodide 50 µg/mL (Invitrogen), RNase A 100 µg/mL (Sigma), and 0.05% Triton X-100 at 37°C. After 30-min incubation, samples were analyzed by ParTec PAS III flow cytometer (ParTec, Munich, Germany), and data were interpreted using the Windows™ FloMax^® software.

Genomic DNA isolation

The total genomic DNA was isolated from cell lines, before and after As₂O₃ treatment, by a standard salting out procedure. The normal breast tissue sample (reduction mammoplasty) was obtained after surgical resection from Shaghayegh Clinic in Tehran, Iran. Genomic DNA was extracted from the frozen tissue using QIAamp^® DNA Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions, and used as a negative control for methylation. In addition, human peripheral blood samples from normal donors were provided by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran, Iran. Normal lymphocytes (NL) (mononuclear cells) were isolated from human peripheral blood by density-gradient centrifugation using Ficoll-Paque™ (GE Healthcare Life Sciences, Parramatta, Australia). Then, their total genomic DNA was also used as a positive control for unmethylated alleles of each gene. The DNA samples were used immediately or stored frozen until analysis at −20°C.

Promoter methylation analysis (restriction enzyme–based method)

The Human Cell Cycle EpiTect Methyl II Signature qPCR Array (SABiosciences, a QIAGEN company, Mainz, Germany) was used for bisulfite-free determination of the promoter methylation status of a panel of 22 genes that positively or negatively control the cell cycle. According to the manufacturer’s procedure, the isolated genomic DNAs were digested with two different restriction endonucleases, a methylation-sensitive restriction enzyme (MSRE) and/or a methylation-dependent restriction enzyme (MDRE). Following digestion, the relative amount of remaining DNA in each individual enzyme reaction was quantified by real-time polymerase chain reaction (PCR) using primers that flank a promoter region of gene of interest. The relative fractions of methylated and unmethylated DNA were subsequently determined by comparing the amount in each digest with that of a mock (no enzymes added) using a ΔCT method. The product of the mock represents the total amount of input DNA for real-time PCR detection. Therefore, the methylation status of individual genes as percentages of unmethylated and methylated fraction of input DNA was determined using a data analysis template which was provided by the manufacturer (SABiosciences).

Sodium bisulfite modification of extracted DNA and methylation-specific PCR

A total of 1–2 µg of genomic DNA was treated with sodium bisulfite using the EpiTect Bisulfite Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

Based on the CpG-rich islands in the promoter sequence of RBL1 and cyclin D2, methylation- and unmethylation-specific primers were designed using MethPrimer program (www.urogene.org/methprimer/). Primer sequences used for MSP of RASSF1A are from previously published study.³⁵ The sequences of PCR primers, annealing temperatures, and the expected sizes of PCR products are summarized in Table 1. The PCR reaction was performed by FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Mannheim, Germany), according to the supplier’s recommendations and included forward and reverse primers (10 pmol/µL of each primer pair per reaction), and bisulfite-modified DNA (30–100 ng) in a final volume of 25 µL. Taq DNA Polymerase 2× Master Mix RED (Ampliqon, Odense, Denmark), consisting of 1.5 mM MgCl₂ final concentration, was also used; in this case, reactions were hot-started at 95°C for 5 min prior to PCR cycling and the addition of Ampliqon Master Mix. Amplification of three genes were performed with a thermal cycler instrument (Applied Biosystems Veriti™, Foster City, CA, USA) under following conditions: 1 cycle of 95°C for 5 min; 40 cycles of 95°C for 30 s, at specific annealing temperature as listed in Table 1 for 25 s, and 72°C for 25 s; and a final extension of 7 min at 72°C. A reaction without DNA (water blank) was used as negative control reaction for contamination checking in each set of PCR reactions; EpiTect^® Control DNA (human), methylated and bisulfite converted (Qiagen, Venlo, Limburg, Netherlands), containing in vitro-methylated and bisulfite-converted DNAs, was used as positive control for methylated alleles; NL DNA and normal breast tissue sample DNA used as negative controls for methylation show unmethylated DNAs. After amplification, 10 µL of the PCR products was resolved by electrophoresis in 3% agarose gels (UltraPure™ Agarose; Invitrogen, Carlsbad, CA, USA), stained with SYBR^® Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, USA), and visualized under ultraviolet (UV) illumination (Bio-Rad’s Gel Doc™ XR+ System, Hercules, CA, USA). All MSP assays were repeated at least three times.

Table 1.

PCR primer sequences used for promoter methylation analysis, the expected sizes of PCR products, and annealing temperatures.

Name	Primers’ pair sequences (5′→3′)	Size (bp)	Annealing temperature (°C)
RASSF1A-M	F: GGGTTTTGCGAGAGCGCG R: GCTAACAAACGCGAACCG	169	64
RASSF1A-U	F: GGTTTTGTGAGAGTGTGTTTAG R: CACTAACAAACACAAACCAAAC	169	60
Cyclin D2-M	F: TACGTGTTAGGGTCGATCGT R: GCTAAACGTAACCACACCGAT	266	63
Cyclin D2-U	F:GTTAGAGTATGTGTTAGGGTTGATT R: CACTAAACATAACCACACCAAT	274	58
RBL1-M	F: GGAGGGATTGTTAGGAGTTTC R: CTCAACGTAAAACTTATCCTCGAA	219	54
RBL1-U	F: GGAGGGATTGTTAGGAGTTTTG R:CCCTCAACATAAAACTTATCCTCAA	221	59

M: methylated-specific primer; U: unmethylated-specific primer; F: forward primer; R: reverse primer.

Analysis of gene expression by quantitative real-time PCR

Total RNA from cultured cells was extracted by TriPure Isolation Reagent (Roche Applied Science) according to manufacturer’s instructions and quantified by NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, Delaware, USA). Then, 1 µg of RNA from each sample was applied to synthesize complementary DNA (cDNA) using the PrimeScript RT Reagent Kit (Takara Bio Inc., Otsu, Japan) according to the manufacture’s specifications. Real-time PCR assay was performed with a light cycler instrument (Roche Diagnostics, Mannheim, Germany) using SYBR Premix Ex Taq (Takara Bio Inc.). In a final volume of 20 µL in a capillary tube, 2 µL of cDNA samples, 10 µL SYBR Green Master Mix, 0.5 µL of each forward and reverse primers (10 pmol), and 7 µL of nuclease-free water (Qiagen, Hilden, Germany) were added to conduct real-time PCR. Thermal cycling conditions involved an initial activation step of 30 s at 95°C followed by 40 cycles including a denaturation step of 5 s at 95°C and a combined annealing/extension step of 20 s at 60°C. Melting curves were analyzed to validate single PCR product of each primer. All primer pairs amplified a single fragment without primer dimer. Hypoxanthine phosphoribosyltransferase 1 (HPRT1) was amplified as a housekeeping gene, and the fold change in expression of each target mRNA relative to HPRT1 was calculated based on 2^−ΔΔCt relative expression formula. The sequences of forward and reverse primers and the relevant products sizes are shown in Table 2.

Table 2.

Nucleotide sequences of the primers used for quantitative real-time RT-PCR.

