Pomegranate extract ameliorates renal ischemia/reperfusion injury in rats via suppressing NF-κB pathway

Abstract

Inflammation and oxidative stress are the major pathways involved in ischemia–reperfusion (I/R)-induced renal injury. This study was designed to evaluate the potential effect of pomegranate against I/R-induced renal injury. I/R injury was induced in nephrectomized rats by unilateral occlusion of the left renal pedicle for 45 min followed by 24 h of perfusion. Pomegranate succeeded to decrease serum levels of creatinine, potassium, and urea nitrogen, along with increasing creatinine clearance. Pomegranate also decreased I/R-induced changes in histopathological examination. Pomegranate attenuated the renal inflammatory response reflected by the suppression of nuclear factor κB p65 DNA binding activity, the upregulation of inhibitory protein kappa B-alpha mRNA expression, the downregulation of mRNA and protein expression of tumor necrosis factor α, in addition to the reduced myeloperoxidase activity and mRNA expression. Additionally, pomegranate attenuated oxidative stress likely through the modulation of lipid peroxidation and antioxidant levels reflected by the decreased MDA content and the increased glutathione level and superoxide dismutase activity. Results confirm the potential protective effect of pomegranate against I/R-induced renal injury through its anti-inflammatory and anti-oxidant effects mediated through the upregulation of inhibitory protein kappa B-alpha, the inhibition of NF-κB activity, and the associated TNF-α release, neutrophil infiltration, and oxidative stress.

Keywords

Acute kidney injury inhibitory protein kappa B-alpha ischemia/reperfusion pomegranate nuclear factor-κB

Introduction

Renal ischemia–reperfusion injury (I/R) is a major clinical challenge with high morbidity and mortality rates which have not significantly decreased over the past 50 years. Several factors are responsible for I/R injury such as trauma, sepsis, some of vascular surgery, and renal transplantation.¹

During I/R, renal tissues initially experience hypoxia within ischemic period, then blood flow returns to ischemic tissues within reperfusion period resulting in more injury because of high amounts of oxygen that attack renal tissue resulting in more ROS release.² The mechanisms of I/R-induced acute kidney injury involve hypoperfusion, inflammation, and reactive oxygen species (ROS) production.² Leukocytes are among major players that may fuel the inflammatory response. During early phase of reperfusion, there is a rapid increase in the levels of various pro-inflammatory cytokines.^3,4 ROS production during reperfusion phase leads to uncontrolled oxidative stress and also drives the inflammatory cascade.⁵

Nuclear factor kappa B (NF-κB) is an important nuclear transcription factor which controls the expression of genes regulating inflammation, apoptosis, and tumorigenesis.⁶ I/R injury activates NF-κB pathway via degrading IκB and releasing NF-κB p65-p50 dimer, that when translocate into the nucleus, binds to NF-κB binding sites on DNA regulating the expression of target genes.⁷

Pomegranate (POM) is an ancient fruit which is rich in polyphenolic compounds including gallic acids, ellagic, punicalagin, and anthocyanins. It has become more popular because of its attribution to various pharmacological and biological activities such as anticancer, cholesterol-lowering, antiulcer, cardioprotective, and anti-infective.^8,9 Evidence shows that POM has potent free radical scavenging, antioxidant, and anti-inflammatory activities.¹⁰ It has been previously reported that POM attenuates nephrotoxicity induced by gentamicin via suppressing the oxidative stress in rats.¹¹ Furthermore, POM has been reported to inhibit inflammation in LPS-induced RAW264.7 macrophages via inhibiting TLR4/NF-κB signaling.¹²

The close association between protection provided by pomegranate and mechanisms of renal I/R suggests that pomegranate may be beneficial in protecting kidney against I/R injury. Therefore, the present study is designed to estimate the potential antioxidant and anti-inflammatory effects of POM in renal I/R injury and the possible mechanisms involved.

