Injectable Decorin/Gellan Gum Hydrogel Encapsulating Adipose-Derived Stem Cells Enhances Anti-Inflammatory Effect in Cartilage Injury via Autophagy Signaling

Abstract

Adipose-derived stem cells (ADSCs) are employed as a promising alternative in treating cartilage injury. Regulating the inflammatory “fingerprint” of ADSCs to improve their anti-inflammatory properties could enhance therapy efficiency. Herein, a novel injectable decorin/gellan gum hydrogel combined with ADSCs encapsulation for arthritis cartilage treatment is proposed. Decorin/gellan gum hydrogel was prepared according to the previous manufacturing protocol. The liquid–solid form transition of gellan gum hydrogel is perfectly suitable for intra-articular injection. Decorin-enriched matrix showing an immunomodulatory ability to enhance ADSCs anti-inflammatory phenotype under inflammation microenvironment by regulating autophagy signaling. This decorin/gellan gum/ADSCs hydrogel efficiently reverses interleukin-1β-induced cellular injury in chondrocytes. Through a mono-iodoacetate-induced arthritis mice model, the synergistic therapeutic effect of this ADSCs-loaded hydrogel, including inflammation attenuation and cartilage protection, is demonstrated. These results make the decorin/gellan gum hydrogel laden with ADSCs an ideal candidate for treating inflammatory joint disorders.

Introduction

Intra-articular injection of adipose-derived stem cells (ADSCs) has been developed as an important therapeutic approach to address arthritis symptoms distributed from animal models ¹ to clinical practice ² . ADSCs can be harvested easily and repeatedly with minimally invasive liposuctions in clinical practice. Clinical outcomes including functional improvement and pain relief have been revealed by therapeutic applications on osteoarthritis (OA)^{3 –5}, rheumatoid arthritis (RA), and cartilage defect disorder^6,7. The existing inflammatory microenvironment is the main cause of cartilage degradation and pain since the inflammatory cytokines induce an increase in metalloproteases expression enhancing cartilage degradation^8,9. ADSCs regulate inflammatory milieu in the chronic inflammatory joint disorder by modulating pro-inflammatory cytokines interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-alpha (TNF-α) and governing immunomodulated anti-inflammatory effects^{10 –12}. On the contrary, the articular inflammatory microenvironment also has a huge impact on the inflammatory phenotype of ADSC. A previous study suggested that inflammatory commitment of ADSC induced by IL-1β activates nuclear factor kappa-B signaling in chondrocytes and synoviocytes ¹³ . Furthermore, TNF-α exposure inhibited glycosaminoglycan (GAG) deposition and chondrogenic gene expression in ADSCs ¹⁴ , indicating that the pro-inflammatory microenvironment could hamper the therapeutic efficiency of ADSC by cytokines interaction. Therefore, regulating the inflammatory “fingerprint” of ADSC and maintaining its anti-inflammatory potential is crucial to the success of ADSC-injected therapy.

Mesenchymal stem cells (MSCs) chondrogenesis involved harmonious crosstalk between extracellular matrix (ECM) components and MSCs ¹⁵ . Decorin, a small leucine-rich proteoglycan within cartilage ECM ¹⁶ , enhanced chondrogenic differentiation of MSCs in gel matrix by inducing GAG and type II collagen deposition ¹⁷ . Interaction between sulfate chains on decorin and peripheral cells controlled the biomechanical environment and the biochemical transduction into cartilage cells^18,19. Indeed, loss of decorin resulted in greater GAG loss and formation of severer OA symptoms in the post-traumatic OA model ²⁰ , indicating a protective role of decorin in late-stage cartilage degeneration ²¹ . Interestingly, patients with spondyloarthropathies showed upregulated decorin antibody levels in synovial fluid compared with OA patients ²² , suggesting an involved role of decorin in regulating inflammatory rheumatic diseases. Of note, alleviation of antigen-induced arthritis by corticosteroid administration elevated decorin mRNA levels in connective tissues ²³ . Furthermore, co-culture MSCs could reduce the pro-inflammatory effect of TNFα and IL-1β on cartilage by increasing decorin secretion ²⁴ , in line with the fact that decorin may interact with extracellular tyrosine kinase receptors for immunol signaling transduction in inflammatory diseases ²⁵ . Given the fact that decorin-overexpressed MSCs significantly attenuate inflammation by regulating immune responses ²⁶ , we therefore wonder whether pericellular decorin would enhance the anti-inflammatory property of ADSCs that facilitate cartilage repair.

