Neuroprotective effect of miR-204-5p downregulation against isoflurane-induced learning and memory impairment via targeting EphB2 and inhibiting neuroinflammation

Abstract

Background:

Isoflurane, one of the most commonly used inhalational anesthetics, is usually used in surgery patients and often causes long-term learning and memory impairment. The aim of this study was to explore the role of microRNA-204-5p (miR-204-5p) in isoflurane-induced learning and memory impairment in rats.

Methods:

The Morris Water Maze (MWM) test was used to estimate the spatial learning and memory abilities of laboratory rats. Enzyme-linked immunosorbent assay (ELISA) was used to determine interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) concentrations in the hippocampal tissues. The expression level of miR-204-5p was determined by using quantitative reverse transcription polymerase chain reaction (qRT-PCR). The potential target genes of miR-204-5p were predicted and verified by the TargetScan and dual-luciferase reporter assay, respectively.

Results:

Isoflurane-induced rats showed significantly higher neurological function scores, higher escape latency and shorter time spent in the original quadrant. Isoflurane could significantly induce neuroinflammation, and the expression of miR-204-5p was increased in the hippocampal tissue of rats exposed to isoflurane. Moreover, downregulation of miR-204-5p attenuated the effect of isoflurane treatment on the escape latency and the time in the original quadrant, and inflammatory cytokines level was downregulated by inhibiting the expression of miR-204-5p. EphB2 was verified as a direct target gene of miR-204-5p.

Conclusion:

Downregulated miR-204-5p exerts protective effects against isoflurane-induced learning and memory impairment via targeting EphB2 and inhibiting neuroinflammation. MiR-204-5p could serve as a potential therapeutic target for the lightening of cognitive dysfunction induced by isoflurane.

Keywords

miR-204-5p isoflurane learning and memory impairment EphB2

Introduction

MicroRNAs (miRNAs/miRs), firstly discovered in the early 19th by Lee et al.,¹ are single-stranded and non-coding RNA species consisting of approximately 18–25 nucleotides. MiRNAs can serve as important regulators of post-transcriptional gene expression.² Abnormal expression of miRNAs has been confirmed to be related to the occurrence of various diseases such as the nervous system, autoimmune system, and cardiovascular system diseases. MiRNAs are also involved in the regulation of cell growth, proliferation, differentiation, and degradation, the study of these molecules would enable us to better understand the pathogenesis of diseases.³ The dysregulation of miRNAs has been reported to play a role in the protective mechanism of several neurological diseases.^4–7 Recently, miR-204-5p is reported to play a vital role in neurodegenerative diseases, and involved in the occurrence and development of Parkinson’s disease.⁸ In addition, in a study of sensorineural hearing loss (SNHL), miR-204-5p is also suggested to be involved in the functional recovery of impaired spiral ganglion neurons. All studies indicated the neuroprotective role of miR-204-5p. However, the role of miR-204-5p in neurological damage caused by isoflurane has not been studied.

Isoflurane is currently a widely used inhaled anesthetic in clinical applications, and its induced cognitive dysfunction is a common complication after major surgery.⁹ The typical symptoms are their impairment in learning, writing and reading.^10,11 Isoflurane can also cause a variety of pathophysiological processes, such as neuroinflammation,¹² excitotoxicity,¹³ mitochondrial dysfunction,¹⁴ and oxidative stress.¹⁵ For example, Wang et al. showed that isoflurane-induced age-related hippocampal neuroinflammation via NLRP3 inflammasome activation.¹⁶ It is worth noting that early isoflurane exposure may cause persistent learning deficits and cognitive dysfunction in children and rodents.¹⁷ However, the pathogenesis of neurological damage caused by isoflurane is not fully understood. Herein, it is an increasingly urgent duty to understand the pathogenesis of isoflurane-induced neurological damage and discover candidate drugs for neuroprotection.

Here, the current study results indicated that miR-204-5p was upregulated in isoflurane-treated rats, and we hypothesized that downregulated miR-204-5p had a neuroprotective effect on isoflurane-induced cognitive dysfunction in rats. Moreover, it is predicted that the 3′-UTR of ephrin type B receptor 2 (EphB2) is the direct target of miR-204-5p. The down-regulated miR-204-5p may play a protective role in isoflurane-induced learning and memory impairment by targeting EphB2 and inhibiting neuroinflammation.