Materials and methods

Pomegranate extract

POM capsules were purchased from Verdure Science Inc. (USA). POM extract was standardized to 30% punicalagin-α and punicalagin-β and 5% of ellagic acid as shown in the HPLC-photodiode array profile.^13-15

Experimental animals

Male Sprague Dawley rats (200±20) were purchased from Vacsera center (Helwan, Egypt). The experimental work fulfills the ethical principles and guidelines for the care and use of laboratory animals approved by the Research Ethics Committee at Faculty of Pharmacy (Mansoura University, Egypt) which is in accordance with ‘‘Principles of Laboratory Animal Care’’ (NIH publication No. 85-23, revised 1985).

Experimental design

The rats were assigned into four groups (6 rats/each) as follows:

Sham group: Rats subjected to right nephrectomy and exposure of the left renal pedicle with no ischemia.

POM group: Rats received POM (400 mg/kg, orally) for 7 days and then underwent surgical procedures as in sham group.

I/R group: Rats subjected to right nephrectomy and left renal ischemia for 45 min.

POM + I/R group: Rats received POM (400 mg/kg, orally) for 7 days and then underwent surgical procedures as in I/R group. Dose of POM was chosen based on the findings obtained in the pilot study.

Induction of I/R

Rats were anesthetized with ketamine (75 mg/kg) and diazepam (5 mg/kg) administered via intraperitoneal injection,¹⁶ and anesthesia was maintained by halothane inhalation (1%). Rats were placed on a heating pad to preserve normal body temperature during the surgery. After shaving, the abdominal skin was sterilized with a 10% povidone–iodine solution, and all procedures were performed under sterile conditions. A midline laparotomy was made, and then the left kidney and its pedicle were dissected off the surrounding fat and clamped with a non-traumatic vascular clamp (Bulldog clamp) for 45 min. Complete ischemia was evidenced by the change of kidney color from red to dark purple in a few seconds. After 45 min, clamp was released to start reperfusion for 24 h. Right nephrectomy was done 5 min before removing the vascular clamp. The abdominal muscles and skin layer were then closed using 4-0 silk suture.¹⁶ After procedure, rats were put in metabolic cages for urine collection. After 24 h, rats were anesthetized with pentobarbital sodium (40 mg/kg, i.p., ¹⁷). Blood was collected from retro orbital sinus and then centrifuged for 15 min at 2000 g. Then, serum was stored at −80°C till analysis. Kidney tissues were rapidly removed, and then divided into two parts. First part was snap frozen in liquid nitrogen and stored at −80°C until subsequent analysis. The other part was fixed in 10% neutral buffered formalin. Rats were put in metabolic cages for urine collection 24 h post-I/R. After urine centrifugation, supernatant was collected to assess microalbumin, creatinine, and glucose, and the sediment was used for leukocytes assessment.

Assessment of serum creatinine, creatinine clearance, leukocyte leakage in urine, microalbumin, and glucosuria

Levels of creatinine in serum and urine were measured according to the instructions of manufacturer (Biodiagnostics, Badr, Egypt). Creatinine clearance was calculated according to the following equation; leukocytes counts in urine were performed using a hemocytometer and were expressed as cells/μl urine.

Urinary levels of microalbumin (Biosystems, Barcelona, Spain) and glucose (Analyticon Biotechnologies, Lichtenfels, Germany) were measured according to the instructions of manufacturer.

Assessment of potassium, BUN, CRP, and AST in serum

Levels of potassium (Lab-care diagnostics, Valsad, India), blood urea nitrogen (BUN, Biodiagnostics, Badr, Egypt), C-reactive protein (CRP, Reactivos GPL, Barcelona, Spain), and aspartate aminotransferase (AST, Biodiagnostics, Badr, Egypt) were measured according to the instructions of manufacturer.

Kidney homogenate preparation

Kidney tissue was homogenized in phosphate-buffered saline (pH 7.4). After centrifugation, oxidative stress biomarkers and TNF-α were measured in supernatant.