Recent studies from the L.M. Grover research group developed decorin-encapsulated gellan gum hydrogel for sustained release of decorin and delivering anti-inflammatory effect^27,28. The transition of solid to fluid-forming hydrogel under shear stress makes it as ideal for injection into the intra-articular space. Integrated MSCs with gellan gum hydrogel have been shown effective for osteochondral repair ²⁹ . In addition, decorin shows regulating immune cell dynamics ³⁰ via mediating outside-in innate autophagy signaling ³¹ . Inhibiting autophagy is associated with cartilage matrix degeneration ³² . In particular, autophagy is required to maintain the anti-inflammatory potential of ADSCs^33,34, whereas inhibition of autophagy mediated stress-induced apoptosis in ADSCs ³⁵ . Despite the previous study indicating that decorin induces autophagy signaling in different cell types^36,37, its precise role play in ADSC phenotype during inflammation is unclear.

In this study, we intend to evaluate the introduction of ADSCs within decorin-loaded gellan gum hydrogel on articular therapy in inflammatory joint disorder. This formulation not only aimed at improving the ADSCs regenerative function at the articular cartilage but also took advantage of the immunomodulatory properties of decorin. The immuno-modulation role of decorin functions not only at ADSCs in the inflammatory microenvironment but also in the chondrocytes via a sustained release. Our results here may represent an easy and effective route to improve the anti-inflammatory capacity of ADSCs for intra-articular injection therapy.

Materials and Methods

Isolation of Mouse ADSCs

Isolation of ADSCs was performed according to previous reports^38,39. Briefly, the inguinal subcutaneous fat was collected from C57BL/6 mice (male, 10 weeks old). The adipose was minced into pieces less than 1 mm in diameter. Digestion was performed with 0.1% type I collagenase (Gibco, United States) at 37°C for 45 min. After neutralization, the collected cells were seeded to a final concentration of 5 × 10⁶ cells/ml. The cells were cultured in a 37°C incubator supplied with 5% CO₂ and 95% humidity. The third- or fourth-passage cells were used for the following experiments. Characterization of the ADSCs through flow cytometry and differentiation assay has been performed according to our previous study ³⁹ .

Decorin/Gellan Gum Hydrogel Preparation and ADSCs Encapsulation

Decorin/gellan gum hydrogel was performed according to previous report ²⁷ with slight modification. Briefly, gellan powder was dissolved in deionized water for 1% (w/v) solution with heating to 70°C. After dissolving, gellan sol was added to the rotational rheometer (Fig. 1A, Brookfield, United States) and cooled to 50°C. Decorin from bovine articular cartilage (Sigma, Germany) and sodium chloride (0.2 M) were added to gellan sol for final concentrations of 0.9% (w/v) gellan, 0.24 mg/ml Decorin, and 10 mM sodium chloride (NaCl). Finally, the whole mixture was cooled at a rate of 1°C/min to a final temperature of 24°C under shear (450/s). In the case of a hydrogel loaded with ADSCs, suspension of ADSCs at a final density of 1 × 10⁶ cells/ml was mixed into the mixture under shear (100/s) in 1 min followed by further experiments.

Figure 1.

Decorin-laden gellan gum hydrogel production and physiochemical property analysis of the decorin/gellan gum/ADSCs hydrogel. (A) Representative figure of the rotational rheometer used in this study. Viscosity characterization of the decorin/gellan hydrogel by applying shear (n = 2). (B) Optical images of the post-shearing hydrogel with syringe injection. (C) Cumulative release curve of the decorin-enriched hydrogel over 180 min. (D) Scanning electron microscopy (SEM) characterization image of the decorin/gellan/ADSCs hydrogel illustrating the forming gel structure. Scare bars: 100 μm. (E) Representative image of 4′,6-diamidino-2-phenylindole (DAPI) staining identifies ADSCs encapsulation in hydrogel on day 1. (F) Swelling degree test of three groups of hydrogels (n = 3). ADSCs: adipose-derived stem cells.

