Sage Journals: Discover world-class research

Abstract

Hepatocellular carcinoma is the second most common cause of cancer death in the world and its incidence has dramatically increased worldwide in the past two decades. Syringic acid (SA) has been studied for its hepatoprotective, anti-inflammatory, immunomodulatory, free radical scavenging, and antioxidant activities. We aimed to evaluate the cytotoxic effect of SA against human hepatoma HepG2 cell line. Cytotoxicity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. HepG2 cells were treated with SA at concentration ranges of 25, 50, and 100 µM for 24 h. Reactive oxygen species (ROS) expression was investigated by dichlorofluorescein staining assay. Morphological changes of SA-treated HepG2 cells were evaluated by acridine orange (AO) and ethidium bromide (EB) dual staining. Apoptotic marker gene expressions were evaluated by qPCR. SA treatment caused significant cytotoxicity and liberation of ROS in HepG2 cells. AO and EB staining showed membrane blebbing and distortion in SA-treated cells. Apoptotic markers such as caspases 3 and 9, cytochrome c, Apaf-1, Bax, and p53 gene expressions were significantly increased upon SA treatment indicating the possibility of apoptosis induction in HepG2 cells. This treatment also caused significant downregulation of Bcl-2 gene expression. SA has a cytotoxic effect on human HepG2 cell line, and this might be a promising agent in anticancer research.

Keywords

Syringic acid apoptosis cytotoxicity HepG2 hepatocellular carcinoma

Introduction

Hepatocellular carcinoma (HCC) is one of the leading cancers worldwide. Its incidence is increasing and is a major public health problem.¹ Recently, International Agency for Research on Cancer, a specialized cancer agency of the World Health Organization, has revealed that the HCC is now the second leading cause of mortality worldwide.² Major risk factors for HCC include chronic alcohol consumption, hepatitis B and C virus infections, nonalcoholic fatty liver diseases, aflatoxin B1–contaminated food, and so on.³ The most common treatment modalities for HCC in current practice are surgery, ablation, and liver transplantation.⁴ Sorafenib, a mitogen-activated protein kinase pathway inhibitor, is currently the only therapeutic agent approved for systemic use in HCC patients, albeit with several adverse effects such as hyperbilirubinemia, hand and foot skin reactions, and fatigue.⁵ Despite advances in HCC diagnosis and treatment, its incidence and mortality continue to rise. Therefore, effective treatment options with fewer or possibly no side effects are needed for patients with advanced HCC. The investigations of the efficacy of plant-based drugs have received growing attention due to their no or minimal side effects.⁶

Natural bioactive substances have been reported to modify the redox status and interfere with basic cellular functions such as cell cycle, apoptosis, inflammation, angiogenesis, invasion, and metastasis.⁶ Several studies have shown that plant-derived phytocompounds have a wide spectrum of biological activities including anti-inflammatory, antioxidant, antimutagenic, and anticancer properties.^7,8 Hence, in this study, we evaluated the cytotoxic effect of syringic acid (SA) in HepG2 human HCC cell line. SA, a known phenolic acid, is used in traditional Chinese medicine and is an emerging nutraceutical.⁹ Several in vivo studies have reported the promising effects of SA against liver diseases, inflammation, diabetes, neurological disorders, and so on.^10

–13 Cytotoxic effect of SA has been explored in lung, breast, and colorectal cancer cell lines with promising results.^12,14,15 However, studies regarding the anticancer potential of SA against human HCC HepG2 cells are not available. Hence, this study has been conducted with the objective to explore the above lacunae.

Materials and methods

Materials

SA (4-hydroxy-3,5-dimethoxybenzoic acid) was procured from Sigma Chemical Co., Chennai, India. Dulbecco’s minimum essential low glucose medium (DMEM), dimethyl sulfoxide (DMSO), penicillin, streptomycin, trypsin-EDTA, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and fetal bovine serum (FBS) were obtained from GIBCO BRL (Gaithersburg, Maryland, USA). Forward and reverse primers of β-actin, Bcl-2, Bax, cytochrome c, caspases 3 and 9, Apaf-1, and p53 were purchased from Shrimpex (Chennai, Tamil Nadu, India). All other chemicals were of analytical grade.

Cell cultures and treatment

The HepG2 human hepatocellular carcinoma cell line was procured from National Centre for Cell Science, Pune, Maharashtra, India with the passage number of 17. Cells were maintained in DMEM with low glucose supplemented with 10% FBS and penicillin (100 units/ml) and streptomycin (100 μg/ml). Cells were cultured in a humidified atmosphere with 5% CO₂ at 37°C and were grown in 25 cm² culture flasks and after a few passages, cells were seeded for experiments. The experiments were done at 70–80% confluence. Upon reaching confluence, cells were detached using 0.25% trypsin-EDTA solution.

SA was dissolved in 0.1% DMSO (v/v). HepG2 cells were plated at 10,000 cells/cm². After 24 h, cells were fed with fresh expansion culture medium supplemented with different final concentrations of SA (25, 50, and 100 µM) or the corresponding volumes of the vehicle. After 24 h of treatment, cells were collected by trypsin application. Total cell number was determined by counting each sample in triplicate under inverted microscope.