Assessment of oxidative stress biomarkers in kidney homogenate

Lipid peroxidation was estimated by measuring MDA level in the supernatant as thiobarbituric acid reactive substances (TBARS). Results were expressed as nmol/g tissue.¹⁸

SOD in kidney homogenate was assayed by monitoring the inhibition of pyrogallol auto-oxidation induced by SOD at alkaline pH. Results were expressed as U/g tissue.¹⁹

Additionally, the level of reduced GSH in the kidney was assessed according to the method described by Ellman.²⁰ Results were expressed as nmol/mg tissue.

Histopathological examination of the kidney

After kidney fixation in neutral-buffered formalin for 24 h, sections were embedded in paraffin wax, cut, and stained with hematoxylin–eosin (H&E) to assess infiltration of inflammatory cells. Inflammatory score was assessed as follows: 0-normal, 1-mild, 2-moderate, and 3-severe. The pathologist was blinded to the study treatment assignment.

NF-κB DNA-binding activity assessment

Nuclear proteins were extracted from kidney tissues (Abcam, Cambridge, USA), then relative NF-κB (p65) DNA binding in nuclear extract was quantified according to the instruction of manufacturer (Abcam, USA). Results were expressed as fold change from sham group.

Assessment of renal TNF-α level

TNF-α concentration was assessed according to the instructions of manufacturer (eBioscience, USA). Results were expressed as pg/g protein.

Determination of renal myeloperoxidase (MPO) activity

Neutrophils infiltration in renal tissues was assessed by measuring MPO activity according to the method previously described with a slight modification.²¹ Kidney tissues were first homogenized in phosphate buffer (0.1 M NaCl, 0.015 M EDTA, 0.02 M NaH₂PO₄, pH 4.7) and then centrifuged for 15 min at 10,000 g. The precipitate was then resuspended in sodium phosphate buffer (pH 5.4) containing hexadecyltrimethylammonium bromide (0.5% w/v). Suspension was freeze–thawed three times using liquid nitrogen. After centrifugation, TMB and H₂O₂ solution were added to supernatant and incubated for 5 min. Reaction was terminated by adding H₂SO₄ at 4°C. The color was measured at 450 nm. Results were expressed as a fold change over sham group.

qRT-PCR

First step was the extraction of total RNA trizol method (life technologies, USA). Then, complementary DNA (cDNA) was reverse transcribed from RNA using Quantitect Reverse Transcription Kit (Qiagen, Germany). The mRNA levels of Iκβ-α, TNF-α, and MPO were normalized relative to B-actin in the same sample. Primers for IKβ-α, TNF-α, MPO, and B-actin were as follows:

IKβ-α (sense: GTGACTTTGGGTGCTGATGT; antisense: ACACTTCAACAGGAGCGA GA; amplicon size = 111); TNF-α (sense: ATGTGGAACTGGCAGAGGAG; antisense: T GGAACTGATGAGAGG GAG; amplicon size = 195); MPO (sense: CTGGAGAGTTGTG CTGGAAG; antisense: CGATTCAGTTTGGCAGGAGT; amplicon size = 75); and B-actin (sense: CCGTCTTCCCCTCCATCG; antisense: GACCCATACCCACCATCACA; amplicon size = 60).

The results were represented as fold change of relative expression of the target gene over the sham.

Statistical Analysis

Data are expressed as mean ± SEM. One way analysis of variance (ANOVA) followed by Tukey–Kramer multiple comparisons post hoc test was used for parametric data analysis while Kruskal–Wallis followed by Dunn post hoc test was used for non-parametric data analysis. GraphPad Prism V 5.02 was used for statistical analysis and graphing (GraphPad Software Inc., USA).

