lncRNA FGD5-AS1 acts as a ceRNA to regulate lipopolysaccharide-induced injury via the miR-223-3p-3p/GAS5 axis in cardiomyocytes

Abstract

Long noncoding RNAs (lncRNAs) are abnormally expressed in numerous diseases, and they are closely associated with cardiac diseases. However, the role of lncRNAs in lipopolysaccharide (LPS)-induced cardiotoxicity as well as the potential mechanism remain largely unclear. In the present study, IncRNA microarray assays were performed to analyze differential lncRNA expression in LPS-treated cardiomyocytes, and lncRNA FGD5-AS1 was one of the downregulated lncRNAs. H9C2 cells were treated with LPS, and the expression of lncRNA FGD5-AS1 was markedly downregulated. LncRNA FGD5 overexpression decreased the LPS-induced cardiomyocyte apoptosis and inflammation. Bioinformatics analysis and a luciferase reporter assay indicated that lncRNA FGD5-AS1 directly binds to miR-223-3p. A miR-222-3p mimic partially reversed the inhibitory effect of lncRNA FGD5-AS1 on the LPS-induced H9C2 cell apoptosis and inflammatory response. Moreover, miR-223-3p directly targeted growth arrest-specific transcript 5 (GAS5). LncRNA FGD5-AS1 regulated LPS-induced H9C2 cell inflammation and apoptosis via the miR-223-3p/GAS5 axis.

Keywords

FGD5-antisense 1 miR-223-3p cardiomyocytes inflammatory response

Introduction

Myocarditis is an inflammatory disease of the heart with viral infections being the most common etiology.¹ However, the mechanism of the pathogenesis of myocarditis is not currently clear.² Thus, understanding the pathogenesis of myocarditis may be helpful for the treatment of this disease.

Long noncoding RNA (lncRNA) is a distinct type of nonprotein coding transcript that plays an important role in various biological processes.^3,4 The biological processes that are regulated by lncRNAs include invasion, migration, apoptosis, angiogenesis, microRNA silencing, embryonic development, cardiac aging and tumor development.^5–7 It has been reported that lncRNA HOTAIR inhibits oxidative stress and cardiomyocyte apoptosis during ischemia-reperfusion injury .⁸ lncRNA FGD5-AS1 is the antisense RNA of the FGD5 gene, which is located on chromosome 3p25.1. Studies have discovered the function of FGD5-AS1, especially in tumors.^9,10 Little is known about the role of FGD5-AS1 in cell damage, but its abnormal expression inhibits the occurrence and development of periodontitis.¹¹ However, the role of FGD5-AS1 in cardiomyocyte injury and the underlying mechanism are not yet clear.

microRNAs (miRNAs) consist of 21–25 nucleotides and are highly evolutionarily conserved. miRNAs bind to the 3′ untranslated region (3′ UTR) of the target mRNA and thus regulate the expression of the target gene at the posttranscriptional level.¹² Previous studies have shown that miR-223-3p participates in a variety of pathological processes, such as the in vivo inflammatory response, cardiovascular and cerebrovascular diseases and infections. Studies have suggested that miR-223-3p promotes autophagy by inhibiting hypoxia inducible factor-2α (HIF2α), which in turn exacerbates lung ischemia-reperfusion injury.¹³ In children with allergic rhinitis, miR-223-3p and IL-35 have been reported to be positively correlated.¹⁴ These results prompted us to hypothesize that miR-223-3p may regulate inflammation-related responses. Lipopolysaccharide (LPS) is a crucial component in the cell wall of gram-negative bacteria, and LPS induces inflammatory responses in host cells and causes immune dysfunction. Studies have shown that LPS exacerbates the heart dysfunction caused by inflammation.¹⁵

Therefore, in this study, LPS was used to treat cardiomyocyte cells to create an in vitro model of myocardial injury, and a lncRNA high-throughput sequencing was performed to identify the differentially expressed lncRNAs. Furthermore, the effects of lncRNA FGD5-antisense 1 (FGD5-AS1) and miR-223-3p on the inflammatory response and apoptosis of cardiomyocytes were further explored by various loss- or gain-of-function analyses.

Materials and methods

Cell culture

The cardiomyocyte cell line H9C2 was purchased from the China Center for Type Culture Collection (CCTCC, Wuhan, China). The H9C2 cells were cultured in DMEM containing 10% fetal bovine serum (FBS) and incubated in an incubator at 37°C and 5% CO₂. To induce inflammation and apoptosis, the H9C2 cells were treated with 10 μg/mL LPS for 6 h as previously described.¹⁶ Soluble cluster of differentiation 14 (sCD14) and lipopolysaccharide-binding protein (LBP) levels of H9C2 after treated with LPS were measured by enzyme-linked immunosorbent assay (ELISA) methods.