Materials and methods

Animals

This animal research was authorized by the Ethics Committee of the Experimental Animal Center of Jinan Third People’s Hospital Hospital (Ethical Approval Number: 201719). Animals were fed under the principles outlined in the Guide for the Care and Use of Laboratory Animals of the Institute for Laboratory Animal Research. Sixty-four male Sprague-Dawley rats (Age, 1 week; Weight, 18–22 g) were obtained from the Animal Center of Chinese Academy of Sciences. All rats were fed in a regulated environment (24 ± 2°C, 45–65% humidity, and a 12 h light/dark cycle) with free access to food and water.

Experimental groups

All rats excluded control group was exposed to 0.75% isoflurane for 6 h according to the previous study.¹⁸ In brief, rats were anesthetized in a preheated, humidified anesthetic chamber with 0.75% isoflurane for 6 h, and the gas composition of the anesthetic chamber was monitored with the application of a calibrated Datex Capnomac Ultima (Datex Instrumentarium Corp., Helsinki, Finland).

The rats were randomly divided into four groups (n = 16 in each group): i, sham control group, rats were exposed in regular air without contact with isoflurane at any time; ii, isoflurane group, rats were exposed to 0.75% isoflurane for 6 h; iii, isoflurane + miR-NC group, rats were injected miR-204-5p negative control antagomir prior to isoflurane exposure; iv, isoflurane + miR-antagomir group, rats were injected miR-204-5p antagomir prior to isoflurane exposure. After experiments, eight rats in each group were sacrificed, and the hippocampus tissues were collected for qRT-PCR. The remaining rats were fed until day 14 (P14), and used for the following neurological function score and Morris water maze test.

Estimation of neurological function score

Rats were fed until day 14 (P14). To assess the neurological function of rats, we investigated the balance, touch, vision, abnormal behavior, muscle mass, sensation and motion of rats, and estimated using a modified Neurological Severity Score (mNSS). Neurological function is scored between 0 and 18, with 0 indicating no deficits and 18 indicating maximum deficits.

Morris water maze test

Rats were fed until day 14 (P14). To assess the learning and memory function of rats, a Morris water maze test was performed using a method earlier described.¹⁹ In brief, the rats in each group were forced to perform the hidden-platform training using a pool (80 cm height and 120 cm diameter) for five consecutive days with four trials daily. Four quadrants were created in the apparatus, and the platform was depth at 30 cm under the water. The releasing position was selected randomly, and animals were placed into the pool facing the wall of the pool. If they failed to find the submerged platform within 120 s of swimming, the rats will be put on the platform passively and stayed for 15 s. Then we removed the platform on the 6th day, and a probe trial was performed. The rats were allowed to swim freely in the pool for 60 s and the escape latency and time in the original quadrant of rats were recorded and analyzed by a video imaging analysis system.

Quantitative real-time PCR (qRT-PCR)

RNA was separated and extracted from the hippocampus tissue samples using TRIzol reagent (Cat no. 15596018; Invitrogen; Thermo Fisher Scientific, Inc.) according to the experimental instructions. A miScript RT kit (Cat no. 218161; Qiagen GmbH) was used for reverse transcription. To investigate miR-204-5p expression levels, the qRT-PCR assay was performed using SYBR green I Master Mix kit (Cat no. 4385610; Invitrogen; Thermo Fisher Scientific, Inc.). Using the gene sequence database GenBank and the miR database BASE, the primer sequences of miR-204-5p and U6 were designed by using Primer 5.0 primer design software and the sequences were recorded in Table 1. The cycle conditions were as follows: initial denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 20 s; and a final extension at 72°C for 10 min. U6 was used as an endogenous control quantification of the relative expression of miR-204-5p which was calculated by using the 2^−ΔΔCt method.

Table 1.

Primer sequences information used to amplify miR-204-5p and U6.