Results

Impact of POM on I/R-induced changes in serum creatinine, creatinine clearance, urinary leukocytes count, microalbumin, and glucose

I/R significantly decreased creatinine clearance to fifth and increased serum creatinine, urinary leukocytes count, microalbumin, and glucose by 2.5-, 67.3-, 28.3--, and 28.4fold, respectively, (p < 0.05, n = 6). POM group did not show any significant effect on these renal markers in comparison to sham group. Pretreatment with POM significantly prevented the I/R-induced decrease in creatinine clearance and elevation of serum creatinine, urinary leukocytes count, microalbumin, and glucose (Figure 1).

Figure 1.

Impact of POM on I/R-induced changes in serum creatinine, creatinine clearance, urinary leukocytes count, microalbumin, and glucose. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Serum and urine were collected 24 h after I/R to measure serum creatinine (a), creatinine clearance (b), urinary leukocytes count (c), microalbumin (d), and glucose (e). *, # p<0.05, significantly different from sham and I/R groups, respectively, n = 6.

Impact of POM on I/R-induced changes in serum K+, BUN, AST, and CRP

I/R significantly increased serum K+, BUN, AST, and CRP by 1.78-, 2.32-, 2.27-, and 2.9-fold, respectively (p < 0.05 vs. sham, n = 6). There was no significance difference between sham and POM groups. Pretreatment with POM significantly reduced serum K+, BUN, AST, and CRP (p < 0.05 vs. I/R, n = 6, Table 1).

Table 1.

Impact of POM on I/R-induced changes in serum K+, BUN, AST, and CRP.

	Sham	POM	I/R	POM + I/R
K+ level (mmol/l)	5.08 ± 0.28	4.80 ± 0.29	8.90 ± 0.28 ^*	5.94 ± 0.22 ^#
BUN (mg/dl)	20.30 ± 1.20	19.70 ± 1.09	46.46 ± 3.06 ^*	30.50 ± 2.40 ^#
CRP (mg/L)	11.14 ± 1.50	10.30 ± 1.10	32 ± 2.50 ^*	15 ± 1.34 ^#
AST level (U/L)	61.25 ± 3.60	65.80 ± 2.80	139.44 ± 9.19 ^*	81.13 ± 6.34 ^#

POM (400 mg/kg, orally) was given for 7 days prior to uninephrectomy and renal ischemia for 45 min. Serum was collected 24 h post-I/R to assess serum K+, BUN, AST, and CRP. Data are expressed as mean ± SEM, n=6. *, # p < 0.05, significantly different from sham and I/R groups, respectively.

Impact of POM on I/R-induced changes in oxidative stress biomarkers in renal tissues

I/R significantly increased MDA content (Figure 2(a)) 1.96-fold and decreased SOD activity to three-fifth (Figure 2(b)) and GSH level to three-tenth (Figure 2(c)) (p < 0.05 vs. sham group, n = 6). There were no significant differences between sham and POM groups. Pretreatment with POM significantly increased SOD activity and GSH level and decreased MDA content (p < 0.05 vs. I/R group, n = 6).

Figure 2.

Impact of POM on I/R-induced changes in oxidative stress biomarkers in renal tissues. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Renal tissues were collected 24 h after I/R to assess MDA (a); SOD (b); and GSH (c). *, # p < 0.05, significantly different from sham and I/R groups, respectively, n = 6.

Impact of POM on I/R-induced changes in histopathological examination of the kidney

Sham and POM groups revealed normal kidney structure and no abnormalities were observed (Figure 3(a)). I/R group showed a marked inflammatory cells infiltration, medullary congestion, hemorrhage, and obstructing casts in the medulla. POM administration prior to I/R prevented I/R-induced histopathological changes.

Figure 3.

Impact of POM on I/R-induced changes in histopathological examination of the kidney. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Renal tissues were collected 24 h post-I/R for histopathological examination (X100) stain (a) and inflammatory score assessment (b). Sham and POM rats revealed normal kidney structure. I/R caused a marked inflammatory cells infiltration, medullary congestion and hemorrhage, and obstructing casts in the medulla. The administration of POM prior to I/R attenuated the histopathological changes induced by I/R. **, ## p<0.05, significantly different from sham and I/R groups, respectively, using Kruskal–Wallis followed by Dunn post hoc test.