Microarray analysis

RNA samples were isolated from triplicates of control and LPS treated H9c2 cells. The RNA concentrations and purity were assessed according to the OD260/280 using a Nanodrop 2000 (Thermo Fisher Scientific, ND-2000). The arrays were performed as follows. In brief, the total RNA was transcribed into double-stranded cDNA. Then, the samples were synthesized via second strand synthesis and in vitro transcription to produce cRNA labeled with Cyanine-3-CTP. The Cyanine-3-CTP-labeled cRNA samples were hybridized on an Agilent DNA Microarray Scanner. The microarray hybridization and expression data collection were performed by BioSune (Shanghai, China). The differentially expressed lncRNAs were identified using the Limma software package.¹⁷ The volcano plots and heatmaps were drawn by the ggplot2 package in the R platform.¹⁸ We predicted the target miRNAs of lncRNA FGD5-AS1 by the intersection three databases from an online tool (https://www.bioinformatics.com.cn/static/others/jvenn/example.html).¹⁹ Potential target genes of miR-222-3p were predicted by the intersection of three databases (TargetScan, miRcode and miRanda).

Fluorescence in situ hybridization (FISH)

The lncATLAS website (https://lncatlas.crg.eu/) was searched to determine the subcellular localization of lncRNA FGD5-AS1. The lncRNA FGD5-AS1 FISH Probe Mix was designed and purchased from GeneChem Co., Ltd (Shanghai, China). In brief, H9C2 cells were seeded into 35 mm confocal dishes. After fixation with 4% paraformaldehyde for 30 min, the H9C2 cells were then hybridized with 250 μL hybridization solution containing a lncRNA FGD5-AS1-specific probe at 42°C overnight. Then, the nuclear DNA was stained with DAPI for 5 min. Images were obtained with a confocal microscope (Leica TCS SP2 Confocal Microscope; Leica).

Nuclear and cytoplasmic cellular RNA isolation

Nuclear and cytoplasmic fractions were carried out by a protein and RNA isolation system kit (PARIS kit, Ambion), according to the manufacturer’s protocol. In brief, cells were washed three times in PBS for 5 min per wash, and then resuspended in precooled cell fractionation buffer (300 μl) for 10 min. Supernatant (cytoplasm) and pellet (nucleus) were harvested following centrifugation at 500 × g and 5 min at 4°C. Then, RNA was isolated from the cytosolic and nuclear fractions, and the level of FGD5-AS1 in cytoplasm and nucleus was determined by qRT-PCR. U6 RNA and GAPDH mRNA were selected as the nuclear and cytoplasmic control transcripts, respectively.

Cell transfection

H9C2 cells were incubated at 37°C in 5% CO₂ for 6 h and then subjected to cell transfection. The lncRNA FGD5-AS1 overexpression plasmid, miR-223-3p mimics and mimics-NC were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The H9C2 cells were transfected with the FGD5-AS1 overexpression plasmid, miR-223-3p mimics and mimics-NC using the Lipofectamine^® 2000 reagent (Invitrogen, California, USA) according to the manufacturer’s protocol. qRT-PCR was used to determine the transfection efficiency.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA was extracted from the H9C2 cells by using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. The total miRNAs were extracted by using the RNeasy Mini kit (Qiagen, Duesseldorf, Germany) to measure the miRNA expression. To determine and analyze miR-223-3p, the reverse transcription of RNA was performed using the TaqMan^® MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA).

To determine and analyze the expression of FGD5-AS1, the RNA samples were reverse transcribed using the Multiscribem reverse transcription kit (Applied Biosystems, CA, USA), and qRT-PCR was performed using the SYBR Green qRT-PCR master mix (Takara, Japan). The real-time PCR data were analyzed using the 2^−△△Ct method. The gene expression and miRNA expression were normalized to that of GAPDH and U6, respectively. The primer sequences are presented in Table 1.

Table 1.

Primers for quantitative real-time PCR.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
FGD5-AS1	CGTGGAGAAGAATTGGGC	CGTGGAGAAGAATTGGGC
miR-223-3p	CAGAAAGCCCAATTCCATCT	5GGGCAAATGGATACCATACC
miR-107	ATGATGAGCAGCATTGTACAGG	GCAGGGTCCGAGGTATTC
miR-103a-3p	TATCCAGTGCAGGGTCCGAGGTATT	GTGCAGGGTCCGAGGT
DYLIP	GACCACAGCCTGGCAATAGGT	TCAACCCAGATGACACAGAGATCT
DDIT4	AGGCCGCACCATTATTTTGTC	GGCAATTCTGTCCCCAAGGAT
KPAN2	AGCCAGAAAATGGGATGGTGG	ACTGCACTGT CCACTTGTCA
GAS5	TGTGCCCTTTATACCCACTTT	CTCGCTTCGGCAGCACA
GAPDH	ACCTGACCTGCCGTCTAGAA	GTCAAAGGTGGAGGAGTGGG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