Gene	Accession no.	Forward primer (5′–3′)	Reverse primer (5′–3′)	Length (bp)
MiR-204-5p	MIMAT0000237	ACACTCCAGCTGGGTTC CCTTTGTCATCCTAT	CTCAACTGGTGTCGTGGA	72
U6	NM_012321	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT	96

Enzyme-linked immunosorbent assay (ELISA)

Levels of IL-6 (Cat no. E02I0006), TNF-α (Cat no. E02T0008), and IL-1β (Cat no. E02I0010) in the hippocampus tissues were detected by the specific enzyme-linked immunosorbent (ELISA) kits (Blue Gene Biotech company, Shanghai, China) according to the manufacturer’s recommendations.

Dual-luciferase reporter assay

Using TargetScan 7.2 to predict candidate target gene of miR-204-5p, the 3′-untranslated region (3′-UTR) of EphB2 was found to have the complementary sequence of miR-204-5p as shown in Figure 5(A). To evaluate their interaction, a dual-luciferase reporter assay was performed as mentioned in previously reporting with modified.²⁰ In short, the HEK293T cell was co-transfected with wild-type (WT) or mutant-type (MT) EphB2 3′-untranslated region luciferase vector together with miR-204-5p mimic, miR-204-5p inhibitor or their negative control (miR-NC) using Lipofectamine 3000 Reagent (Invitrogen). The transfection lasted for 24 h, then the luciferase activity of the cells in each group was assessed by a luciferase assay kit (Cat no E1550; Promega, Madison, WI, USA). Experiments were run at least three times.

Statistical analysis

GraphPad Prism 7.04 software was used for analyzing all statistical data. Data were reported as mean and SD. Student’s t-test and one-way ANOVA analysis were applied for the significance test of differences between two groups or among multiple groups. P < 0.05 was considered to be statistically significant.

Results

Isoflurane-induced cognitive dysfunction in rats

The neurological examination and Morris water maze test were performed to assess the effect of isoflurane on neurological impairment in rats. As shown in Figure 1(A), the neurological function score in isoflurane-induced rats was significantly higher than that in the control group (P < 0.001). Compared with rats of the control group, the escape latency of rats during Morris water maze tests was significantly prolonged in the isoflurane-treated rat group (P < 0.001, Figure 1(B)), showing that the spatial learning ability of the rats was impaired. The duration of staying in the original safe-platform quadrant was significantly decreased in isoflurane-induced group compared with the control group (P < 0.001, Figure 1(C)), illustrating an impairment in the memory ability of the rats.

Figure 1.

The effect of isoflurane on neurological damage in rats. (A) The neurological function score of isoflurane-induced group was higher significantly than that of the control group. (B) The escape latency in the isoflurane group was significantly longer than that of the control group. (C) The time in the original quadrant was significantly decreased in isoflurane-treated rats. ***P < 0.001.

Effects of isoflurane on neuroinflammation

The isoflurane-induced learning and memory impairment is often accompanied by an inflammatory response.¹² The expression levels of IL-6, IL-1β and TNF-α were measured to analyze the role of neuroinflammation in cognitive handicap. The result showed that, in the hippocampus of rats, the protein levels of IL-6, TNF-α, and IL-1β were increased significantly after exposure to isoflurane (P < 0.001, Figure 2).

Figure 2.

The concentration of IL-6 (A), TNF-α (B), and IL-1β (C) in isoflurane-induced group were increased significantly compared with the control group. ***P < 0.001.

Dysregulation of miR-204-5p in isoflurane-induced rats

The expression level of miR-204-5p was detected by qRT-PCR assay in the hippocampus of both the control group and isoflurane group. It was found that the expression of miR-204-5p was upregulated significantly in rats exposed to isoflurane compared with the control group (P < 0.01, Figure 3), indicating that the upregulated miR-204-5p might be related to the neurological function impairment induced by isoflurane.

Figure 3.

The expression of miR-204-5p in isoflurane-treated rats. Compared with the control group, the expression level of mir-204-5p in the hippocampus of rats treated with isoflurane increased significantly. ***P < 0.001.

miR-204-5p attenuated the cognitive dysfunction and neuroinflammation induced by isoflurane

Based on the up-regulated expression of miR-204-5p in rats exposed to isoflurane, the effects of miR-204-5p on the learning and memory impairment and neuroinflammation induced by isoflurane were further explored by regulating miR-204-5p expression in vivo. The expression of miR-204-5p increased significantly after isoflurane treatment, while miR-204-5p antagomir could significantly reduce the expression of miR-204-5p (Figure 4(A), F = 9.893, P < 0.001). As shown in Figure 4(B), the down-regulated miR-204-5p significantly reduced the neurological function score in isoflurane-induced group (F = 28.07, P < 0.001). Moreover, downregulation of miR-204-5p can significantly attenuate the effect of isoflurane treatment on the escape latency (Figure 4(C), F = 45.52, P < 0.001) and the time in the original quadrant (Figure 4(D), F = 80.31, P < 0.001).