Figure 3(b) shows the effect of POM on changes in inflammatory score. I/R significantly increased inflammatory score to be 4.0 (p< 0.05 vs 0.0 in sham group). Treatment with POM significantly decreased inflammatory score to be 1.0 compared to I/R group. There is no significant difference between sham and POM groups in inflammatory score.

Impact of POM on I/R-induced increases in NF-κB DNA-binding activity in kidney tissues

I/R significantly increased p65 DNA-binding activity 1.7-fold (Figure 4(a)) (p < 0.05 vs. sham, n=6). There was no significant difference between sham and POM groups. Pretreatment with POM significantly decreased NF-κB p65 DNA-binding activity (p < 0.05 vs. I/R, n=6).

Figure 4.

Impact of POM on I/R-induced changes in NF-κB DNA-binding activity in addition to IκB-α mRNA expression in renal tissues. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Renal tissues were collected 24 h after I/R to assess NF-κB p65 DNA-binding activity (a) and relative mRNA expression of IκB-α (b).*, # p < 0.05, significantly different from sham and I/R groups, respectively, n = 6.

Impact of POM on I/R-induced changes mRNA expression of IκB-α in renal tissues

I/R significantly increased IκB-α mRNA expression (p < 0.05 vs. sham groups, n = 6) (Figure 4(b)). There was no significant difference between sham and POM groups. Pretreatment with POM significantly prevented I/R-induced decrease in IκB-α mRNA expression (p < 0.05 vs. I/R group, n = 6).

Impact of POM on I/R-induced increases in mRNA and protein expression of TNF-α in renal tissues

I/R significantly increased mRNA and protein expression of TNF-α 6.7- and 3.7-fold, respectively, (p < 0.05 vs. sham, n = 6, Figures 5(a) and (b)). There were no significant differences between sham and POM groups. Pretreatment with POM significantly reduced mRNA and protein expression of TNF-α (p < 0.05 vs. I/R group, n = 6).

Figure 5.

Impact of POM on I/R-induced increases in mRNA and protein expression of TNF-α in renal tissues. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Renal tissues were collected 24 h after I/R to assess relative mRNA expression of TNF-α (a) and TNF-α protein level (b). *, # p<0.05, significantly different from sham, I/R group, respectively, n = 6.

Impact of POM on I/R-induced increases in activity and mRNA expression of MPO in renal tissues

Additionally, renal mRNA expression and activity of MPO were significantly elevated in I/R group by 2- and 1.8-fold, respectively, (p < 0.05 vs. sham group, n = 6, Figures 6(a) and (b)). There were no significant differences between sham and POM groups. Pretreatment with pomegranate significantly reduced mRNA expression and activity of MPO (p < 0.05 vs. I/R group, n = 6).

Figure 6.

Impact of POM on I/R-induced increases in MPO mRNA expression and activity in renal tissues. POM (400 mg/kg, orally) was administered for 7 days prior to I/R. Renal tissues were collected 24 h after I/R to assess relative mRNA expression of MPO (a) and MPO activity (b). *, # p<0.05, significantly different from sham, I/R group, respectively, n = 6.

Discussion

In the present study, I/R induced a sudden decrease in kidney function, oxidative stress, and a significant increase in the inflammatory markers that were parallel to the histopathological changes. Oral administration of POM prior to I/R has significant protective effects against I/R-induced renal dysfunction and histolopathological changes in rats via reducing the oxidative stress and inflammation.