Western blot analysis

Protein extracts were isolated from each group cells in using RIPA protein lysis buffer containing 1 mM PMSF. Afterwards, 50 μg of total protein was loaded on a 12% polyacrylamide gel and electrophoresed at 100 V for 2 h, then transferred to the polyvinylidene fluoride (PVDF) membranes. After being blocked with 5% skimmed milk for 1 h at room temperature, the membranes were rinsed with TBST 3 times for 10 min each time, and incubated with primary antibodies of anti-cleaved caspase-3 (#9661, CST, 1:1000), anti-cleaved caspase-9 (#20750, CST, 1:500), anti-Bax (ab53154, Abcam, 1:1000), anti-Bcl-2 (ab32124, Abcam, 1:1000) and anti-GAPDH (ab181602, Abcam, 1:3000) overnight at 4°C. After being washed with TBST, PVDF membranes were incubated with horseradish (HRP)-labeled anti-rabbit second antibody (ab9482, Abcam, 1:1000) for 1 h. A chemiluminescence detection kit with an ECL Plus chemiluminescence detection kit (Sangon Biotech) was used for visualizing protein bands and Image J (National Institutes of Health, Bethesda, MD, USA) was applied to analyze the gray value of each protein.

Luciferase reporter assay

According to the results from the target gene prediction database StarBase (https://starbase.sysu.edu.cn/), miR-223-3p was possibly the target miRNA of FGD5-AS1. The wild-type FGD5-AS1 3′ UTR fragment containing the miR-223-3p-binding site was inserted into a luciferase reporter gene vector to construct a wild-type FGD5-AS1-WT plasmid. Gene mutation technology was utilized to induce mutations into the miR-223-3p-binding site of the FGD5-AS1 3′ UTR to construct the mutant FGD5-AS1-MUT plasmid. Myocardial H9C2 cells in the logarithmic growth phase were selected and seeded into a 24-well plate at a density of 5 × 10⁴ cells per well. When the cell growth and confluence reached approximately 50%, the Lipofectamine^® 2000 transfection reagent was used to transfect the FGD5-AS1-WT and FGD5-AS1-MUT plasmids with the miR-223-3p mimics or mimics-NC. The relative luciferase activities of the cells were determined according to the instructions of the luciferase activity detection kit.

Flow cytometry

H9C2 cell apoptosis in the treated groups was determined by an Annexin V-FITC/PI apoptosis detection kit (Biotool, Houston, TX, USA). Briefly, the H9C2 cells were seeded into 6-well plates (3.0 × 10⁵ cells/well) and incubated for 24 h before transfection. The transfected cells were then washed with phosphate-buffered saline (PBS) and resuspended, and then, 5 μL Annexin V-FITC and 5 μL PI were mixed with the cell suspension and incubated in the dark for 15 min. Cell apoptosis was then analyzed by flow cytometry (BD Bioscience, San Jose, California), and quantitative analysis was performed using CellQuest software (Version 4.0; BD Biosciences, San Jose, California).

Enzyme-linked immunosorbent assay (ELISA)

The levels of TNF-α, IL-6 and IL-1β in the supernatants were measured using commercially available ELISA kits (R&D Systems, USCN Life Science, USA). In brief, the supernatants (50 μL) in the treated groups were obtained by centrifugation at 1500 r/min/min for 20 min and stored at −80°C until analysis. The optical density was measured by a microplate automatic reader (EL800; Biotek, Winooski, VT, USA) at a wavelength of 450 nm.

Statistical analysis

The data in this study are expressed as the mean ± standard deviation (SD), and SPSS 19.0 statistical software (IBM Analytics, Armonk, NY) was used for one-way analysis of variance (ANOVA). p < 0.05 was considered statistically significant. All the experiments were repeated at least 5 times.

Results

LncRNA FGD5-AS1 was downregulated in LPS-treated H9C2 cells

sCD14 (Supplemental S1A) and LBP (Supplemental S1B) levels of H9C2 after treated with LPS were significantly upregulated. We first identified the lncRNA transcripts from three normal H9C2 cell groups and three LPS-treated H9C2 cell groups using RNA-seq analysis. The expression analysis demonstrated that a large number of lncRNAs were differentially expressed. In total, 909 distinct lncRNA candidates were identified in the H9C2 cells, among which 514 lncRNAs were upregulated and 395 lncRNAs were downregulated in the LPS-treated H9C2 cells compared with the control H9C2 cells (Figure 1(a) and (b)). We conducted RT-PCR to validate the results generated by RNA-Seq in the normal H9C2 cells and LPS-treated H9C2 cells (Figure 1(c)) and found one lncRNA, namely, lncRNA FGD5-AS1.