Figure 4.

The effect of miR-204-5p on isoflurane-induced neurological impairment. (A) The expression of miR-204-5p increased significantly after isoflurane treatment, while miR-antagomir could significantly reduce the expression of miR-204-5p. (B) The upregulated miR-204-5p significantly reduced the neurological function score in isoflurane-induced group. (C and D) Upregulation of miR-204-5p can significantly reduce the effect of isoflurane treatment on the escape latency and the time in the original quadrant. (E) The inflammatory cytokines levels in the hippocampus were detected by enzyme-linked immunosorbent assay (ELISA). ***P < 0.001, compared with control group; ^###P < 0.001, compared with isoflurane group.

To further investigate the effect of miR-204-5p on isoflurane-induced neurological impairment in rats, the inflammatory cytokines (IL-6, TNF-α, and IL-1β) levels in the hippocampus were performed by ELISA. The expression level of inflammatory cytokines was increased significantly after inducing by isoflurane. After miR-204-5p antagomir transfection, the levels of IL-6 (F = 27.51, P < 0.001), TNF-α (F = 18.6, P < 0.001)), and IL-1β (F = 20.44, P < 0.001)) induced by isoflurane were all downregulated significantly in the hippocampus of rats (Figure 4(E)).

EphB2 is the target gene of miR-204-5p

EphB2 was predicted to be the putative binding target of miR-204-5p via Targetscan7.2 (Figure 5(A)). The relative luciferase activity was performed by dual-luciferase reporter assay to confirm the relation of miR-204-5p and EphB2. The miR-204-5p inhibitor significantly enhanced the luciferase activity of EphB2-Wt vector, while the activity of EphB2-Mut reporter vectors had little change. Meanwhile, miR-204-5p mimic significantly decreased the luciferase activity of EphB2 wildtype luciferase reporter vector in cells compared to control group (Figure 5(B), F = 77.05, P < 0.001), while had no effect on EphB2 mutant luciferase reporter vector. The above results indicated the binding ability between miR-204-5p and EphB2.

Figure 5.

EphB2 is a functional target of miR-204-5p. (A) The putative miR-204-5p binding site in the 3′-UTR of EphB2 was shown. (B) Transfection of miR-204-5p mimic decreased the luciferase activity in cells transfected with EphB2-Wt, whereas the luciferase activity was increased by miR-204-5p inhibitor transfection significantly. Mutation in the miR-204-5p binding sites in the 3’-UTR of EphB2 abolished the effect on the luciferase activity. ***P < 0.001, compared with control group.

Discussion

Isoflurane-induced cognitive dysfunction has attracted more and more attention in recent studies. And miRNAs have shown the potential therapeutic effect on neurological diseases. In this study, we showed for the first time that miR-204-5p downregulation attenuated isoflurane-induced learning and memory impairment and neuroinflammation in neonatal rats. Moreover, the protective effect of miR-204-5p downregulation after isoflurane exposure might be achieved by targeting EphB2 and inhibiting neuroinflammation.

A growing number of studies have shown that regulation of miRNAs expression exhibits neuroprotective effects in several diseases involved nerve injuries, such as miR-15a/16-1, miR-214,²¹ and miR-203.²² These dysregulated miRNAs play a vital role in development of neuro-related diseases and its role in isoflurane-induced learning and memory impairment have attracted more and more attention for their therapeutic potential. For instance, Qi et al. demonstrated that vitexin had protective effects against isoflurane-induced neurotoxicity by inhibiting the expression of miR-409.²³ Work by Cao et al. demonstrated that isoflurane preconditioning-induced neuroprotection may involve increased expression of miR-203.²² Based on previous studies, we established isoflurane-induced rat nerve injury model and evaluated the rat’s neurological function.¹⁸ Experimental results demonstrated that isoflurane treatment caused learning and memory impairment in rats, implying that the rat nerve injury model induced by isoflurane was successfully established. Notably, it was found that miR-204-5p was upregulated by isoflurane treatment, demonstrated that miR-204-5p might be involved in the isoflurane-induced neurological impairment.