Scanning Electron Microscopy Analysis

Solid form ADSCs/decorin/gellan gum hydrogel was immersed in 2.5% glutaraldehyde for fixation for about 1 h. Dehydration was performed with graded ethanol (50%, 70%, 80%, 90%, 95%, and 100%) and lyophilized for 12 h to eliminate residual water. All samples were sputter-coated with platinum and imaged with an ULTRA 55 scanning electron microscope (SEM; Carl ZEISS AG, Germany).

In Vitro Decorin Release

Cumulatively release levels of decorin from the hydrogel were determined according to a previous study ²⁷ . A total of 1 ml of the solid decorin/gellan gum hydrogel was soaked in 2 ml of Dulbecco’s Modified Eagle Medium (DMEM) and incubated at 37°C. At a certain time point, the medium was removed for measurement by enzyme-linked immunosorbent assay (ELISA). Decorin cumulatively released was quantified using Bovine Decorin ELISA (Sigma, RAB1185, Germany) following the manufacturer’s protocol.

Swelling Assay

The swelling behavior of hydrogels was performed as described before ⁴⁰ . Briefly, 200 mg (M0) of lyophilized hydrogel was soaked in 20 ml of normal saline solution. At every time point, the hydrogels were removed and immediately weighed (M1). The swelling behavior was calculated as Swelling (%) $=((M1-M0)/M0)\times 100$ .

Live/Dead Assay

A Live/Dead cell imaging kit (Invitrogen, R37601) was used to determine the effect of IL-β (20 ng/mL) with/without decorin on ADSC viability according to the manufacturer’s protocol. Images were taken with a fluorescence microscope (Leica, Germany) at ex 488 nm and ex 570 nm.

Cell Proliferation Assay Under Inflammation

The ADSCs were seeded onto the hydrogels at the density of 1 × 10⁶ cells/ml. Then IL-1β (20 ng/ml) was added to each well and incubated for 24 h. Cell proliferation assay was evaluated using Cell Counting Kit-8 (CCK-8, Sigma-Aldrich) according to the manufacturer’s instructions.

Co-culture System

The Transwell co-culture system was performed as described before ⁴¹ . A number of 5 × 10⁴ primary chondrocytes were seeded into a 24-well plate. Cells were incubated with/without 20 ng/ml IL-1β for 12 h. After induction of inflammation, ADSCs/decorin/gellan gum hydrogel was added into transwell inserts for co-culture with inflamed chondrocytes for another 12 h. ADSCs or chondrocytes were collected and used in the following Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) analysis.

Quantitative Real-time Polymerase Chain Reaction

Total RNA from ADSCs or chondrocytes was extracted using TRIzol (Invitrogen, Germany). The qRT-PCR assay was performed using the ABsolute Real Time PCR SYBR Master Mix (Invitrogen, AB1162B) on a 7000 PCR System according to the manufacturer’s instructions. The fold change in the expression of the sample was calculated using the ΔΔCt comparative method. Primers used in this study are listed in Table 1.

Table 1.

Mus Musculus Primers Used in This Study.

GENE	Forward	Reverse
SOX9	AGTACCCGCATCTGCACAAC	ACGAAGGGTCTCTTCTCGCT
Col2a1	GGGAATGTCCTCTGCGATGAC	GAAGGGGATCTCGGGGTTG
Aggrecan	CCTGCTACTTCATCGACCCC	AGATGCTGTTGACTCGAACCT
Runx2	GACTGTGGTTACCGTCATGGC	ACTTGGTTTTTCATAACAGCGGA
MMP-13	CTTCTTCTTGTTGAGCTGGACTC	CTGTGGAGGTCACTGTAGACT
ADAMTS5	GGAGCGAGGCCATTTACAAC	CGTAGACAAGGTAGCCCACTTT
TNF-α	GGTGCCTATGTCTCAGCCTCTT	GCCATAGAACTGATGAGAGGGAG
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
β-Actin	ACTCTTCCAGCCTTCCTTC	ATCTCCTTCTGCATCCTGTC

ADAMTS5: ADAM metallopeptidase with thrombospondin type I Motif 5; Col2a1: collagen type II alpha 1 chain; IL-6: interleukin-6; MMP-13: matrix metalloproteinase 13; Runx2: Runt-related transcription factor 2; SOX9: SRY-box transcription factor 9; TNF-α: tumor necrosis factor-alpha; GAPDH: Glycerinaldehyd-3-phosphat-Dehydrogenase.