Figure 1.

LncRNA FGD5-AS1 was downregulated in LPS-treated cardiomyocytes. (a) Clustering heatmap of differentially expressed lncRNAs between the LPS-treated cardiomyocytes and control cardiomyocytes, red indicates high expression and green low expression. (b) Volcano plot of differentially expressed lncRNAs between the LPS-treated cardiomyocytes and control cardiomyocytes, green dots represent up-regulated lncRNAs and red dots represent up-regulated lncRNAs in LPS-treated cardiomyocytes; black dots represent normally lncRNAs. (c) Relative expression of LncRNA FGD5-AS1 between the LPS-treated cardiomyocytes and control cardiomyocytes. (d) The relative expression of lncRNA FGD5-AS1 was upregulated in the H9C2 cells after transfection with the lncRNA-FGD5-AS1 overexpression plasmid. (e) Subcellular localization plots of lncRNA FGD5-AS1 displayed by lncATLAS (https://lncatlas.crg.eu/). (f) A fluorescence in situ hybridization (FISH) assay was performed to determine the cellular localization of lncRNA FGD5-AS1. (g) Nuclear and cytoplasmic RNA isolation showed that FGD5-AS1 was mainly localized in the cytoplasm of H9C2 cells. The U6 and 18S mRNAs were selected as the nuclear and cytoplasmic control transcripts, respectively.

To detect the potential role of lncRNA FGD5-AS1 in LPS-treated H9C2 cells, we first constructed a lncRNA FGD5-AS1 overexpression plasmid, which confirmed the RT-PCR results (Figure 1(d)).

LncRNA FGD5-AS1 is localized throughout the cytoplasm, according to the lncATLAS website (https://lncatlas.crg.eu/, Figure 1(e)), and this finding was further confirmed by FISH (Figure 1(f)) and nuclear and cytoplasmic RNA isolation experiment (Figure 1(g)). Because lncRNA FGD5-AS1 is localized to the cytoplasm, we speculated that lncRNA FGD5-AS1 might function by competitively binding to downstream miRNAs to regulate their biological functions.

The effect of lncRNA FGD5-AS1 on LPS-induced H9C2 cell apoptosis was determined by using Annexin V-FITC and PI double staining. We observed significantly increased cell apoptosis in the H9C2 cells treated with LPS (Figure 2(a)). However, overexpression of lncRNA FGD5-AS1 partially reversed the LPS-induced H9C2 cell apoptosis (Figure 2(a)). This result was confirmed by western blot (Figure 2(b)).

Figure 2.

LncRNA FGD5-AS1 downregulated the LPS-induced apoptosis of cardiomyocytes. (a) Flow cytometric apoptosis analysis showed that lncRNA FGD5-AS1 overexpression significantly decreased the apoptosis rate in LPS-treated H9C2 cells. The apoptosis rate was calculated as apoptotic cells (Q2 + Q3)/total cells × 100%. (b) Determination of the expression of apoptosis-related proteins (Bcl-2, Bax, Cleaved cas-3 and Cleaved cas-9) by western blot analysis. (c) Effects of lncRNA FGD5-AS1 overexpression on the levels of IL-6, TNF-α and IL-1β in LPS-treated cardiomyocytes. Data were presented as mean ± SD, n = 5, *p < 0.05.

The effect of lncRNA FGD5-AS1 on the LPS-induced H9C2 cell inflammatory response was determined using ELISA. LncRNA FGD5-AS1 downregulated the LPS-induced expression of IL-6, TNF-α and IL-1β in the H9C2 cells (Figure 2(c)).

Our data suggested that lncRNA FGD5-AS1 protects H9C2 cells against LPS-induced apoptosis and the inflammatory response by decreasing pro-apoptotic signals and increasing anti-apoptotic signals.

miR-223-3p was upregulated in LPS-treatedH9C2 cells

To identify the target miRNAs that lncRNA FGD5-AS1 might regulate, the overlapping target miRNAs in three databases (StarBase, TargetScan and miRcode databases) were identified as lncRNA FGD5-AS1-targeted miRNAs. The overlapping section of the three databases contained target genes encoding three miRNAs (Figure 3(a)). The expression of these three miRNAs in the control and lncRNA FGD5-AS1-overexpressing cells was determined by RT-PCR. The results showed that only the expression of miR-223-3p was considered to be significantly different (Figure 3(b)). Therefore, we selected miR-223-3p as the candidate target miRNA of lncRNA FGD5-AS1 for further analysis. Compared to the control cells, the LPS-treated cells exhibited significantly increased miR-223-3p expression (Figure 3(c)). H9C2 cells were transfected with the mimic-NC or miR-222-3p mimic, and the transfection efficiency was validated by RT-PCR (Figure 3(d)).