To further investigate the role of miR-204-5p in isoflurane-induced neurological function impairment, the level of miR-204-5p was regulated by transfection in vivo. It was found that miR-204-5p downregulation protected against isoflurane-induced neurological function impairment. Consistently, miR-204-5p has been reported to be involved in the mechanism of spatial learning and memory impairment caused by exposure to fluorine and aluminium during the embryonic stage, which was associated with the downregulation of the BDNF-TrkB pathway in the hippocampus.²⁴ Another study by Liu et al. recruited HT22 cells, and demonstrated that downregulation of miR-204-5p inhibited sevoflurane-induced neuron cell apoptosis and promoted cell proliferation.²⁵ Furthermore, inhibition of miR-204-5p alleviated sevoflurane-induced oxidative injuries in HT22 cells.²⁵ All evidence demonstrates the neuroprotective effect of miR-204-5p downregulation, which supported our present results. However, in the current study, the role of miR-204-5p in oxidative stress, neuron cell apoptosis, and autophagy was not investigated, which should be explored in future studies.

Accumulating evidence suggested that isoflurane-induced neuronal dysfunction and cognitive impairment were highly associated with neuroinflammation by elevating the expressions of pro-inflammatory cytokines.^11,26 As Cao et al. reported that suppressing HIF-1α protein expression attenuated the neuroinflammation in the hippocampus by disturbing NF-κB signaling pathway activity and decreasing TNF-1α after 4-h isoflurane exposure.¹¹ In our study, we detected the protein levels of IL-6, TNF-α, and IL-1β in the hippocampus. The results showed that the expression level of inflammatory cytokines in the isoflurane-induced rats was significantly higher than that in the control group, indicating that neuroinflammation has a potential role in isoflurane-induced nerve injury. miR-204-5p has been widely reported to be involved in several diseases’ progression through regulating inflammatory response, such as PD, atherosclerosis, and sepsis.^8,27,28 Therefore, we further explored the effect of miR-204-5p on the levels of inflammatory cytokines in isoflurane-treated rats. As expected, the downregulation of miR-204-5p significantly reversed the increase of IL-6, TNF-α and IL-1β protein levels induced by isoflurane. Herein, it is concluded that the neuroprotective effect of miR-204-5p antagomir on isoflurane-induced neurological impairment might be achieved through anti-inflammatory effects.

The EphB2 is a member of the membrane-bound Ephrin (Eph) family of receptor tyrosine kinases (RTKs).²⁹ It contains a hydrophobic transmembrane domain, a cytoplasmic kinase domain and an N-terminal branch involved in ligand binding.³⁰ EphB2 receptor is involved in synaptic development and maturation.³¹ Accumulating evidence has indicated that EphB2 plays an important role in neuropsychiatric diseases, such as Alzheimer’s disease,³² pain after peripheral nerve injury,³³ and anxiety.³¹ For instance, Dou et al. suggested that EphB2 plays a critical role in synaptic development, and its potent activation by NAP suggests that ADNP may mediate synaptic development partly by activating EphB2.³⁴ Zhang et al. demonstrated that EphB2 was a critical factor that contributes to the vulnerability to stress and might be a potential target for the treatment of depression.³⁵ Additionally, a recent study validated that age-associated increase in miR-204 level and age-related loss of EphB2 might contribute to cognitive deficits by accelerating this deterioration.³⁶ In this study, bioinformatics analysis predicted the 3’-UTR of EphB2 to be a potential binding site for miR-204-5p, and a dual-luciferase reporter was performed to further confirm, which was consistent with previous findings.³ Therefore, we deduced that downregulation of miR-204-5p might protect against isoflurane-induced learning and memory impairment via targeting EphB2. Consistently, in aged mice, EphB2 has been suggested to be essential for normal memory formation, which supported our hypothesis.³⁷ In future, further studies are needed to clarify the potential mechanism about the involvement of miR-204-5p in isoflurane-induced neurological impairment, and its potential role in neuron cell apoptosis, oxidative stress, and autophagy should also be examined.