Ischemic kidney injury is a complex clinical challenge involving renal vasoconstriction, extensive tubular damage, myofibroblast activation, tubular cell necrosis, hemodynamics alteration, release of ROS, and neutrophil accumulation.⁴

Previous studies showed that I/R-induced renal dysfunction was elucidated by the increased serum levels of creatinine, AST, K+, and urea nitrogen. In addition to the urinary leakage of leukocytes, glucose, and microalbumin and the decreased creatinine clearance.^{22, 23} Results of the present study match with the previous studies indicating the impaired glomerular filtration and tubular damage. Moreover, histopathological examination showed a marked inflammatory cells infiltration, medullary congestion and hemorrhage, and obstructing casts in the medulla confirming kidney damage induced by I/R.

Pretreatment with POM prevented I/R-induced kidney dysfunction via decreasing serum levels of creatinine, AST, K+, urea nitrogen, and CRP. In addition to dereasing urinary leakage of leukocytes, glucose, and microalbumin, and increasing creatinine clearance. These results are in accordance with the previous study demonstrated the ability of POM to improve renal dysfunction induced by gentamicin.¹¹

In renal I/R injury, polymorphonuclear leukocytes (PMNs) infiltration into kidney parenchyma is well-known phenomenon mediating the tissue injury.²⁴ Activation of these cells releases ROS, MPO, cytokines, and other enzymes.²⁵ Consistently, the present study demonstrated that PMNs trafficking into kidney was increased as evidenced by histopathological findings and elevated MPO mRNA expression and activity confirming that I/R increases PMNs trafficking activity and triggers inflammation.

POM administration prior to I/R decreased MPO mRNA expression and activity suggesting its attenuating effect on neutrophils infiltration. This was further confirmed by histopathological findings. Previous study reported that POM polyphenols exerted anti-inflammatory and cytotoxic effects in azoxymethane-treated rats and colon cancer cells by decreasing vascular cell adhesion molecules (VCAM)-1 expression.²⁶ In the present study, VCAM-1 was not measured; however, this could be the mechanism by which POM attenuated leuckocytes trafficking into renal tissues.

Inflammation is a major player in the development of ischemic injury that is initiated by leukocytes infiltration and proinflammatory cytokines production following I/R.² In the current study, inflammation was measured both systemically and locally. I/R systemically increased serum CRP and locally increased renal TNF-α level. TNF-α could upregulate its own expression as well as expression of other genes implicated in the inflammatory response.²⁷ Evidence shows that I/R increased TNF-α expression in rat kidney.^{28, 29} Administration of POM prior to I/R decreased the elevated TNF-α at both mRNA and protein levels.

To investigate mechanisms through which I/R induced TNF-α expression, NF-κB (P65) DNA-binding activity, TNF-α expression, and IκB-α expression were estimated.

NF-κB is one of the key regulators of inflammation.⁶ Inhibition of NF-κB activation could be useful in renal I/R injury.⁷

In this context, the current study demonstrated that I/R increased TNF-α mRNA expression, decreased IκB-α mRNA expression, and subsequently increased NF-κB (p65) DNA-binding activity confirming the involvement of NF-κB signaling in the pathogenesis of renal I/R. POM administration prior to I/R decreased TNF-α mRNA expression and increased IκB-α mRNA expression and subsequently decreased p65 DNA-binding activity. Therefore, inhibition of NF-κB pathway represents a major signaling through which POM can attenuate I/R injury.

Another major pathway involved in I/R is oxidative stress. ROS generation such as hydroxyl radical and superoxide radical is a key feature of I/R injury.³⁰ These reactive radicals could cause direct damage to proteins and membranes and indirect damage via activating pro-apoptotic signaling.³¹

Oxidative stress is not only responsible for cellular damage but also triggers inflammatory response via activating nuclear factor kappa B and p38 mitogen-activated protein kinase; key signaling elements involved in cytokines production such as TNF-α^{32, 33} indicating interplay between two pathways. Experimental evidence reports that antioxidant treatment has been proven to attenuate AKI.³⁴

Consistently, evidence shows that I/R increased MDA content and decreased GSH level and SOD activity.^{16, 28} The current study revealed that POM administration significantly prevented IR-induced increase in MDA level and decrease in SOD activity and GSH level confirming that POM could have antioxidant activity against oxidative stress induced by renal IR.