Figure 3.

miR-223-3p promotes LPS-induced H9C2 cell apoptosis. (a) Venn diagrams showing the intersection of candidate target miRNAs identified in three databases (StarBase, TargetScan and miRcode). (b) Relative luciferase activity was analyzed in the cells cotransfected with the WT or Mut 3′-UTR reporter plasmids and the miR-222-3p mimic or miR-NC. (c) Relative expression of miR-222-3p in the LPS-treated cardiomyocytes and control cardiomyocytes. (d) The relative expression of miR-222-3p was upregulated in the H9C2 cells after transfection with the miR-222-3p mimic. (e) The relative expression of miR-222-3p was downregulated in the H9C2 cells after transfection with the lncRNA-FGD5-AS1 overexpression plasmid.

The TargetScan database suggested that the 3′ UTR of lncRNA FGD5-AS1 contains a putative binding site for miR-223-3p (Figure 3(e)). The results of double luciferase activity tests showed that the luciferase activity of the FGD5-AS1-WT cells in the miR-223-3p group was significantly reduced compared with that of the FGD5-AS1-WT cells in the mimic-NC group, and the luciferase activity of the FGD5-AS1-Mut cells was not remarkably changed (Figure 3(e)).

Compared with the mimic-NC group, the miR-223-3p mimic group exhibited a significantly increased apoptosis rate (p < 0.05, Figure 4(a)). This observation was corroborated by Western blot analysis, which showed that the miR-223-3p mimic resulted in increased levels of pro-apoptotic proteins and decreased levels of apoptotic suppressor proteins (Figure 4(b)).

Figure 4.

miR-222-3p promoted LPS-induced apoptosis of cardiomyocytes. (a) Flow cytometric apoptosis analysis using an Annexin V-FITC/PI kit showed that the miR-222-3p mimic significantly increased the apoptosis rate in the LPS-treated H9C2 cells. The apoptosis rate was calculated as apoptotic cells (Q2 + Q3)/total cells × 100%. (b) Determination of apoptosis-related protein expression in the H9C2 cells treated with the miR-222-3p mimic by western blot analysis. (c) Effects of the miR-222-3p mimic on the levels of IL-6, TNF-α and IL-1β in the LPS-treated cardiomyocytes. Data were presented as mean ± SD, n = 5, *p < 0.05.

The effect of miR-223-3p on the LPS-induced H9C2 cell inflammatory response was determined using ELISA. miR-223-3p upregulated the LPS-induced IL-6, TNF-α and IL-1β expression in the H9C2 cells (Figure 4(c)).

The above results suggested that lncRNA FGD5-AS1 targeted and regulated miR-223-3p to regulate LPS-induced H9C2 cell apoptosis.

miR-223-3p directly targets GAS5

The overlapping genes among the miR-223-3p putative targets from three databases (TargetScan, miRcode and miRanda) were identified by Venn diagram analysis. The Venn diagram showed four overlapping genes that were significantly targeted (MYLIP, DDIT4, KPNA2 and GAS5, Figure 5(a)). The expression of GAS5 was significantly lower for miR-223-3p, but there were no significant differences in expression between miR-223-3p and the control for the other three genes (Figure 5(b)).

Figure 5.

miR-223-5p directly targets GAS5. (a) Venn diagram represent the overlapping target genes among the TargetScan, miRanda and miRcode databases. (b) Relative expression of MYLIP, DDIT4, KPNA2 and GAS5 in the cells transfected with the NC-mimic or miR-222-3p mimic. (c) The putative binding sites between miR-223-3p and GAS5. (d) Relative luciferase activity was analyzed in the cells cotransfected with the GAS5 WT or Mut 3′-UTR reporter plasmids and the miR-222-3p mimic or miR-NC. (e) Relative expression of GAS5 in the LPS-treated cardiomyocytes and control cardiomyocytes. (f) The relative expression of GAS5 was upregulated in the H9C2 cells after transfection with the lncRNA-FGD5-AS1 overexpression plasmid. (g) Correlation analysis between miR-222-3p and GAS5 in the H9C2 cells. Data were presented as mean ± SD, n = 5, *p < 0.05.

The miR-222-3p sequence has 12 binding sites for the 3′ UTR of GAS5, suggesting that GAS5 may be a potential target gene of miR-222-3p (Figure 5(c)). Further results suggested that the miR-223-3p mimic significantly inhibited the relative luciferase activity of GAS5-3′UTR-WT (Figure 5(d)).