Western Blotting

ADSCs were harvested and homogenized in Radioimmunoprecipitation assay (RIPA) lysis buffer. Protein concentration was determined using a bicinchoninic acid (BCA) assay (Invitrogen, Germany). After gel running, samples were blocked with 5% skim milk and incubated with primary antibodies at 4°C overnight: LC3A/B (CST, 1:1,000, 4108), p62 (CST, 1:1,000, 23214), and β-actin (CST, 1:1,000, 3700). Samples were rinsed three times with PBST and incubated with indicated secondary antibodies for 2 h at room temperature. Samples were developed with Immobilon Western Chemilum HRP Substrate (Millipore, WBKLS0500) for 1–2 min. The band density for each sample was determined relative to β-actin.

Animal Experiments

The mono-iodoacetate (MIA)-induced OA animal study was conducted under the guideline of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. A total of 38 adult male C57BL/6 mice (10 weeks old) were randomly divided into the following groups: (1) SHAM = 3; (2) SHAM + gellan/deocrin/ADSCs hydrogel = 3; (3) MIA = 6; (4) MIA + gellan gum hydrogel = 6; (5) MIA + gellan/decorin hydrogel = 6; (6) MIA + gellan/ADSCs hydrogel = 6; and (7) MIA + gellan/decorin/ADSCs hydrogel = 8. PBS intra-articular injection serves as the SHAM group. The MIA OA model was generated according to the previous report with slight modification ⁴² . Briefly, under anesthesia, an intra-articular injection of 0.25 mg of MIA was performed into the left knee. In the treatment groups, OA induction was followed by their respective treatments: Intra-articular injection of hydrogel for once on 7 days post-MIA injection. Tissue was collected at 14 days post-MIA injection.

Masson’s Trichrome Stain Assessment, Imaging, and OARSI Scoring

The collected specimens of the knee joint were fixed in 4% paraformaldehyde, decalcified in 10% EDTA decalcification solution for 2 weeks, and embedded in paraffin. The specimens were sectioned at 5 μm thickness in the sagittal plane and prepared for Masson’s trichrome stain analysis. Sections were hydrated to distilled water and mordant in Bouins’s solution for 5 min. After washing three times, they were kept in modified Weigert’s iron hematoxylin for 5 min. Then Biebrich Scarlet-Acid Fuchsin solution was used for 5 min, followed by 1% phosphomolybdic acid solution for 3 min and Aniline Blue solution for 10 min. Sections were imaged on a Zeiss Axioscanner fluorescent microscope. The Osteoarthritis Research Society International (OARSI) scoring was performed as a recommended scoring system for mice ⁴³ .

Cytokines Evaluations

The synovial membranes were collected and lysed. The ELISA kits (MTA00B, MLB00C, D6050, R&D, United States) were employed to test the cytokines (TNF-α, IL-1β, and IL-6) in synovium samples according to the manufacturer’s instructions.

Statistical Analysis

All statistical analysis was performed using GraphPad Prism version 7.0 (GraphPad Software, La Jolla, CA, United States). Statistical significance was determined at p < 0.05. Statistical differences between the two groups were using Student’s t-test. Statistical differences among groups were analyzed using one-way variance with Tukey’s post hoc tests. For the data that were not normally distributed, a non-parametric Mann–Whitney t-test was used.