Taken together, it is concluded that downregulation of miR-204-5p expression might play protective effects against isoflurane-induced learning and memory impairment via targeting EphB2 and inhibiting neuroinflammation. Therefore, miR-204-5p may serve as a potential therapeutic target for the treatment of cognitive dysfunction induced by isoflurane.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

H Liu

References

Lee

Feinbaum

Ambros

The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993; 75: 843–854.

Jerczynski

Lacroix-Pepin

Boilard

, et al. Role of dicer1-dependent factors in the paracrine regulation of epididymal gene expression. PLoS One 2016; 11: e0163876.

Duan

Chen

, et al. Mir-204 regulates cell proliferation and invasion by targeting EphB2 in human cervical cancer. Oncol Res 2018; 26: 713–723.

Jin

Gao

, et al. MiR-182-5p inhibits the proliferation of vascular smooth muscle cells induced by ox-LDL through targeting PAPPA. Int Heart J 2020; 61: 822–830.

Xie

Wang

Zhang

, et al. Neuroprotective effects of miR-142-5p downregulation against isoflurane-induced neurological impairment. Diagn Pathol 2020; 15: 1–8.

Liu

Yang

, et al. Astrocyte-derived exosome-transported microRNA-34c is neuroprotective against cerebral ischemia/reperfusion injury via TLR7 and the NF-KAPPAB/MAPK pathways. Brain Res Bull 2020. 163: 84–94.

Mead

Cullather

Nakaya

, et al. Viral delivery of multiple miRNAs promotes retinal ganglion cell survival and functional preservation after optic nerve crush injury. Exp Eye Res 2020; 197: 108071.

Zhou

Zhang

Guo

, et al. Long non-coding RNA NORAD functions as a microRNA-204-5p sponge to repress the progression of Parkinson’s disease in vitro by increasing the solute carrier family 5 member 3 expression. IUBMB Life 2020; 72: 2045–2055.

Yang

Liang

Khojasteh

, et al. Comparison of neurodegeneration and cognitive impairment in neonatal mice exposed to propofol or isoflurane. PLoS One 2014; 9: e99171.

10.

Sha

Zhao

Sha

, et al. Effects of vitamin B12 on postoperative cognitive dysfunction induced by isoflurane anesthesia in rats. Eur Rev Med Pharmacol Sci 2017; 21: 1959–1966.

11.

Cao

, et al. Isoflurane induced postoperative cognitive dysfunction is mediated by hypoxia inducible factor1alphadependent neuroinflammation in aged rats. Mol Med Rep 2018; 17: 7730–7736.

12.

Sun

Zheng

Yang

, et al. HDAC2 hyperexpression alters hippocampal neuronal transcription and microglial activity in neuroinflammation-induced cognitive dysfunction. J Neuro inflammation 2019; 16: 249.

13.

Bickler

Warren

Clark

, et al. Anesthetic protection of neurons injured by hypothermia and rewarming: roles of intracellular Ca2+ and excitotoxicity. Anesthesiology 2012; 117: 280–292.

14.

Bosnjak

Logan

Liu

, et al. Recent insights into molecular mechanisms of propofol-induced developmental neurotoxicity: implications for the protective strategies. Anesth Analg 2016; 123: 1286–1296.

15.

Sosunov

Ameer

Niatsetskaya

, et al. Isoflurane anesthesia initiated at the onset of reperfusion attenuates oxidative and hypoxic-ischemic brain injury. PLoS One 2015; 10: e0120456.

16.

Wang

Meng

Cao

, et al. Critical role of NLRP3-caspase-1 pathway in age-dependent isoflurane-induced microglial inflammatory response and cognitive impairment. J Neuroinflammation 2018; 15: 109.

17.

Zhou

Zhang

Xue

, et al. Isoflurane exposure regulates the cell viability and BDNF expression of astrocytes via upregulation of TREK1. Mol Med Rep 2017; 16: 7305–7314.

18.

Luan

Guan

, et al. Hydrogen sulfide attenuates isoflurane-induced neuro apoptosis and cognitive impairment in the developing rat brain. BMC Anesthesiol 2017; 17: 123.

19.