Gene	Accession number	Forward primer (5′–3′)	Reverse primer (5′–3′)	Size (bp)
HPRT1	NM_000194	CCTGGCGTCGTGATTAGTGAT	AGACGTTCAGTCCTGTCCATAA	131
DNMT1	NM_001379	GATCGAATTCATGCCGGCGCGTACCGCCCCAG	ATGGTGGTTTGCCTGGTGC	124
DNMT3a	NM_175629	GGGGACGTCCGCAGCGTCACAC	CAGGGTTGGACTCGAGAAATCGC	137
DNMT3b	NM_006892	CCTGCTGAATTACTCACGCCCC	GTCTGTGTAGTGCACAGGAAAGCC	125
AS3MT	NM_020682	CGTCTATACGAGCCTTGAAC	AACGACAGTCACCGATAA	156
RBL1	NM_002895	ACCACCAAAGTTACCACGAAG	CCCCAATCATCCGAAAATTACCC	119
RASSF1A	NM_007182	ACCTCTGTGGCGACTTCATCT	AGGTGAACTTGCAATGCGC	69
CCND2	NM_001759	TTCCGCAGTGCTCCTACTTC	CGCACTTCTGTTCCTCACAG	105
CDKN1A	NM_000389	CCTGTCACTGTCTTGTACCCT	GCGTTTGGAGTGGTAGAAATCT	130
GADD45A	NM_001924	GAGAGCAGAAGACCGAAAGGA	CACAACACCACGTTATCGGG	145
TP53	NM_001126118	CAGCACATGACGGAGGTTGT	TCATCCAAATACTCCACACGC	125
CCND1	NM_053056	GAACAAACAGATCATCCGCAAAC	GCGGTAGTAGGACAGGAAGTTG	166
CCNE1	NM_001238	GGAAGGCAAACGTGACCGT	AGTTTGGGTAAACCCGGTCAT	177
CCNB1	NM_031966	AACTTTCGCCTGAGCCTATTTTG	TGGTCTGACTGCTTGCTCTTC	227

Statistical analysis

All experiments were carried out in duplicate or triplicate, and the results have been expressed as mean ± standard error (SE). Statistical significances of difference were determined using paired two-tailed Student’s t-tests. Statistically different values were considered significant at p values <0.05 compared to corresponding control.

Results

DNA methylation pattern of cell cycle regulatory genes in breast cell lines

In this study, we analyzed the promoter methylation pattern of 24 different genes (22 genes by a restriction enzyme–based PCR method and 2 additional genes by MSP method) in two breast cancer cell lines (MCF-7 and MDA-MB-231) and in a normal breast tissue sample. After identifying methylated genes, the effect of As₂O₃ on the promoter methylation pattern of the methylated genes was analyzed by methylation-specific PCR (MSP) method in three cell lines (including MDA-MB-468 cell line).

The functional gene groupings are listed in Table 3; all these genes are involved in the cell cycle regulation such as phase transitions and checkpoints, DNA replication, and cell cycle arrest. The promoter methylation status of a panel of 22 genes (from SABiosciences) is listed in Table 4 as percentage of unmethylated and methylated fraction of input DNA in MCF-7 and MDA-MB-231 cell lines and also in normal breast tissue. According to the manufacturer, methylated represents the fraction of input genomic DNA containing two or more methylated CpG sites in the targeted region of a gene and unmethylated represents the fraction of input genomic DNA containing no methylated CpG sites in the amplified region of a gene. The real-time PCR results revealed that 55.8% and 55.1% of total input DNA had methylated RBL1 (p107) gene promoter in MCF-7 and MDA-MB-231 cell lines, respectively, compared to 2.8% in normal breast tissue. Additionally, the methylation frequencies of GADD45A were 10.9% and 4.6% in MCF-7 and MDA-MB-231, respectively, compared to 0.3% in normal breast tissue. However, the promoter region of the remaining genes did not show significant methylation in human breast cancer cell lines.

Table 3.

24 cell cycle regulatory genes: functional gene groupings.

G1 phase and G1/S transition: CCND1, CCND2, CCNE1, CDK4, CDKN1B (p27KIP1).

S phase and DNA replication: MCM2, MCM4.

G2 phase and G2/M transition: CCNB1, CDK5RAP1, CKS1B.

M phase: CCNF, MRE11A, RAD51.

Cell cycle checkpoint and cell cycle arrest: ATM, BRCA1, BRCA2, CDK2, CDKN1A (p21CIP1/WAF1), CDKN1B (p27KIP1), CHEK1, GADD45A, RAD9A, RASSF1A, TP53.

Regulation of cell cycle: ATM, BRCA1, BRCA2, CCNB1, CCND1, CCND2, CCNE1, CCNF, CDK2, CDK4, CDKN1A (p21CIP1/WAF1), CDKN1B (p27KIP1), CKS1B, GADD45A, RAD9A, RASSF1A, RBL1, TP53.

Table 4.

The promoter methylation status of a panel of 22 genes key to cell cycle regulation in MCF-7 and MDA-MB-231 breast cancer cell lines and in a normal human breast tissue.

Gene symbol	MCF-7		MDA-MB-231		Normal breast
Gene symbol	UM	M	UM	M	UM	M
ATM	99.9%	0.2%	100.0%	0.0%	99.2%	0.9%
BRCA1	99.7%	0.3%	99.9%	0.1%	99.9%	0.1%
BRCA2	99.9%	0.1%	99.9%	0.1%	99.4%	0.6%
CCNB1	98.9%	1.1%	99.8%	0.2%	99.4%	0.6%
CCND1	100.0%	0.0%	100.0%	0.1%	99.6%	0.4%
CCNE1	100.0%	0.0%	99.9%	0.1%	99.9%	0.1%
CCNF	99.9%	0.1%	99.8%	0.2%	99.7%	0.3%
CDK2	99.6%	0.4%	99.8%	0.2%	98.6%	1.4%
CDK4	99.8%	0.2%	99.8%	0.2%	99.1%	0.9%
CDK5RAP1	99.9%	0.1%	100.0%	0.0%	99.9%	0.1%
CDKN1A	94.1%	5.9%	98.8%	1.2%	99.4%	0.6%
CDKN1B	99.5%	0.5%	100.0%	0.0%	99.2%	0.8%
CHEK1	99.9%	0.1%	100.0%	0.0%	99.0%	1.0%
CKS1B	99.7%	0.3%	99.8%	0.2%	98.5%	1.5%
GADD45A	89.1%	10.9%	95.4%	4.6%	99.7%	0.3%
MCM2	99.7%	0.3%	99.7%	0.3%	99.6%	0.4%
MCM4	99.8%	0.2%	99.9%	0.1%	100.0%	0.0%
MRE11A	99.3%	0.7%	99.9%	0.1%	98.7%	1.3%
RAD51	99.8%	0.2%	100.0%	0.0%	99.6%	0.4%
RAD9A	99.6%	0.4%	99.8%	0.2%	99.9%	0.1%
RBL1	44.3%	55.8%	44.9%	55.1%	97.2%	2.8%
TP53	99.9%	0.1%	100.0%	0.0%	100.0%	0.0%

UM: unmethylated; M: methylated.

Methylation status of the CpG islands of two more cell cycle–related genes, RASSF1A and cyclin D2, was analysed by MSP in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. Selection of RASSF1A and cyclin D2 was based on PubMeth (www.pubmeth.org); among the most analyzed genes for DNA methylation in breast cancer, two well-known cell cycle genes, RASSF1A and cyclin D2, are mostly hypermethylated in the majority of human breast cancers. Our MSP results show that RASSF1A and cyclin D2 were almost fully methylated in all three cell lines.