Results

Decorin-Laden Gellan Gum Hydrogel Formulation and ADSCs Encapsulation Properties

First, we studied the viscosity–shear rate profiles of decorin-laden hydrogel. As shown in Fig. 1A, time-dependent viscosity profiles highlight the degree of thixotropy of decorin-laden hydrogel. The viscosities of hydrogel were around 10,000 mPa·s at a shear rate of 1/s. Increasing the shear force exerted on the hydrogel results in shear-thinning behavior, indicating that the post-sheared hydrogel exhibited typical liquid-like property which is suitable for applying syringe (27G) injection (Fig. 1B). After hydrogel formulation, we evaluated the rate of decorin release by determining the cumulative release curve (Fig. 1C). Release of decorin from the hydrogel was calculated approximately linear over time (y = 0.0752+0.103x−0.0001x², R² = 0.9851). After shearing and cooling, “rope-like” gelled entities were synthesized and were analyzed by SEM image (Fig. 1D). As shown in Fig. 1E, DAPI staining in hydrogel on day 1 could observe encapsulated ADSCs in decorin/gellan gum hydrogel. We further found that the swelling ratio of the hydrogel declined with the encapsulation of ADSCs (Fig. 1F). Proper hydrogel formulation could ameliorate the survival of ADSCs and preserve functional property. Taken together, these results indicated that ADSCs could be successfully and effectively encapsulated into decorin/gellan gum hydrogel.

Biocompatibility and Chondrogenesis Regulation of ADSCs by Decorin-Laden Hydrogel Under Inflammatory Stress

ADSCs encapsulated in different hydrogels can still proliferate and differentiate into cartilage cells. To evaluate the biocompatibility of ADSCs in the deocrin/gellan gum hydrogel under inflammatory stress, IL-1β (20 ng/mL) was treated with or without decorin loading. Live/dead cell staining analysis indicated ADSCs encapsulated in decorin-laden hydrogel after culture for 7 days displayed a high rate of cell viability under IL-1β stimulation when compared with ADSCs encapsulated in gellan hydrogel (Fig. 2A, B). Of note, the cell viabilities of ADSCs encapsulated in decorin/gellan gum hydrogel showed significant differences with increased IL-1β concentration (from 10 to 40 ng/ml) while compared with non-decorin loading (Fig. 2C), suggesting a protection role of decorin against inflammation-induced cell death on ADSCs.

Figure 2.

ADSCs in vitro biocompatibility evaluation in the decorin/gellan gum hydrogel with IL-1β. (A, B) Representative images of live/dead images of ADSCs cultured in the decorin/gellan gum hydrogel on days 1 and 7 with IL-1β (20 ng/mL) stimulation (n = 3). Scare bars: 200 μm. (C) CCK-8 assay identified ADSCs viabilities encapsulated in the decorin/gellan gum hydrogel with increased IL-1β concentration (from 10 to 40 ng/ml, n = 3). ADSCs = adipose-derived stem cells; CCK-8 = Cell Counting Kit-8; IL-1β = interleukin-1β.

We then compared the ability of decorin-laden hydrogels to regulate the chondrogenic differentiation of ADSCs under inflammatory stress by measuring the expression of chondrogenic-related genes, including SRY-box transcription factor 9 (SOX9), collagen type II alpha 1 chain (Col2a1), aggrecan (ACAN), and Runt-related transcription factor 2 (Runx2). After in vitro chondrogenic differentiation for 14 days, the mRNA expression levels of SOX9, Col2a1, and ACAN significantly increased in ADSCs encapsulated decorin hydrogel under IL-1β stimulation, while the expression of the OA-related gene Runx2 showed significant decreased (Fig. 3). These results suggested that the decorin/gellan gum hydrogel could protect the chondrogenic differentiation ability of ADSCs in the inflammation microenvironment.

Figure 3.

The chondrogenic differentiation analysis of ADSCs under inflammatory stress. Quantitative real-time PCR analysis of the expression of SOX9, Col2a1, ACAN, and Runx2 in ADSCs encapsulated in the decorin/gellan gum hydrogel with or without IL-1β stimulation (n = 4). ADSCs = adipose-derived stem cells; IL-1β = interleukin-1β.

Decorin/Gellan Hydrogel Modulate Autophagy Signaling in ADSCs Under Inflammatory Stress