In conclusion: POM could prevent I/R-induced acute renal injury in rats through the suppression of NF-κB activity, the inhibition of TNF-α release and neutrophil infiltration along with the suppression of oxidative stress.

Footnotes

Acknowledgments

We would like to thank Dr Nadia Atwan , Professor of Pathology, Faculty of Medicine for her assistance in pathological work and Dr Eman Nour, Fellow of Veterinary Medicine, Animal Research Facility, Urology and Nephrology Center, Mansoura University for her help during surgical work.

Author contributions

MNM contributed to the experimental design, experimental work, statistical analysis, and writing; MSEA contributed to the experimental design, statistical analysis, and writing; RRAA contributed to the experimental design, statistical analysis, and writing; NMG contributed to revising the manuscript; ABSED contributed to the experimental design and revising the manuscript; and EMA contributed to the experimental design.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iDs

Mirhan N Makled

Rania R Abdel-Aziz

Appendix

References

Kezić

Stajic

Thaiss

. Innate immune response in kidney ischemia/reperfusion injury: potential target for therapy. J Immunol Res 2017; 2017: 6305439.

Huang

Zhang

Wang

, et al. PPARγ in ischemia-reperfusion injury: overview of the biology and therapy. Front Pharmacol 2021; 12.

M-Y

Yiang

G-T

Liao

W-T

, et al. Current mechanistic concepts in ischemia and reperfusion injury. Cell Physiol Biochem 2018; 46: 1650–1667.

Naito

Nojima

Fujisaki

, et al. Therapeutic strategies for ischemia reperfusion injury in emergency medicine. Acute Med Surg 2020; 7: e501.

Han

Lee

. Mechanisms and therapeutic targets of ischemic acute kidney injury. Kidney Res Clin Pract 2019; 38: 427–440.

Song

Thaiss

Guo

. NFκB and kidney injury. Front Immunol 2019; 10: 815.

Bai

Zhao

Cui

, et al. Protective effect of hydroxysafflor yellow a against acute kidney injury via the TLR4/NF-κB signaling pathway. Scientific Rep 2018; 8: 9173.

Bassiri-Jahromi

. Punica granatum (Pomegranate) activity in health promotion and cancer prevention. Oncol Rev 2018; 12: 345.

Melgarejo-Sánchez

Núñez-Gómez

Martínez-Nicolás

, et al. Pomegranate variety and pomegranate plant part, relevance from bioactive point of view: a review. BioResources Bioprocess 2021; 8: 2.

10.

Baradaran Rahimi

Ghadiri

Ramezani

, et al. Antiinflammatory and anti‐cancer activities of pomegranate and its constituent, ellagic acid: evidence from cellular, animal, and clinical studies. Phytotherapy Res 2020; 34: 685–720.

11.

Cekmen

Otunctemur

Ozbek

, et al. Pomegranate extract attenuates gentamicin-induced nephrotoxicity in rats by reducing oxidative stress. Ren Fail 2013; 35: 268–274.

12.

Zhang

, et al. Pomegranate peel polyphenols inhibits inflammation in LPS-induced RAW264.7 macrophages via the suppression of TLR4/NF-κB pathway activation. Food Nutr Res 2019; 63.

13.

Mertens-Talcott

Jilma-Stohlawetz

Rios

, et al. Absorption, Metabolism, and Antioxidant Effects of Pomegranate (Punica granatumL.) Polyphenols After Ingestion of a Standardized Extract in Healthy Human Volunteers. J Agric Food Chem 2006; 54: 8956–8961.

14.

Pacheco-Palencia

Noratto

Hingorani

, et al. Protective effects of standardized pomegranate (punica granatum l.) polyphenolic extract in ultraviolet-irradiated human skin fibroblasts. J Agric Food Chem 2008; 56: 8434–8441.