Inhibitory effect of As₂O₃ on survival of breast cancer cells

MTT assay was used to determine the suppressive effect of various concentrations of As₂O₃ at different time intervals (24, 48, and 72 h) on proliferation and viability of MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. As shown in Figure 1, As₂O₃ induced a remarkable reduction of viability in a dose- and time-dependent manner in three breast cancer cell lines. For example, at 48-h treatment with 1, 2, 3, and 4 µM As₂O₃, viability of MCF-7 cells was decreased by 7.84%, 25.57%, 43.7%, and 60.2% and MDA-MB-231 cells by 8.31%, 43.97%, 66.14, and 72.02%; and viability of MDA-MB-468 cells was reduced by 40.5%, 59.15%, 72.25%, and 80.5%, respectively (p < 0.05).

Figure 1.

Evaluation of As₂O₃ effect on the viability of MCF-7, MDA-MB-231, and MDA-MB-468 breast cancer cell lines. The cells were treated with indicated concentrations of As₂O₃ and their viability was assessed by MTT assay after 24, 48, and 72 h. Values are represented as percentage of viability compared to the untreated control cells and are given as mean ± SE from three independent experiments (p < 0.05 by one-way variance analysis).

As₂O₃ causes redistribution of cell cycle in breast cancer cells

Cellular DNA content and cell cycle changes were determined by flow cytometric analyses after 48 h of incubation with various concentrations of As₂O₃. As shown in Figure 2, As₂O₃ increased the number of MCF-7 cells accumulated in G1 phase and reduced the number of MCF-7 cells in S and G2/M phases of the cell cycle. On the contrary, As₂O₃ induced G2/M arrest and markedly decreased the proportion of cells in G1 phase in MDA-MB-231 cell line. In MDA-MB-468 cells, As₂O₃ induced both S and G2/M arrest and markedly reduced the proportion of cells in G1 phase. Collectively, these results suggest that As₂O₃ induces the cell cycle arrest at G1, S, and/or G2/M phases depending on the breast cancer cell lines.

Figure 2.

As₂O₃-induced cell cycle arrest at different phases in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines: (a) flow cytometric analyses of cell cycle distribution in As₂O₃-treated breast cancer cells stained with propidium iodide (PI) and (b) percentage of cells accumulated at G1, S, and G2/M phases of the cell cycle depending on the cell type after 48 h of incubation with different concentrations of As₂O₃. Columns indicate means of three independent experiments.

As₂O₃-induced demethylation of promoter-associated CpG islands of cell cycle–related genes in breast cancer cell lines

To determine whether As₂O₃ can act as a demethylating agent, the methylation status of the CpG islands of three genes (RBL1, RASSF1A, and cyclin D2), which were highly methylated, was examined by MSP method in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines before and after treatment with As₂O₃.

Based on MTT results, all three breast cancer cell lines were treated with As₂O₃ at concentration of 3 µM for 48 h for performing bisulfite conversion and MSP reactions. As shown in Figure 3, after treatment with As₂O₃, the RBL1, RASSF1A, and cyclin D2 genes were converted into partially demethylated genes in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. We showed a significant decrease in the methylated-specific bands and an increase in the unmethylated-specific bands of RBL1, RASSF1A, and cyclin D2 genes in cells treated with As₂O₃. It is useful to note that the analysis of DNA methylation pattern of the RBL1 promoter by MSP yielded results almost similar to the restriction endonuclease–based method. Collectively, our study suggests that As₂O₃ treatment could result in demethylation of the hypermethylated CpG islands of the cell cycle–related genes in different human breast cancer cell lines.

Figure 3.

Methylation analysis of the three cell cycle–related gene promoters, (a) RBL1, (b) RASSF1A, and (c) cyclin D2, by MSP in three breast cancer cell lines. Cell lines, MCF-7, MDA-MB-468, and MDA-MB-231, were treated with 3 µM of As₂O₃ for 48 h, and CpG island promoter methylation status of these cell cycle genes was determined using methylation-specific PCR. H₂O served as a negative control reaction without DNA (water blank) for control of contamination in the PCR reaction. In vitro–methylated DNA (IVD) and normal lymphocytes (NL) were used as positive and negative controls for methylation, respectively. Normal breast tissue (reduction mammoplasty) was used as another negative control for methylation. Untreated and As₂O₃-treated cell lines were amplified with methylated (M) and unmethylated (U) primers after bisulfite-treated genomic DNA.

Alterations in mRNA expression levels of DNMTs and AS3MT in As₂O₃-treated breast cancer cells

To investigate the mechanism of As₂O₃-induced DNA hypomethylation, we used quantitative real-time PCR to determine whether DNMTs and AS3MT mRNA levels would be changed in breast cell lines after treatment with different concentrations of As₂O₃ for 48 h. As presented in Figure 4, As₂O₃ inhibited DNMT1 (maintenance DNMT) mRNA levels in all three breast cancer cell lines (p < 0.05). The mRNA expression of DNMT3a as a de novo DNMT was decreased in MCF-7 and MDA-MB-468 cell lines, but not in MDA-MB-231 cells. Interestingly, the mRNA expression of DNMT3b (de novo DNMT) was increased in three breast cancer cells after As₂O₃ treatment. The mRNA level of AS3MT, a key enzyme that catalyzes the conversion of inorganic As₂O₃ to methylated products, was increased steadily in As₂O₃-treated MCF-7 and MDA-MB-468 cells (p < 0.05; Figure 4(a) and (c)); however, its expression was reduced in MDA-MB-231 cells (Figure 4(b)).

Figure 4.

The effect of As₂O₃ on transcriptional levels of DNMT1, DNMT3a, DNMT3b, and AS3MT in breast cancer cell lines: (a) MCF-7, (b) MDA-MB-231, and (c) MDA-MB-468 cells were treated with various concentrations of As₂O₃ for 48 h. Data are shown as fold change in relative expression levels of transcripts determined by quantitative real-time PCR. Values are normalized using the expression of the housekeeping HPRT1 on the basis of comparative Ct (2^−ΔΔCt) method. Values are given as mean ± SE of three independent experiments (p < 0.05).

Correlation between DNA methylation pattern and basal expression of RBL1, RASSF1A and cyclin D2 genes in breast cancer cell lines

In order to determine whether a relationship exists between promoter DNA methylation status and basal expression level of RBL1, RASSF1A, and cyclin D2 genes in the untreated MCF-7, MDA-MB-231, and MDA-MB-468 cell lines, the percentage of methylated bands (as compared to the unmethylated) was estimated from the intensity of bands in the gel image using Quantity One and Multi-Analysis softwares (Bio-Rad Laboratories, Hercules, CA, USA). The basal gene expression level (expression level in the untreated cells) was measured by quantitative reverse transcription PCR (QRT-PCR), as described before.

As shown in Figure 5, the results show that the expression of RBL1 was partially silenced, whereas expression of RASSF1A and cyclin D2 was almost fully silenced in all three untreated cell lines, suggesting that the downregulation of RBL1 mRNA levels and the loss of RASSF1A and cyclin D2 expressions in the studied breast cancer cell lines were probably as the result of promoter methylation.