Decorin was known to induce autophagy signaling in different cell types ⁴⁴ . During autophagy, cytoplasmic LC3 protein (LC3-I) is conjugated to phosphatidylethanolamine for lipidation to form LC3-phosphatidylethanolamine conjugate (LC3-II) and then recruited to the autophagosome membranes^45,46. The ubiquitin-associated protein p62 binds to LC3 and entraps in autophagosome; therefore, decreased expression of p62 is commonly considered upregulated autophagy signaling. IL-1β-induced inflammation interferes with autophagy signaling in ADSCs, as indicated by upregulated LC3-II and p62 protein expression (Fig. 4). Of note, enhanced p62 expression in acute inflammation via impaired proteasomal degradation is associated with IL-1β production ⁴⁷ . Importantly, decorin-loaded hydrogels restored the autophagy signaling in ADSCs, as suggested by upregulated p62 protein expression (Fig. 4) when compared with IL-1β treatment. A previous study has shown that 200 nM decorin stimulation on endothelial cells for 12 h effectively activates the LC3-I/LC3-II conversion ⁴⁸ and increases p62 degradation ⁴⁹ . However, loading with gellan gum hydrogel only did not show a significant change in p62 protein expression. These above results proved that the decorin/gellan gum hydrogel could attenuate the autophagy destruction in ADSCs with IL-1β-induced inflammation challenges.

Figure 4.

Decorin/gellan gum hydrogel regulates autophagy signaling in ADSCs under IL-1β stress. WB analysis of the expression of autophagy-related genes LC3-I, LC3-II, and p62 in ADSCs encapsulated in the decorin/gellan gum hydrogel with or without IL-1β stimulation (n = 3). ADSCs = adipose-derived stem cells; IL-1β = interleukin-1β.

In Vitro Chondrocytes Protection and In Vivo Cartilage Repair Assays of Decorin/Gellan/ADSCs Hydrogel

To determine the protected effect of decorin/gellan/ADSCs hydrogel on chondrocytes, a co-culture transwell system was used. IL-1β stimulation significantly induced mRNA expression levels of inflammatory genes in chondrocytes, including matrix metalloproteinase 13 (MMP-13), ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS5), TNF-α, and IL-6 (Fig. 5). However, placement of decorin/gellan/ADSCs hydrogel in upper transwell chamber decreased the mRNA expression levels of OA-related genes, indicating that decorin/gellan/ADSCs hydrogel may provide protection on chondrocytes through cytokines paracrine signaling or decorin released.

Figure 5.

In vitro evaluation of chondrocytes protection in a co-culture system. The qRT-PCR of the expression of OA-related genes MMP-13, ADAMTS5, TNF-α, and IL-6 in chondrocytes with or without the decorin/gellan/ADSCs hydrogel treatment under IL-1β stimulation (n = 4). ADSCs = adipose-derived stem cells; IL-1β = interleukin-1β; OA = osteoarthritis; TNF-α = tumor necrosis factor-alpha.

After comparatively analyzing the ability to provide chondrocyte protection in vitro, we tested the ability of the hydrogel to attenuate cartilage injury in vivo. Hydrogels loaded with different components were injected into mice knee joint with MIA-induced cartilage damage (Fig. 6A). Masson’s trichrome staining showed that apparent cartilage damage in the MIA group and MIA + gellan gum group (MIA + G), as reflected by GAG denaturation on the cartilage surface and collagen matrix disorganization (red staining). As expected, injection of gellan/decorin hydrogel (MIA + G/D) slightly suppressed cartilage degeneration in the MIA model, while injection of gellan/ADSCs hydrogel (MIA + G/A) significantly decreased cartilage injury, as shown by improvement of the structural integrity in cartilage. Interestingly, a synergistic therapeutic effect of decorin and ADSCs was displayed by better protection on tibial cartilages injury (Fig. 6A). In line with this result, analysis of the OARSI score showed that the decorin/gellan gum/ADSCs hydrogel injection group displayed significantly lower scores than gellan gum/ADSCs hydrogel injection group (Fig. 6B). Furthermore, MIA-induced inflammatory factor (TNF-α, IL-1β, and IL-6) upregulation in the synovial membrane was significantly attenuated by intra-articular application of decorin/gellan gum/ADSCs hydrogel (Fig. 6C). Taken together, the above results indicated that the decorin/gellan gum/ADSCs hydrogel presented better in vivo cartilage protection ability in inflammatory arthritis when compared with intra-articular injection of decorin/gellan gum/ hydrogel or ADSCs/gellan gum/ hydrogel.

Figure 6.