The relative expression of GAS5 was significantly downregulated in the LPS-treated H9C2 cells compared with the control H9C2 cells (Figure 5(e)).

The GAS5 expression was increased in the FGD5-AS1-overexpressing H9C2 cells but decreased in the miR-222-3p mimic-treated H9C2 cells (Figure 5(f)).

The correlation was further analyzed and confirmed that miR-222-3p was negatively correlated with GAS5 expression in the LPS-treated H9C2 cells (Figure 5(g)). These results indicated that miR-222-3p directly targets GAS5.

miR-223-3p mimic could partially reverse the inhibitory effect of lncRNA FGD5-AS1 on LPS-induced H9C2 cell apoptosis and inflammation response

To further validate that lncRNA FGD5-AS1 directly targets miR-222-3p, H9C2 cells were transfected with the FGD5-AS1 overexpression plasmid alone or cotransfected with the FGD5-AS1 overexpression plasmid and miR-222-3p mimic. Compared with transfection with the FGD5-AS1 overexpression plasmid alone or with the FGD5-AS1 overexpression plasmid and NC-mimic, cotransfection with the FGD5-AS1 overexpression plasmid and miR-222-3p mimic could partially reverse the decreased apoptosis rate in the lncRNA FGD5-AS1-overexpressing cells (Figure 6(a)). Compared with the empty vector, the FGD5-AS1 overexpression plasmid significantly increased GAS5 expression, while cotransfection with the FGD5-AS1 overexpression plasmid and miR-222-3p mimic partially downregulated GAS5 expression (Figure 6(b)).

Figure 6.

The inhibitory effect of lncRNA FGD5-AS1 on LPS-induced apoptosis and inflammatory reactions in the H9C2 cells was partially blocked by the miR-222-3p mimic. (a) miR-222-3p partially reversed the anti-apoptotic effect of lncRNA FGD5-AS1 in the H9C2 cells. (b) miR-222-3p partially reversed the LncRNA FGD5-AS1 overexpression-induced increase in GAS5 expression in the H9C2 cells. (c) Determination of the apoptosis-related protein expression in the H9C2 cells treated with the FGD5-AS1 overexpression plasmid alone or with the miR-222-3p mimic by western blot analysis. (d) miR-222-3p partially reversed the effect of lncRNA FGD5-AS1 on the inflammatory response in the H9C2 cells. Data were presented as mean ± SD, n = 5, *p < 0.05. Supplement S1: A sCD14 expression level in control and LPS treated H9C2 cells; B LBP expression level in control and LPS treated H9C2 cells.

To further determine that the miR-222-3p mimic could partially block the inhibitory effect of lncRNA FGD5-AS1 on LPS-induced H9C2 cell apoptosis, the expression of the apoptosis-related proteins Bcl-2, Bax, cleaved caspase-3 and cleaved caspase-9 was further confirmed by western blot analysis (Figure 6(c)).

Compared with the empty vector, the FGD5-AS1 overexpression plasmid significantly increased proinflammatory cytokine (IL-6, TNF-α and IL-1β) expression, while cotransfection with the FGD5-AS1 overexpression plasmid and miR-222-3p mimic partially downregulated the expression of these proinflammatory cytokines (Figure 6(d)). Collectively, these data demonstrate that the miR-223-3p mimic could partially reverse the inhibitory effect of lncRNA FGD5-AS1 on LPS-induced H9C2 cell apoptosis and inflammatory response.

Discussion

In this study, we identified a large number of lncRNAs that were differentially expressed in LPS-treated H9C2 cells, which indicated that these lncRNAs may exert a potential function in cardiomyocyte injury. After RT-PCR validation, we selected one of the most under expressed lncRNAs, namely, lncRNA FGD5-AS1, for further experiments. Overexpression of FGD5-AS1 suppressed the LPS-induced apoptosis and inflammatory response. We also found that lncRNA FGD5-AS1 was localized in the cytoplasm and may act as a miRNA sponge. According to lncRNA target prediction databases and luciferase reporter assays, lncRNA FGD5-AS1 directly targets miR-222-3p. Moreover, miR-223-3p directly targets GAS5 and partially reverses the inhibitory effect of lncRNA FGD5-AS1 on LPS-induced H9C2 cell apoptosis.