Figure 5.

Relation between percentage of (a) promoter methylation and (b) basal gene expression level of RBL1, RASSF1A, and cyclin D2 in untreated MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. Values are given as mean ± SE of three independent experiments.

As₂O₃-induced re-expression or upregulation of demethylated cell cycle genes mRNA in breast cancer cells

Figure 6 shows increases in mRNA expression levels of RBL1, RASSF1A, and cyclin D2 genes in breast cancer cells treated with different concentrations (1, 2, 3, and 4 µM) of As₂O₃ for 48 h, relative to the untreated cells. The mRNA level of RBL1 was markedly enhanced and mRNA expression of RASSF1A and cyclin D2 was indeed restored by As₂O₃ treatment in all three cell lines. These results are consistent with the concept that demethylation of the methylation-silenced cell cycle genes is linked to the As₂O₃-mediated re-expression or upregulation of these genes.

Figure 6.

Effects of As₂O₃ on mRNA expression level of genes involved in cell cycle regulation in breast cancer cell lines. The effects of different concentrations of As₂O₃ on the mRNA levels of methylated genes (RBL1, RASSF1A, and cyclin D2) and unmethylated genes (p21, GADD45A, cyclin D1, cyclin D1, and cyclin D1) involved in cell cycle regulation were analyzed after treatment for 48 h in (a) MCF-7, (b) MDA-MB-231, and (c) MDA-MB-468 cells. Data are shown as fold change in expression level of transcripts relative to the untreated controls as determined by QRT-PCR. Values were normalized using the expression of the housekeeping HPRT1 on the basis of comparative Ct (2^−ΔΔCt) method. Values are given as mean ± SE of three independent experiments (p < 0.05).

As₂O₃ changes transcriptional level of unmethylated cell cycle genes in breast cancer cells

To gain further insights into the effect of As₂O₃ on cell cycle, we examined the mRNA expression of several other genes key to the cell cycle regulation in breast cancer cells exposed to various concentrations of As₂O₃ for 48 h. Based on the results of the restriction enzyme assays, these cell cycle–related genes were unmethylated in MCF-7 and MDA-MB-231 cell lines.

As indicated in Figure 6, the expression levels of cell cycle negative regulatory genes p21, p53, and GADD45A were significantly increased in MCF-7 cells with wild-type p53 gene (p < 0.05). While, the mRNA level of p53 was not measured in the MDA-MB-231 and MDA-MB-468 cell lines with mutant p53. As₂O₃ reduced the mRNA levels of cyclin D1 and cyclin E1 in MCF-7 cells (p < 0.05), while the mRNA level of these genes was increased or not changed in MDA-MB-231 and MDA-MB-468 cells. The expression of cyclin B1, a positive regulator of cell cycle, was noticeably decreased (p < 0.05) in all three breast cancer cell lines, more significantly in MDA-MB-231 and MDA-MB-468 cell lines.

Discussion

It is now well known that the deregulation of cell cycle progression is one of the most important changes during cancer development. Understanding the molecular details of the cell cycle control and checkpoint aberrations in cancer and manipulation of these mechanisms may provide insights into the discovery of effective treatment strategies.^36,37

In this study, we aim to determine promoter methylation status of 24 different cell cycle regulatory genes in different subtypes of breast cancer cell lines and in a normal breast tissue sample by MSP and/or restriction enzyme–based methods. The function of these cell cycle regulatory genes is listed briefly in Table 5. Our methylation analysis indicates that only promoters of RBL1 (p107), RASSF1A, and cyclin D2 genes were aberrantly methylated in all three cell lines. A low level of methylation was also found at the promoter of GADD45A gene in MCF-7 and MDA-MB-231 cells lines. Promoter methylation of these genes was probably tumor-specific phenomenon, confined to tumors and did not occur in the normal breast tissue. While our results revealed that a large number of important genes involved in controlling cell cycle checkpoints and DNA repair were unmethylated in breast cancer cells, it seems that the DNA methylation alterations are not implicated as a regulator of abnormal expression of many cell cycle genes in these breast cancer cells.

Table 5.

24 cell cycle genes studied for methylation.

Gene designation	Gene title	Chromosome location	Function of encoded Protein in cell cycle
ATM	Ataxia telangiectasia mutated	11q22.3	Once activated, the checkpoint leads to cell cycle arrest and either DNA repair or apoptosis.
BRCA1	Breast cancer 1, early onset	17q21.31	Required for appropriate cell cycle arrest in both S-phase and G2/M checkpoint of the cell cycle on DNA damage.
BRCA2	Breast cancer 2, early onset	13q12.3	May participate in S-phase checkpoint activation upon DNA damage.
CCNB1	Cyclin B1	5q13.2	Cyclin B1–Cdk1 complex is essential for the control of the cell cycle at the G2/M transition.
CCND1	Cyclin D1	11q13.3	Regulatory component of the cyclin D1–Cdk4/6 complex that phosphorylates and inhibits members of the retinoblastoma protein family including RB1 and regulates the cell cycle during G1/S transition.
CCND2	Cyclin D2	12p13.32	Involved in regulation of transition from G1 to S phase during the cell cycle.
CCNE1	Cyclin E1	19q12	Regulatory component of the cyclin E1–Cdk2 complex whose activity is required for cell cycle G1/S transition.
CCNF	Cyclin F	16p13.3	G2/mitotic-specific cyclin F is substrate recognition component of a complex which mediates ubiquitination and proteasomal degradation of CP110 during G2 phase, thereby acting as an inhibitor of centrosome reduplication.
CDK2	Cyclin-dependent kinase 2	12q13.2	Activated by interaction with cyclin E during early stages of DNA synthesis to permit G1/S transition, and subsequently activated by cyclin A during late stages of DNA replication to drive the transition from S phase to the G2 phase.
CDK4	Cyclin-dependent kinase 4	12q14.1	Catalytic subunit of cyclin D–CDK4 complex that phosphorylates and inhibits members of the retinoblastoma protein family including RB1 and is important for cell cycle G1 phase progression.
CDK5RAP1	CDK5 regulatory subunit associated protein 1	20q11.21	Specifically inhibits CDK5 activation by p35 and might be interacting with cell cycle regulating mitotic CDKs as well.
CDKN1A	Cyclin-dependent kinase inhibitor 1A “p21, Cip1”	6p21.1	Can inhibit the activity of cyclin–CDK2, CDK1, CDK4, or CDK6 complexes and function as a regulator of cell cycle progression at G1 and G2 phases and also can interact with PCNA, a DNA polymerase accessory factor, and play a regulatory role in S-phase DNA replication and DNA-damage repair.
CDKN1B	Cyclin-dependent kinase inhibitor 1B “p27, Kip1”	12p13.1	Potent inhibitor of cyclin E-, cyclin A-CDK2, and cyclin D-CDK4 complexes and involved in G1 arrest.
CHEK1	CHK1 checkpoint homolog “S. pombe”	11q24.2	Required for checkpoint-mediated cell cycle arrest, preventing cells from entry into mitosis and activation of DNA repair.
CKS1B	CDC28 protein kinase regulatory subunit 1B	1q21.3	Binds to the catalytic subunit of the cyclin-dependent kinases and is essential for their biological function.
GADD45A	Growth arrest and DNA-damage-inducible, alpha	1p31.2	Induction of cell cycle G2/M arrest through suppression of cyclin B1-CDK1 kinase activity and also inhibition of cell entry into S phase
MCM2	Minichromosome maintenance complex component 2	3q21.3	Acts as component of the MCM2-7 complex which is required for the entry in S phase and for the initiation of eukaryotic genome replication and has been shown to regulate the helicase activity of the complex.
MCM4	Minichromosome maintenance complex component 4	8q11.21	A component of the hexameric MCM complex which is essential for ‘once per cell cycle’ DNA replication initiation and elongation in eukaryotic cells and acts as a DNA unwinding enzyme.
MRE11A	MRE11 meiotic recombination 11 homolog A “S. cerevisiae”	11q21	Component of the MRN complex, which controls DNA replication initiation in response to DNA damage, thereby plays an essential role in the S-phase checkpoint. The complex is also required for double-strand break repair, telomere integrity maintenance, and meiosis.
RAD51	RAD51 homolog “S. cerevisiae”	15q15.1	In proliferating cells, RAD51 expression peaks in the S/G2 phases of the cell cycle indicating a role of the protein in intrachromosomal recombinational repair. Also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage.
RAD9A	RAD9 homolog A “S. pombe”	11q13.2	A cell cycle checkpoint protein required for cell cycle arrest and DNA-damage repair in response to DNA damage. RAD9 checkpoint is activated by DNA lesions and arrests cell division in late S/G2 phase.
RASSF1A	Ras association “RalGDS/AF-6” domain family member 1	3p21.31	A negative regulator of cell proliferation acting at the level of G1-/S-phase cell cycle progression through inhibition of cyclin D1 accumulation, engaging the Rb family cell cycle checkpoint, and preventing p53 degradation by promoting MDM2 ubiquitination.
RBL1	Retinoblastoma-like 1 “p107”	20q11.23	Prevents cell cycle progression by inhibiting the kinase activity of cyclin E–CDK2 and cyclin A–CDK2 complexes; this points to a unique role for p107 during S phase, in addition to its function in late G1 phase. Also binds to repressor E2F family members to bring them to their target genes.
TP53	Tumor protein p53	17p13.1	Involved in cell cycle regulation as a trans-activator that acts to negatively regulate cell division by controlling a set of genes required for this process and both G1/S and G2/M cell cycle checkpoints.