In vivo evaluation of cartilage protection by the decorin/gellan gum/ADSCs hydrogel in the MIA models. (A) Representative Masson’s trichrome staining images of mouse cartilage injuries in different hydrogel groups. (B) OARSI histological assessment score in different hydrogel groups. (C) The ELISA assay was employed to test the cytokines TNF-α, IL-1β, and IL-6 in synovium membranes from different hydrogel groups (G, gellan gum; D, decorin; A, ADSCs). ADSCs = adipose-derived stem cells; ELISA = enzyme-linked immunosorbent assay; IL-1β = interleukin-1β; MIA = mono-iodoacetate; TNF-α = tumor necrosis factor-alpha.

Discussion

This study aimed to determine the regulated effect of decorin-rich gellan gum hydrogel on ADSC regenerative phenotype under the inflammatory microenvironment. Our results demonstrate that encapsulation ADSCs within a decorin-enriched gellan gum not only regulated their proliferation activity under inflammation but also supported their chondrogenesis in favor of cartilage regeneration. The underlying mechanism may be related to the regulation of ADSCs autophagy signaling in the inflammatory microenvironment. Of note, a synergistic effect of ADSCs on articular therapy in inflammatory joint disorder was achieved by combining with decorin-loaded gellan hydrogel, suggesting the regenerative potential of ADSCs/decorin/gellan hydrogel for cartilage injury repair in preclinical medicine (Fig. 7).

Figure 7.

Schematic diagram of the injectable ADSCs-loaded decorin/gellan gum hydrogel for arthritis inflammatory microenvironment regulation. Integration of ADSCs and decorin in hydrogel results in cartilage ECM biomimetic and anti-inflammatory properties. ADSCs: adipose-derived stem cells; ECM: extracellular matrix.

ADSCs are multipotent and able to differentiate into chondrocytes. Arthroscopy injection of ADSCs improved cartilage regeneration and reduced pain in patients with OA. The efficacy of articular cartilage regeneration by MSCs-hydrogel composite was demonstrated by clinical trial ⁵⁰ . Ideal hydrogel matrix should be injectable for intra-articular implantation ⁵¹ , biomimetic for maintaining stem cell phenotype for chondrogenesis ⁵² , and particularly immunomodulated for inflammation attenuation ⁵³ . Naturally derived polymers, including gellan gum, can form hydrogels for MSCs encapsulation ⁵⁴ . Gellan gum hydrogel eye drop formulation was first developed by Hill et al ²⁷ . Our results confirmed the transition between solid and liquid states of gellan gum hydrogel, allowing loading of ADSCs followed by needle injection. We believe that the resting solid state of gellan gum hydrogel after intra-articular injection is beneficial not only for stem cell retention but also for application for three-dimensional tissue bioprinting manufacturing.

Three-dimensional culture of MSCs in the ECM motifs-modified gellan gum hydrogel presented higher proliferation and metabolic secrete factors when compared with commercially available hydrogel ⁵⁵ , indicating the importance of mimicking the ECM microenvironment for MSCs to maintain inflammation attenuation phenotype ⁵³ . Interestingly, trehalose-assisted gellan gum encapsulation of ADSC retained their differentiation phenotype under cryopreservation stress ⁵⁶ . The outcomes of our study confirmed that decorin supported the chondrogenesis of ADSCs in inflammatory circumstances. The decreased proliferation rate induced by IL-1β was also retained by decorin-assisted gellan gum hydrogel. A similar study on BMSCs pointed out that stiffness varying can form a suitable network for cartilage differentiation of BMSCs ⁵⁷ . There is evidence that ADSCs are more likely to differentiate into cartilage than BMSCs; therefore, optimization of hydrogel matrix stiffness favors for MSC chondrogenic differentiation was practicable ⁵⁸ . Considering decorin was necessary for maintaining fibril structure and mechanical stiffness of tendon and cartilage^59,60, we assumed that application of decorin in gellan gum could serve as viscous substrates to modulate stiffness in a microenvironment, which preserves ADSCs regenerative potential under inflammation.

On the other hand, decorin is known for its ability to adhere to the aggrecan network and mediate biomechanical transduction of cartilage ⁶¹ , which explains that decorin delays the loss of sulfated GAGs in chondrocyte induced by IL-1β stimulation ²⁰ . Here, we demonstrated that decorin-loaded gellan gum hydrogel increases the aggrecan expression in ADSCs with IL-1β activation, indicating that decorin regulates the integrity of the aggrecan network in the pericellular microenvironment ⁶² . Therefore, the chondromimetic matrix formulated by decorin gellan hydrogel may control the chondrogenic differentiation of ADSCs which is in line with other data ⁶³ . In addition, the decorin-based biomimetic scaffold has been shown suitable for promoting chondrogenic differentiation of ADSCs ⁶⁴ , suggesting the crucial role decorin plays in assembling chondromimetic hydrogel for cartilage regeneration. Taken together, combination of ADSCs and the extracellular decorin matrix may favor better participation in suppressing cartilage injury.