A major strength of this study was that this study investigated the role of lncRNA FGD5-AS1/miR-222-3p/GAS5 axis in the progression of cardiomyocyte injury through bioinformatic analysis and experiments validation. In this study, H9C2 cells are selected as a model for heart disease pathology remains a reasonable model for the purpose of this study. H9C2 cell line was originally derived from embryonic rat ventricular tissue. Although H9c2 cells are no longer able to beat, they share several characteristics with primary cardiomyocytes.²⁰

Studies have shown that lncRNAs can be used as competitive endogenous RNAs to interact with noncoding miRNAs and jointly participate in the regulation of target genes, thereby exerting an important effect on tumorigenesis and development.²¹ Both miRNAs and lncRNAs play essential roles in the modulation of cellular processes.²² Increasing evidence has shown that lncRNAs and miRNAs play vital roles in the pathogenesis of myocardial ischemia and reperfusion injury. For example, lncRNA FTX regulates the PTEN/PI3K/AKT signaling pathway by sponging miR-22, thereby inhibiting mouse cardiomyocyte hypertrophy.²³ LncRNA MALAT1 regulates TSC2-mTOR signaling and thus suppresses autophagy and promotes cardiomyocyte apoptosis.²⁴ In addition, the lncRNA ROR/miR-124-3p/TNF receptor associated factor 6 (TRAF6) axis modulates the inflammatory response of cardiomyocytes induced by ischemia-reperfusion injury.²⁵ The current study discovered that lncRNA FGD5-AS1 was under expressed in injured H9C2 cells, and overexpression of FGD5-AS1 inhibited the secretion of inflammatory factors, including TNF-α, IL-6 and IL-1β, by H9C2 cells. Through further research, it was suggested that lncRNA FGD5-AS1 targeted and negatively regulated miR-223-3p expression. miR-223-3p has been reported to regulate inflammation,²⁶ breast cancer cell apoptosis²⁷ and hypoxia-induced injury.²⁷ In the current study, we showed that miR-223-3p reduced LPS-induced H9C2 cell apoptosis by targeting GAS5.

Through bioinformatics analysis, we found that miR-222-3p directly targeted GAS5. Cumulative studies have shown that GAS5 is abnormally expressed in tumors²⁸ and cerebral ischemia/reperfusion injury.²⁹ When GAS5 is silenced, apoptosis and the inflammatory response are significantly reduced in cerebral ischemia/reperfusion injury.²⁹ Based on these results, we think that GAS5 could be used as a potential therapeutic target in myocarditis patients.

Conclusion

In conclusion, our in vitro data first discovered that lncRNA FGD5-AS1 acts as a miR-222-3p sponge and modulates GAS5 expression to protect H9C2 cells from LPS-induced injury. These findings showed, for the first time, that lncRNA FGD5-AS1 may be a potential prognostic factor and therapeutic target in patients with myocarditis.

Supplemental Material

Supplemental Material - lncRNA FGD5-AS1 acts as a ceRNA to regulate lipopolysaccharide-induced injury via the miR-223-3p-3p/GAS5 axis in cardiomyocytes

Supplemental Material for lncRNA FGD5-AS1 acts as a ceRNA to regulate lipopolysaccharide-induced injury via the miR-223-3p-3p/GAS5 axis in cardiomyocytes by Xiao-ling Fang and Shu-guang Shi Engeln in Human & Experimental Toxicology.

Footnotes

Author contributions

Xiao-ling Fang and Shu-guang Shi performed the majority of experiments and analyzed the data; Xiao-ling Fang and Shu-guang Shi performed the molecular investigations; Xiao-ling Fang and Shu-guang Shi designed and coordinated the research; Xiao-ling Fang and Shu-guang Shi wrote the full texts. All author approved the final manuscript.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Shu-guang Shi

Supplemental Material

Supplemental material for this article is available online.

References

Wang

Ouyang

, et al. Leonurine alleviates LPS-induced myocarditis through suppressing the NF-small ka, CyrillicB signaling pathway. Toxicology 2019; 422: 1–13.

, et al. MiR-16, as a potential NF-kappaB-related miRNA, exerts anti-inflammatory effects on LPS-induced myocarditis via mediating CD40 expression: A preliminary study. J Biochem Mol Toxicol 2020; 34: e22426.

Zheng

, et al. Circulating LncRNAs as novel, non-invasive biomarkers for prenatal detection of fetal congenital heart defects. Cell Physiol Biochem 2016; 38: 1459–1471.

Zhu

Qiu

, et al. Involvement of long non-coding RNA in colorectal cancer: From benchtop to bedside (review). Oncol Lett 2015; 9: 1039–1045.

Bouckenheimer

Assou

Riquier

, et al. Long non-coding RNAs in human early embryonic development and their potential in ART. Hum Reprod Update 2016; 23: 19–40.

Zhao

. Non-coding RNAs and cardiac aging. Adv Exp Med Biol 2020; 1229: 247–258.

Yang

, et al. Long noncoding RNAs in the progression, metastasis, and prognosis of osteosarcoma. Cell Death Dis 2016; 7: e2389.