PCNA: proliferating cell nuclear antigen; Mre11-Rad50-Nbs1: MRN.

It has been shown that As₂O₃ can inhibit cancer cell proliferation by induction of cell cycle arrest in many cancer cells, including breast cancer. However, the molecular mechanisms by which As₂O₃ regulates various genes that cause redistribution of cell cycle remain to be elucidated. Recent studies have suggested novel chemo-preventative properties of As₂O₃ as DNMTs inhibitor.^14,15,38 In this study, we also found that As₂O₃ inhibits DNMT1 expression in all three breast cancer cells lines, but not DNMT3a or DNMT3b. The results are similar to those that reports that As₂O₃ inhibits DNMT1 protein and mRNA in the colon³⁹ and liver cancer cells.¹⁴ The prototypic DNMT, DNMT1 (maintenance DNMT), has far higher catalytic activity than DNMT3a and DNMT3b;⁹ it is essential and sufficient for maintenance of global DNA methylation and aberrant CpG island methylation patterns in human tumor cells.^14,40,41 It has been shown in colon, breast, bladder, and lung cancer cells that reduction of DNMT1 levels is sufficient to induce demethylation and the resultant re-expression of methylation-silenced genes.^40,42–45 We also found that As₂O₃ increased AS3MT expression level in MCF-7 and MDA-MB-468 cell lines but reduced in MDA-MB-231. These findings suggest that although AS3MT may be the predominant enzyme in the pathway for As₂O₃ methylation, there could be AS3MT-independent mechanisms and unidentified methyltransferases involved in alternative As₂O₃ methylation pathways.^46–50

In order to demonstrate that As₂O₃ as a DNA methylation inhibitor can induce hypomethylation of aberrantly methylated cell cycle regulatory genes in breast cancer cells, we examined the methylation status of promoter-associated CpG islands of the RBL1, RASSF1A, and cyclin D2, before and after treatment with As₂O₃ by MSP in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. Treatment with 3 µM of As₂O₃ for 48 h induced hypomethylation of the partially or fully hypermethylated CpG islands around the promoter regions of the RBL1, RASSF1A, and cyclin D2 genes in all three cell lines. Interestingly, the detection of DNA methylation pattern at the RBL1 promoter by MSP yielded similar results to restriction enzyme–based method. These results suggest that the ability of As₂O₃ to alter DNA methylation of the cell cycle genes may be an important mechanism leading to cell cycle arrest and apoptosis in breast cancer cells.

Furthermore, as it was expected, our results showed that there was an inverse correlation between promoter DNA methylation status and basal expression level of RBL1, RASSF1A, and cyclin D2 genes in the untreated MCF-7, MDA-MB-231, and MDA-MB-468 cell lines (Figure 5). The mRNA levels of RASSF1A and cyclin D2 genes were undetectable in all three cell lines before the As₂O₃ treatment where the promoters of these genes were fully hypermethylated. Whereas, RBL1 gene had some detectable expression in all three cell lines where the promoter of this gene was partially methylated or possibly was hemimethylated.

We show for the first time that the RBL1 (p107) gene promoter was aberrantly partially methylated in all three breast cell lines compared to the normal breast tissue. Like its family members (Rb and p130), RBL1 gene product is worthily involved in transcription repression and tumor suppression and plays a key role in negative control of cell cycle progression.^51,52 RBL1 is most highly expressed during the G1 to S transition of the cell cycle in actively dividing cells and stably associated with cyclin E/Cdk2 and cyclin A/Cdk2 complexes and inhibited their kinase activity in late G1 phase and during the S phase.^51–53 In our study, a methylation frequency of RBL1 in MCF-7 was 55.8% and in MDA-MB-231 was 55.1% compared to only 2.8% in normal breast tissue. As₂O₃ treatment induced demethylation of the RBL1 gene in all three cell lines up to 50%. At the same time, As₂O₃ induced significant upregulation of its mRNA (about five-fold) in MCF-7 and a slight increase in MDA-MB-231 and MDA-MB-468 cell lines.

RASSF1A is an important human tumor suppressor protein acting as a negative regulator of cell cycle progression through inhibition of G1/S. It can engage the Rb family cell cycle checkpoint and inhibit cyclin D1 accumulation probably through inhibition of its mRNA translation, which likely prevents RASSF1A-expressing cells from entering S phase.^54–56 Epigenetic inactivation of tumor suppressor gene RASSF1A by hypermethylation of CpG islands in the promoter region is an extremely common event in a considerable proportion of human cancers (at least 37 tumor types), including 49%–62% of breast cancers.^54,55,57 In our study, the promoter region of RASSF1A was completely methylated in all three cell lines and unmethylated in normal breast cancer tissue. As₂O₃ treatment induced hypomethylation of the RASSF1A genes in all three cell lines. The expression level of this gene was undetectable; As₂O₃ indeed restored mRNA expression level of RASSF1A in all three cell lines (45-, 13- and 100-fold increase in MCF-7, MDA-MB-231, and MDA-MB-468 cell lines, respectively).