A previous study showed the possibility of the immuno-modulation capacity of decorin ⁶⁵ . Not surprisingly, IL-1β stimulation induces decorin production in human stromal cells ⁶⁶ , indicating that decorin acts as a feedback regulation under the inflammatory microenvironment. Interestingly, decorin boosts pro-inflammatory signaling via Toll-like receptors in macrophages ⁶⁷ . However, Toll-like receptors are not dominantly expressed in ADSCs, suggesting that a different immunomodulatory role may decorin play in the ADSCs. Topical decorin reduces the infiltration of inflammatory macrophages and neutrophils in corneal inflammation^68,69, indicating the inflammation attenuating aspect of decorin on other cell types. Moreover, decorin overexpressing MSCs regulate inflammation in injuries via increasing the expression of anti-inflammatory cytokines ²⁶ . Our results showed a synergistic effect of decorin and ADSCs in inflammatory joint disorder; therefore, we assumed that decorin in the matrix could modulate ADSCs immunol phenotype to enhance the anti-inflammatory effect via cytokines paracrine action on chondrocytes. In line with these data, a co-culture-secreted protein study of MSCs and cartilage explants showed a protective effect of MSCs on IL-1β induced cartilage catabolic injury by increasing the decorin secretion ²⁴ .

ADSCs increase the autophagy flux in response to stress stimulations ⁷⁰ , probably via the Sirtuin-1-related autophagy pathway to attenuate oxidative stress-induced cell death ⁷¹ . Enhancing autophagy signaling in stress-challenged ADSCs plays a protective role in cell survival ⁷² . In addition, enhanced autophagy of ADSCs improves its stemness ⁷³ and therefore promotes therapeutic effect under inflammation ⁷⁴ . Our results showed that decorin-laden hydrogel may increase autophagy signaling in ADSCs under IL-1β challenging. Previous studies revealed that proteoglycan could regulate the autophagy pathway in endothelial cells via outside-in signaling^31,75. Recent studies have shown that decorin can also induce autophagy and mitophagy. Decorin directly interacts with vascular endothelial growth factor receptor 2 to induce autophagy ⁷⁶ . We assumed that decorin-laden hydrogel may increase autophagy signaling in ADSCs via interacting with receptor tyrosine kinases under an inflammatory microenvironment. In fact, preconditioning induction of autophagy in ADSCs alters the immune phenotype and increases the expression of cytokines ⁷⁷ . Therefore, regulating the inflammatory “fingerprint” of ADSC by decorin may upregulate its anti-inflammatory potential. Interestingly, ADSCs itself could activate autophagy in chondrocytes for attenuating catabolism in an inflammation microenvironment ⁷⁸ , suggesting that released decorin may have a direct therapeutic effect via contacting chondrocytes.

There are some limitations in this study: (i) Comparison of the immune phenotype of the different magnitude of cell numbers in hydrogels could enhance the novelty of this study; (ii) using human-driven cells or decorin would complement the translational potential of this study; (iii) the underlying mechanism of decorin regulate autophagy in ADSCs is unknown; and (iv) tracking the distribution of ADSCs after intra-articular injection of the hydrogel would strengthen the research depth of this study. However, we could not underestimate the scientific novelty of this study which is the synergistic therapeutic effect of decorin/gellan gum/ADSCs hydrogel in favor of cartilage protection in inflammatory arthritis.

In summary, decorin/gellan gum hydrogel enhances the anti-inflammatory properties of encapsulating ADSCs. The regulating mechanism may be complemented by the ability of decorin to induce autophagy signaling and therefore modulates the immune response of ADSC in the inflammation microenvironment. Further research aimed at exploring a promising intra-articular injection candidate for the anti-inflammatory drug of decorin/gellan gum/ADSCs hydrogel in inflammatory joint disorder is warranted.