15.

Sadik

NAH

Shaker

. Inhibitory effect of a standardized pomegranate fruit extract on Wnt signalling in 1, 2-dimethylhydrazine induced rat colon carcinogenesis. Dig Dis Sci 2013; 58: 2507–2517.

16.

Awadalla

Hussein

El-Far

, et al. Effect of zinc oxide nanoparticles and ferulic acid on renal ischemia/reperfusion injury: possible underlying mechanisms. Biomed Pharmacother 2021; 140: 111686.

17.

Khaled

Makled

Nader

. Tiron protects against nicotine-induced lung and liver injury through antioxidant and anti-inflammatory actions in rats in vivo. Life Sci 2020; 260: 118426.

18.

Ohkawa

Ohishi

Yagi

. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979; 95: 351–358.

19.

Marklund

. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 1974; 47: 469–474.

20.

Ellman

. Tissue sulfhydryl groups. Arch Biochem Biophys 1959; 82: 70–77.

21.

Schierwagen

Bylund-Fellenius

A-C

Lundberg

. Improved method for quantification of tissue PMN accumulation measured by myeloperoxidase activity. J Pharmacol Methods 1990; 23: 179–186.

22.

Chang

Choi

Jeong

, et al. Dapagliflozin, SGLT2 inhibitor, attenuates renal ischemia-reperfusion injury. PLoS One 2016; 11: e0158810.

23.

Salehi

Garmabi

Jafarisani

, et al. Vaspin exert anti-inflammatory and antioxidant effects on renal and liver injury induced by renal ischemia reperfusion. Int J Pept Res Ther 2020; 26: 1607–1612.

24.

Rabie

Zaki

Bahgat

, et al.

Angiotensin antagonists and renal ischemia/reperfusion: Possible modulation by l-carnitine

Bull Fac Pharm Cairo Univ 2012; 50: 7–16.

25.

Khan

Alsahli

Rahmani

. Myeloperoxidase as an active disease biomarker: recent biochemical and pathological perspectives. Med Sci 2018; 6: 33.

26.

Banerjee

Kim

Talcott

, et al. Pomegranate polyphenolics suppressed azoxymethane-induced colorectal aberrant crypt foci and inflammation: possible role of miR-126/VCAM-1 and miR-126/PI3K/AKT/mTOR. Carcinogenesis 2013; 34: 2814–2822.

27.

Lee

Cho

Kim

, et al. TNF-α-induced Inflammation Stimulates Apolipoprotein-A4 via Activation of TNFR2 and NF-κB Signaling in Kidney Tubular Cells. Scientific Rep 2017; 7: 8856.

28.

Hou

Chen

, et al. Hydralazine protects against renal ischemia-reperfusion injury in rats. Eur J Pharmacol 2019; 843: 199–209.

29.

Liu

Liang

, et al. Ellagic acid ameliorates renal ischemic-reperfusion injury through NOX4/JAK/STAT signaling pathway. Inflammation 2020; 43: 298–309.

30.

Chen

. Reactive Oxygen Species (ROS)-responsive nanomedicine for solving ischemia-reperfusion injury. Front Chem 2020; 8: 732.

31.

Kaushal

Chandrashekar

Juncos

. Molecular interactions between reactive oxygen species and autophagy in kidney disease. Int J Mol Sci 2019; 20: 3791.

32.

Rapa

Di Iorio

Campiglia

, et al. Inflammation and oxidative stress in chronic kidney disease-potential therapeutic role of minerals, vitamins and plant-derived metabolites. Int J Mol Sci 2019; 21: 263.

33.

Charlton

Garzarella

Jandeleit-Dahm

KAM

, et al. Oxidative stress and inflammation in renal and cardiovascular complications of diabetes. Biology 2021; 10: 18.

34.

Dennis

Witting

. Protective role for antioxidants in acute kidney disease. Nutrients 2017; 9: 718.