Cyclin D2, a major regulator of cell cycle, is implicated in regulation of G1- to S-phase transition. Expression of cyclin D2 is unique among the D-type cyclins, being upregulated in a variety of normal human tissues, including breast tissue.^6,58 Whereas, loss of cyclin D2 expression by hypermethylation of its promoter region was found to be associated with tumor development in breast, lung, gastric, and pancreatic cancer, indicating that cyclin D2 might be involved in a vital tumor suppressor function in a cancer-type dependent manner.^10,58–60 Our results also showed aberrant methylation of the cyclin D2 gene in all three breast cancer cell lines and correlated with silencing of the gene expression. When the cells were exposed to As₂O₃, the cyclin D2 promoter was partially demethylated, and cyclin D2 mRNA expression was restored.

To gain further insights into the anti-cancer effect of As₂O₃ on cell cycle, we investigated the effect of As₂O₃ treatment on the mRNA expression level of several other important unmethylated or slightly methylated cell cycle regulatory genes, including p21, p53, and GADD45A which are known as negative regulators of cell cycle progression and cyclin D1, cyclin E1, and cyclin B1 as positive modulators of the cell division. These cyclins are key components of the cell cycle machinery that are responsible for the progression through the G1/S and G2/M phases of the cell cycle.^61–64 In our experiments, differential expression of cyclins was observed after As₂O₃ treatment in all three breast cancer cell lines, by a mechanism independent of demethylation.

The mRNA expression of GADD45A was increased in a dose-dependent manner in three studied breast cancer cell lines after As₂O₃ treatment (p < 0.05). It has been reported that GADD45A protein plays a role in the G2/M checkpoint in response to the DNA damage, and its most prominent action at the G2/M transition is disrupting the CDK1/cyclin B1 complex. However, GADD45A can also interact with p21 resulting in cell cycle arrest at both G1/S and G2/M checkpoints.⁵ GADD45A gene is mostly downregulated in many cancer cells including breast cancer;⁶⁵ the decrease in expression level of this gene is often, but not always, associated with its promoter methylation. It has been reported that As₂O₃ induces the GADD45A expression in cancer cells; however, the mechanism of induction is not known.⁶⁶ In this study, even though the methylation frequencies of GADD45A were 10.9% and 4.6% in MCF-7 and MDA-MB-231 cells, respectively, compared to 0.3% in normal breast tissue, the As₂O₃ treatment caused a significant upregulation of GADD45A expression level (about 16- and 11-fold increase, respectively). In this regard, the upregulation of GADD45A may have some significant roles in As₂O₃-induced cell cycle arrest in breast cancer cells.

In a previous study, we have shown that As₂O₃ is able to induce apoptosis and block cell cycle progression in the G2 phase in human APL NB4 cells.²³ Also, it has been demonstrated that As₂O₃ can cause the cell cycle arrest at different phases, G1/S and G2/M transitions,^{21,23,67–69} and even in S phase,⁷⁰ in cancer cells. Liu et al.⁶⁹ reported that the As₂O₃-induced G1 or G2/M cell cycle arrest in myeloma cells was dependent on p53 status. Here, our study demonstrated that As₂O₃ is capable of perturbing the cell cycle of the human breast cancer cells at various phases. Flow cytometric analysis revealed that As₂O₃ induced G1 arrest and inhibited cell cycle progression to the S and G2/M phases in MCF-7 cells. The growth arrest was associated with an inhibition of G1 cyclin (cyclin D1 and cyclin E1) expression. As₂O₃ also induced upregulation of p53, p21, GADD45A, RBL1, RASSF1A, and cyclin D2 by demethylation-independent and/or dependent mechanisms. p21 is a CKI required for the p53-mediated G1 arrest leading to apoptosis in cancer cells.⁷¹ In the presence of functional p53, As₂O₃ might act like a DNA damaging agent⁶⁹ that triggers p53-dependent DNA repair apparatus involving upregulation of p21 and GADD45A and blocking of cyclin D1 and cyclin E1 followed by the G1 arrest and eventually leading to apoptosis in MCF-7 cells with p53 wild-type.

On the contrary, As₂O₃ induced G2/M arrest in MDA-MB-231 cells as well as S and G2/M arrests in MDA-MB-468 cells. Cyclin D1 and cyclin E1 levels were increased or remained unchanged, and alterations in p21 expression were not significant in these two cell lines. It has been reported that in the lack of functional p53 and G1 arrest, DNA damage can lead to a p53-independent G2/M arrest but involving other DNA damage–responsive proteins such as ATR and ATM; this can block the formation of the mitotic cyclin B1/CDK1 complex and induce G2/M cell cycle arrest.^61,69 Moreover, GADD45A may also be involved in the G2/M checkpoint through several mechanisms such as interacting with p21 or disrupting the interaction between CDK1 and cyclin B1.^63,64 In this study, As₂O₃ clearly decreased the mRNA expression of cyclin B1 and upregulated the GADD45A mRNA level in these cell lines.

In conclusion, no single mechanism has been able to elucidate all of the effects seen with As₂O₃; yet, it most likely acts at multiple levels, with different modes of actions. However, we provided new evidence that the induction of DNA hypomethylation probably is one of the molecular mechanisms underlying the As₂O₃-promoted cell cycle arrest in breast cancer cells. As₂O₃ as a DNA methylation inhibitor via inhibition of DNMT1 mRNA level induced demethylation of the promoter-associated CpG islands resulting in upregulation of several cell cycle–related genes such as RBL1, RASSF1A, and cyclin D2 in breast cancer cell lines. As₂O₃ depending on the cell type induced the cell cycle arrest at different phases of breast cancer cell lines; it also induced alterations in the mRNA expression of several cell cycle regulatory genes, such as p21, GADD45A, p53, cyclin D1, cyclin E1, and cyclin B1 independent of demethylation in breast cancer cells. Overall, As₂O₃ induces cell cycle arrest at G1, S, or G2 phases, depending on the cell type, and modulates cell cycle regulatory gene expression by the molecular mechanisms dependent and/or independent of demethylation in breast cancer cells. Promoter methylation and mRNA expression of more cell cycle–related genes need to be analyzed in response to As₂O₃ effect in order to explore exact As₂O₃ mechanisms in induction of cell cycle arrest.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This study was funded by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran.

References

Schafer

. The cell cycle: a review. Vet Pathol 1998; 35(6): 461–478.

Caldon

Daly

Sutherland

. Cell cycle control in breast cancer cells. J Cell Biochem 2006; 97(2): 261–274.

Fernandez

Jares

Rey

. Cell cycle regulators and their abnormalities in breast cancer. Mol Pathol 1998; 51(6): 305–309.

Vermeulen

Van Bockstaele

Berneman

. The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif 2003; 36(3): 131–149.

Tamura

de Vasconcellos

Sarkar

. GADD45 proteins: central players in tumorigenesis. Curr Mol Med 2012; 12(5): 634–651.

Meyyappan

Wong

Hull

. Increased expression of cyclin D2 during multiple states of growth arrest in primary and established cells. Mol Cell Biol 1998; 18(6): 3163–3172.