Wolf

Braden

Bimonte-Nelson

, et al. Broad-based nutritional supplementation in 3xTg mice corrects mitochondrial function and indicates sex-specificity in response to Alzheimer’s disease intervention. J Alzheimers Dis 2012; 32: 217–232.

20.

Jian

, et al. The Rho/Rho-associated protein kinase inhibitor fasudil in the protection of endothelial cells against advanced glycation end products through the nuclear factor KAPPAB pathway. Exp Ther Med 2013; 6: 310–316.

21.

Shang

Shen

, et al. Neuroprotection of miR-214 against isoflurane-induced neurotoxicity involves the PTEN/PI3K/Akt pathway in human neuroblastoma cell line SH-SY5Y. Arch Biochem Biophys 2019; 678: 108181.

22.

Cao

Feng

, et al. Contribution of microRNA-203 to the isoflurane preconditioning-induced neuroprotection. Brain Res Bull 2012; 88: 525–528.

23.

Chen

Shan

, et al. Vitexin improves neuron apoptosis and memory impairment induced by isoflurane via regulation of miR-409 expression. Adv Clin Exp Med 2020; 29: 135–145.

24.

Tan

Luo

, et al. MiR-132, miR-204 and BDNF-TrkB signaling pathway may be involved in spatial learning and memory impairment of the offspring rats caused by fluorine and aluminum exposure during the embryonic stage and into adulthood. Environ Toxicol Pharmacol 2018; 63: 60–68.

25.

Liu

Wang

Yan

, et al. MicroRNA-204-5p mediates sevoflurane-induced cytotoxicity in HT22 cells by targeting brain-derived neurotrophic factor. Histol Histopathol 2020; 35: 1353–1361.

26.

Fung

Vitiello

Alessi

, et al. Report and research agenda of the american geriatrics society and national institute on aging bedside-to-bench conference on sleep, circadian rhythms, and aging: new avenues for improving brain health, physical health, and functioning. J Am Geriatr Soc 2016; 64: e238–e247.

27.

Wang

Zhang

Wang

, et al. Cyanidin-3-O-glucoside attenuates endothelial cell dysfunction by modulating miR-204-5p/SIRT1-mediated inflammation and apoptosis. Biofactors 2020; 46: 803–812.

28.

Chen

Song

. LPS promotes the progression of sepsis by activation of lncRNA HULC/miR-204-5p/TRPM7 network in HUVECs. Biosci Rep 2020; 40. doi: 10.1042/BSR20200740.

29.

Chen

Rossi

Priddy

, et al. EphB2 activation is required for ependymoma development as well as inhibits differentiation and promotes proliferation of the transformed cell. Sci Rep 2015; 5: 9248.

30.

Liang

Wen

, et al. EphB2 contributes to human naive B-cell activation and is regulated by miR-185. FASEB J 2014; 28: 3609–3617.

31.

Zhang

Han

Chen

, et al. EphB2 in the medial prefrontal cortex regulates vulnerability to stress. Neuropsychopharmacology 2016; 41: 2541–2556.

32.

Wei

Jin

, et al. Overexpression of EphB2 in hippocampus rescues impaired NMDA receptors trafficking and cognitive dysfunction in Alzheimer model. Cell Death Dis 2017; 8: e2717.

33.

Chen

Zhou

, et al. Activation of EphB receptors contributes to primary sensory neuron excitability by facilitating Ca2+ influx directly or through SRC kinase-mediated N-methyl-D-aspartate receptor phosphorylation. Pain 2020; 161: 1584–1596.

34.

Dou

Lee

Charness

. Neuroprotective peptide NAPVSIPQ antagonizes ethanol inhibition of l1 adhesion by promoting the dissociation of L1 and ankyrin-G. Biol Psychiatry 2020; 87: 656–665.

35.

Zhang

Liu

, et al. Activation of EphB2 in the basolateral amygdala promotes stress vulnerability of mice by increasing NMDA-dependent synaptic function. Neuropharmacology 2020; 167: 107934.

36.

Mohammed

Rhee

PHEE

, et al. Mir-204 downregulates EphB2 in aging mouse hippocampal neurons. Aging Cell 2016; 15: 380–388.

37.

Alapin

Dines

Lamprecht

. EphB2 receptor forward signaling is needed for normal long-term memory formation in aged mice. Neurobiol Aging 2020; 86: 11–15.