Meng

Jiao

Zhu

. The long noncoding RNA hotair regulates oxidative stress and cardiac myocyte apoptosis during ischemia-reperfusion injury. Oxid Med Cel Longev 2020; 2020: 1645249.DOI: 10.1155/2020/1645249

Liu

Zhan

Huang

, et al. LncRNA FGD5-AS1 can be predicted as therapeutic target in oral cancer. J Oral Pathol Med 2020; 49: 243–252.

10.

Gao

Zhang

, et al. Long noncoding RNA FGD5-AS1 acts as a competing endogenous RNA on microRNA-383 to enhance the malignant characteristics of esophageal squamous cell carcinoma by increasing SP1 expression. Cancer Manag Res 2020; 12: 2265–2278.

11.

Chen

Lan

, et al. Abnormal expression of long noncoding RNA FGD5-AS1 affects the development of periodontitis through regulating miR-142-3p/SOCS6/NF-κB pathway. Artif Cell Nanomed Biotechnol 2019; 47: 2098–2106.

12.

Rivera-Barahona

Pérez

Richard

, et al. Role of miRNAs in human disease and inborn errors of metabolism. J Inherit Metab Dis 2017; 40: 471–480.

13.

Dai

, et al. microRNA-223 promotes autophagy to aggravate lung ischemia-reperfusion injury by inhibiting the expression of transcription factor HIF2α. Am J Physiol Lung Cel Mol Physiol 2020. Epub ahead of print. DOI: 10.1152/ajplung.00009.2020.

14.

Ruan

Wen

Yuan

. Correlation between miR-223 and IL-35 and their regulatory effect in children with allergic rhinitis. Clin Immunol 2020; 214: 108383.

15.

Deng

Wang

, et al. Sectm1a deficiency aggravates inflammation-triggered cardiac dysfunction through disruption of LXRα signaling in macrophages. Cardiovasc Res 2021; 117: 890–902.

16.

Hwang

Kim

Chung

, et al. Knockdown of Sestrin2 increases lipopolysaccharide-induced oxidative stress, apoptosis, and fibrotic reactions in H9c2 cells and heart tissues of mice via an AMPK-dependent mechanism. Mediators Inflamm 2018; 2018: 6209140.

17.

Smyth

. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 2004; 3: 3. DOI: 10.2202/1544-6115.1027.

18.

Liao

Wang

Huang

, et al. Integrated analysis of competing endogenous RNA network revealing potential prognostic biomarkers of hepatocellular carcinoma. J Cancer 2019; 10: 3267–3283.

19.

Bardou

Mariette

Escudié

, et al. jvenn: an interactive venn diagram viewer. BMC Bioinformatics 2014; 15: 293.

20.

Kimes

Brandt

. Properties of a clonal muscle cell line from rat heart. Exp Cel Res 1976; 98: 367–381.

21.

Pang

Xing

Adams

, et al. Comparative expression of miRNA genes and miRNA-based AFLP marker analysis in cultivated tetraploid cottons. J Plant Physiol 2011; 168: 824–830.

22.

Liang

, et al. A new strategy for construction of artificial miRNA vectors in arabidopsis. Planta 2012; 235: 1421–1429.

23.

Yang

Tao

Zhu

, et al. Long noncoding RNA FTX reduces hypertrophy of neonatal mouse cardiac myocytes and regulates the PTEN/PI3K/Akt signaling pathway by sponging microRNA-22. Med Sci Monit 2019; 25: 9609–9617.

24.

, et al. Long non-coding RNA MALAT1 enhances the apoptosis of cardiomyocytes through autophagy inhibition by regulating TSC2-mTOR signaling. Biol Res 2019; 52: 58.

25.

Liang

Liu

, et al. The lncRNA ROR/miR-124-3p/TRAF6 axis regulated the ischaemia reperfusion injury-induced inflammatory response in human cardiac myocytes. J Bioenerg Biomembr 2019; 51: 381–392.

26.

Dong

Chen

, et al. Sinomenine attenuates cartilage degeneration by regulating miR-223-3p/NLRP3 inflammasome signaling. Inflammation 2019; 42: 1265–1275.

27.

Wang

Tong

Liu

. MiR-223-3p targeting epithelial cell transforming sequence 2 oncogene inhibits the activity, apoptosis, invasion and migration of MDA-MB-468 breast cancer cells. Onco Targets Ther 2019; 12: 7675–7684.

28.

Lin

Wang

Yang

, et al. Impact of GAS5 genetic polymorphism on prostate cancer susceptibility and clinicopathologic characteristics. Int J Med Sci 2019; 16: 1424–1429.

29.

Shangguan

Han

. GAS5 knockdown ameliorates apoptosis and inflammatory response by modulating miR-26b-5p/Smad1 axis in cerebral ischaemia/reperfusion injury. Behav Brain Res 2020; 379: 112370.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.11 MB