Basse

Arock

. The increasing roles of epigenetics in breast cancer: implications for pathogenicity, biomarkers, prevention and treatment. Int J Cancer 2015; 137(12): 2785–2794.

Kanwal

Gupta

. Epigenetic modifications in cancer. Clin Genet 2012; 81(4): 303–311.

Taby

Issa

. Cancer epigenetics. CA Cancer J Clin 2010; 60(6): 376–392.

10.

Virmani

Rathi

Heda

. Aberrant methylation of the cyclin D2 promoter in primary small cell, nonsmall cell lung and breast cancers. Int J Cancer 2003; 107(3): 341–345.

11.

Widschwendter

Jones

. DNA methylation and breast carcinogenesis. Oncogene 2002; 21(35): 5462–5482.

12.

Issa

. DNA methylation as a therapeutic target in cancer. Clin Cancer Res 2007; 13(6): 1634–1637.

13.

Szyf

Pakneshan

Rabbani

. DNA methylation and breast cancer. Biochem Pharmacol 2004; 68(6): 1187–1197.

14.

Cui

Wakai

Shirai

. Arsenic trioxide inhibits DNA methyltransferase and restores methylation-silenced genes in human liver cancer cells. Hum Pathol 2006; 37(3): 298–311.

15.

Khaleghian

Ghaffari

Ahmadian

. Metabolism of arsenic trioxide in acute promyelocytic leukemia cells. J Cell Biochem 2014; 115(10): 1729–1739.

16.

Lengfelder

Hofmann

Nowak

. Impact of arsenic trioxide in the treatment of acute promyelocytic leukemia. Leukemia 2012; 26(3): 433–442.

17.

Ghavamzadeh

Alimoghaddam

Ghaffari

. Treatment of acute promyelocytic leukemia with arsenic trioxide without ATRA and/or chemotherapy. Ann Oncol 2006; 17(1): 131–134.

18.

Emadi

Gore

. Arsenic trioxide: an old drug rediscovered. Blood Rev 2010; 24(4–5): 191–199.

19.

Ghavamzadeh

Alimoghaddam

Rostami

. Phase II study of single-agent arsenic trioxide for the front-line therapy of acute promyelocytic leukemia. J Clin Oncol 2011; 29(20): 2753–2757.

20.

Liu

Tao

. Radiosensitizing effects of arsenic trioxide on MCF-7 human breast cancer cells exposed to 89 strontium chloride. Oncol Rep 2012; 28(5): 1894–1902.

21.

Wang

Gao

Long

. Essential role of cell cycle regulatory genes p21 and p27 expression in inhibition of breast cancer cells by arsenic trioxide. Med Oncol 2011; 28(4): 1225–1254.

22.

Dizaji

Malehmir

Ghavamzadeh

. Synergistic effects of arsenic trioxide and silibinin on apoptosis and invasion in human glioblastoma U87MG cell line. Neurochem Res 2012; 37(2): 370–380.

23.

Hassani

Ghaffari

Zaker

. Azidothymidine hinders arsenic trioxide-induced apoptosis in acute promyelocytic leukemia cells by induction of p21 and attenuation of G2/M arrest. Ann Hematol 2013; 92(9): 1207–1220.

24.

Ghaffari

Momeny

Bashash

. Cytotoxic effect of arsenic trioxide on acute promyelocytic leukemia cells through suppression of NFkbeta-dependent induction of hTERT due to down-regulation of Pin1 transcription. Hematology 2012; 17(4): 198–206.

25.

Tong

Lin

. Arsenic trioxide induced p15INK4B gene expression in myelodysplastic syndrome cell line MUTZ-1. Zhonghua Xue Ye Xue Za Zhi 2002; 23(12): 638–641.

26.

Cai

Huang

. Arsenic trioxide-induced mitotic arrest and apoptosis in acute promyelocytic leukemia cells. Leukemia 2003; 17(7): 1333–1337.

27.

Taylor

McNeely

Miller

. p53 suppression of arsenite-induced mitotic catastrophe is mediated by p21CIP1/WAF1. J Pharmacol Exp Ther 2006; 318(1): 142–151.

28.

Gao

Yuan

. The cell cycle related apoptotic susceptibility to arsenic trioxide is associated with the level of reactive oxygen species. Cell Res 2004; 14(1): 81–85.

29.

McNeely

Taylor

States

. Mitotic arrest-associated apoptosis induced by sodium arsenite in A375 melanoma cells is BUBR1-dependent. Toxicol Appl Pharmacol 2008; 231(1): 61–67.

30.

McNeely

Belshoff

Taylor

. Sensitivity to sodium arsenite in human melanoma cells depends upon susceptibility to arsenite-induced mitotic arrest. Toxicol Appl Pharmacol 2008; 229(2): 252–261.

31.

Zhao

Tsuchida

Kawakami

. Effect of As₂O₃ on cell cycle progression and cyclins D1 and B1 expression in two glioblastoma cell lines differing in p53 status. Int J Oncol 2002; 21(1): 49–55.

32.

Kao

Salari

Bocanegra

. Molecular profiling of breast cancer cell lines defines relevant tumor models and provides a resource for cancer gene discovery. PLoS ONE 2009; 4(7): e6146.

33.

Holliday

Speirs

. Choosing the right cell line for breast cancer research. Breast Cancer Res 2011; 13(4): 215.

34.

Gordon

Mulligan

Maxwell-Jones

. Breast cell invasive potential relates to the myoepithelial phenotype. Int J Cancer 2003; 106(1): 8–16.

35.

Burbee

Forgacs

Zochbauer-Muller

. Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst 2001; 93(9): 691–699.

36.

Golias

Charalabopoulos

. Cell proliferation and cell cycle control: a mini review. Int J Clin Pract 2004; 58(12): 1134–1141.

37.

Park

Lee

. Cell cycle and cancer. J Biochem Mol Biol 2003; 36(1): 60–65.

38.

Reichard

Schnekenburger

Puga

. Long term low-dose arsenic exposure induces loss of DNA methylation. Biochem Biophys Res Commun 2007; 352(1): 188–192.

39.

Bartlett

Gorry

. Three epigenetic drugs up-regulate homeobox gene Rhox5 in cancer cells through overlapping and distinct molecular mechanisms. Mol Pharmacol 2009; 76(5): 1072–1081.

40.

Robert

Morin

Beaulieu

. DNMT1 is required to maintain CpG methylation and aberrant gene silencing in human cancer cells. Nat Genet 2003; 33(1): 61–65.

41.

Christman

. 5-Azacytidine and 5-aza-2′-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene 2002; 21(35): 5483–5495.

42.

Chen

Hevi

Gay

. Complete inactivation of DNMT1 leads to mitotic catastrophe in human cancer cells. Nat Genet 2007; 39(3): 391–396.

43.

Yan

Nass

Smith

. Specific inhibition of DNMT1 by antisense oligonucleotides induces re-expression of estrogen receptor-alpha (ER) in ER-negative human breast cancer cell lines. Cancer Biol Ther 2003; 2(5): 552–556.

44.

Suzuki

Sunaga

Shames

. RNA interference-mediated knockdown of DNA methyltransferase 1 leads to promoter demethylation and gene re-expression in human lung and breast cancer cells. Cancer Res 2004; 64(9): 3137–3143.

45.

Fournel

Sapieha

Beaulieu

. Down-regulation of human DNA-(cytosine-5) methyltransferase induces cell cycle regulators p16(ink4A) and p21(WAF/Cip1) by distinct mechanisms. J Biol Chem 1999; 274(34): 24250–24256.

46.

Drobna

Xing

Thomas

. shRNA silencing of AS3MT expression minimizes arsenic methylation capacity of HepG2 cells. Chem Res Toxicol 2006; 19(7): 894–898.

47.

Drobna

Naranmandura

Kubachka

. Disruption of the arsenic (+3 oxidation state) methyltransferase gene in the mouse alters the phenotype for methylation of arsenic and affects distribution and retention of orally administered arsenate. Chem Res Toxicol 2009; 22(10): 1713–1720.

48.

Canet

Hardwick

Lake

. Altered arsenic disposition in experimental nonalcoholic fatty liver disease. Drug Metab Dispos 2012; 40(9): 1817–1824.

49.

Harari

Engstrom

Concha

. N-6-adenine-specific DNA methyltransferase 1 (N6AMT1) polymorphisms and arsenic methylation in Andean women. Environ Health Perspect 2013; 121(7): 797–803.

50.

Ren

Aleshin

. Involvement of N-6 adenine-specific DNA methyltransferase 1 (N6AMT1) in arsenic biomethylation and its role in arsenic-induced toxicity. Environ Health Perspect 2011; 119(6): 771–777.

51.

Genovese

Trani

Caputi

. Cell cycle control and beyond: emerging roles for the retinoblastoma gene family. Oncogene 2006; 25(38): 5201–5209.

52.

Wirt

Sage

. p107 in the public eye: an Rb understudy and more. Cell Div 2010; 5: 9.

53.

Grana

Garriga

Mayol

. Role of the retinoblastoma protein family, pRB, p107 and p130 in the negative control of cell growth. Oncogene 1998; 17(25): 3365–3383.

54.

Shivakumar

Minna

Sakamaki

. The RASSF1A tumor suppressor blocks cell cycle progression and inhibits cyclin D1 accumulation. Mol Cell Biol 2002; 22(12): 4309–4318.

55.

Agathanggelou

Cooper

Latif

. Role of the Ras-association domain family 1 tumor suppressor gene in human cancers. Cancer Res 2005; 65(9): 3497–3508.

56.

Donninger

Vos

Clark

. The RASSF1A tumor suppressor. J Cell Sci 2007; 120(Pt 18): 3163–3172.

57.

Jiang

Cui

Chen

. The prognostic role of RASSF1A promoter methylation in breast cancer: a meta-analysis of published data. PLoS ONE 2012; 7(5): e36780.

58.

Evron

Umbricht

Korz

. Loss of cyclin D2 expression in the majority of breast cancers is associated with promoter hypermethylation. Cancer Res 2001; 61(6): 2782–2787.

59.

Leung

Ebert

. Absence of cyclin D2 expression is associated with promoter hypermethylation in gastric cancer. Br J Cancer 2003; 88(10): 1560–1565.

60.

Hsu

Wong

. Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells. Clin Epigenetics 2011; 3: 3.

61.

Taylor

Stark

. Regulation of the G2/M transition by p53. Oncogene 2001; 20(15): 1803–1815.

62.

O’Connell

Walworth

Carr

. The G2-phase DNA-damage checkpoint. Trends Cell Biol 2000; 10(7): 296–303.

63.

Kearsey

Coates

Prescott

. Gadd45 is a nuclear cell cycle regulated protein which interacts with p21Cip1. Oncogene 1995; 11(9): 1675–1683.

64.

Wang

Zhan

Coursen

. GADD45 induction of a G2/M cell cycle checkpoint. Proc Natl Acad Sci U S A 1999; 96(7): 3706–3711.

65.

Wang

Huper

Guo

. Analysis of methylation-sensitive transcriptome identifies GADD45a as a frequently methylated gene in breast cancer. Oncogene 2005; 24(16): 2705–2714.

66.

Ding

Adrian

. Arsenic trioxide causes redistribution of cell cycle, caspase activation, and GADD expression in human colonic, breast, and pancreatic cancer cells. Cancer Invest 2004; 22(3): 389–400.

67.

Chow

Chan

Fung

. Inhibition of cell proliferation and the action mechanisms of arsenic trioxide (As₂O₃) on human breast cancer cells. J Cell Biochem 2004; 93(1): 173–187.

68.

Park

Seol

Kim

. Arsenic trioxide-mediated growth inhibition in MC/CAR myeloma cells via cell cycle arrest in association with induction of cyclin-dependent kinase inhibitor, p21, and apoptosis. Cancer Res 2000; 60(11): 3065–3071.

69.

Liu

Hilsenbeck

Gazitt

. Arsenic trioxide-induced apoptosis in myeloma cells: p53-dependent G1 or G2/M cell cycle arrest, activation of caspase-8 or caspase-9, and synergy with APO2/TRAIL. Blood 2003; 101(10):4078–4087.

70.

Han

Kim

. Arsenic trioxide inhibits growth of As4.1 juxtaglomerular cells via cell cycle arrest and caspase-independent apoptosis. Am J Physiol Renal Physiol 2007; 293(2): F511–F520.

71.

Waldman

Kinzler

Vogelstein

. p21 is necessary for the p53-mediated G1 arrest in human cancer cells. Cancer Res 1995; 55(22): 5187–5190.

Demethylation and alterations in the expression level of the cell cycle–related genes as possible mechanisms in arsenic trioxide–induced cell cycle arrest in human breast cancer cells

Abstract

Keywords

Introduction

Materials and methods

Cell lines

As2O3 treatment and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay

Flow cytometric analysis of cell cycle distribution

Genomic DNA isolation

Promoter methylation analysis (restriction enzyme–based method)

Sodium bisulfite modification of extracted DNA and methylation-specific PCR

Analysis of gene expression by quantitative real-time PCR

Statistical analysis

Results

DNA methylation pattern of cell cycle regulatory genes in breast cell lines

Inhibitory effect of As2O3 on survival of breast cancer cells

As2O3 causes redistribution of cell cycle in breast cancer cells

As2O3-induced demethylation of promoter-associated CpG islands of cell cycle–related genes in breast cancer cell lines

Alterations in mRNA expression levels of DNMTs and AS3MT in As2O3-treated breast cancer cells

Correlation between DNA methylation pattern and basal expression of RBL1, RASSF1A and cyclin D2 genes in breast cancer cell lines

As2O3-induced re-expression or upregulation of demethylated cell cycle genes mRNA in breast cancer cells

As2O3 changes transcriptional level of unmethylated cell cycle genes in breast cancer cells

Discussion

Footnotes

Declaration of conflicting interests

Funding

References

As₂O₃ treatment and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay

Inhibitory effect of As₂O₃ on survival of breast cancer cells

As₂O₃ causes redistribution of cell cycle in breast cancer cells

As₂O₃-induced demethylation of promoter-associated CpG islands of cell cycle–related genes in breast cancer cell lines

Alterations in mRNA expression levels of DNMTs and AS3MT in As₂O₃-treated breast cancer cells

As₂O₃-induced re-expression or upregulation of demethylated cell cycle genes mRNA in breast cancer cells

As₂O₃ changes transcriptional level of unmethylated cell cycle genes in breast cancer cells