MTT assay

The cytotoxic evaluation of SA was done using the MTT assay.¹⁶ Cells were seeded in a 96-well plate at a concentration of 1 × 10⁴ cells/well. After 24 h, the medium was replaced with 100 µl of medium containing SA at different concentrations (25, 50, and 100 µM) and incubated for 24 h. At the end of the treatment period, media from control and SA-treated cells were discarded, and 50 μl of MTT with the final concentration of 0.5 mg/ml was added to each well. Cells were then incubated for 4 h at 37°C in CO₂ incubator. MTT was then discarded and the colored crystals of produced formazan were dissolved in 150 μl of DMSO. The purple-blue formazan formed was measured using an ELISA reader (Bio-Rad, Model 680, Hercules, California, USA) at 570 nm. The optical density of each sample was compared with control optical density, and graphs were plotted.

Dichloro-dihydro-fluorescein diacetate (DCFH-DA) assay

The formation of reactive oxygen species (ROS) was measured using DCFH-DA assay.¹⁷ The expression of intracellular ROS was estimated in the control and SA-treated HepG2 cells. Briefly, an aliquot of 8 × 10⁶ cells/ml was made up to a final volume of 2 ml in normal phosphate buffered saline (PBS, pH 7.4). Then 1 ml aliquot of cells was taken, to which 100 µl of DCFH-DA (10 μM) was added and incubated at 37°C for 30 min. The fluorescence intensity (excitation = 485 nm; emission = 535 nm) was measured using a PerkinElmer multimode reader, Waltham, Massachusetts, USA, and the photographs were obtained using a Nikon Eclipse Ti fluorescence microscope (Nikon Instruments Inc., NY, USA).

Acridine orange/ethidium bromide staining and fluorescent microscopy

Acridine orange/ethidium bromide (AO/EB) staining was carried out by the method of Gohel et al.¹⁸ HepG2 cells were plated at a density of 1 × 10⁴ per well in 48-well plates. They were allowed to grow at 37°C in a humidified CO₂ incubator until 70–80% confluent. Then cells were treated with SA for 24 h. After 24 h, the culture medium was aspirated from each well and cells were gently rinsed twice with PBS at room temperature. Then equal volumes of cells from control and SA treatments were mixed with 100 μl of dye mixture (1:1) and viewed immediately under the Nikon Eclipse Ti fluorescence microscope (Nikon Instruments Inc., NY, USA). Quantification of viable and dead cells, according to the percentage of fluorescence intensity of AO/EB staining, was performed via ImageJ software (NIH, Bethesda, Maryland, USA).

Apoptotic marker gene analysis

The HepG2 cells were cultured in six-well plates and exposed to 25, 50, and 100 µM of SA for 24 h. At the end of the exposure, total RNA was extracted by TRIzol reagent according to the standard protocol. Isolated RNA was quantified using a NanoDrop, and cDNA was synthesized using a commercial kit (high cDNA, Applied Biosystems, Foster City, CA). Quantitative real-time PCR was performed in ABI Prism™ 7700 sequence detection system (Applied Biosystems). Gene-specific primers for Bax, Bcl-2, cytochrome c, caspases 3 and 9, Apaf-1, and p53 were used. β-actin was used as housekeeping control (Table 1). The change in fluorescence of SYBR Green dye (invitrogen, Chennai, India) in every cycle was monitored, and the threshold cycle above background for each reaction was calculated. Results are expressed as fold change in gene expression with respect to the controls.¹⁹

Table 1.

Sequences of primers were used in this study.

Gene name	Sequence	Product size	Annealing temperature (°C)
p53	Forward: TGAAGCTCCCAGAATGCCAG	136	59
p53	Reverse: GCTGCCCTGGTAGGTTTTCT	136	59
Bax	Forward: TTGGACTGTGTTTTTCCTCCAT	158	58
Bax	Reverse: GATGCCGAAGTGTGTCCC	158	58
Bcl-2	Forward: AAGTTCTCTGCACAGGAAATTGG	153	59
Bcl-2	Reverse: GTGAAAGCAGGGCATACACAC	153	59
Cytochrome c	Forward: ATGGTCTCTTTGGGCGGAAG	142	59
Cytochrome c	Reverse: TCACACTCCTGATAGTTTGCCA	142	59
Apaf-1	Forward: AGTGGTAAAGATTCAGTTAGTGGAA	160	57
Apaf-1	Reverse: TGACCCATCCTGGTTCACCT	160	57
Caspase 9	Forward: ATGATCGAGGACATCCAGCG	130	59
Caspase 9	Reverse: GGCCTGTGTCCTCTAAGCAG	130	59
Caspase 3	Forward: AGCGAATCAATGGACTCTGGA	159	59
Caspase 3	Reverse: TTCCCTGAGGTTTGCTGCAT	159	59
β-actin	Forward: TGTGTTGGCGTACAGGTCTTTG	198	59
β-actin	Reverse: GGGAAATCGTGCGTGACATTAAG	198	59

Statistical analysis

Data were expressed as mean ± SEM and analyzed by one-way ANOVA following Dunnett’s test to determine the significant differences between groups. A p value lower than 0.05, 0.01, or/and 0.001 was considered to be significant.

Results

Cytotoxic effect of SA in HepG2 cells

The effect of SA on the cell growth was assessed at different concentrations on the HepG2 cell line. The HepG2 cells showed typical cancer cell morphology and were exposed to different concentrations of SA as presented in Figure 1(a). SA at 25, 50, and 100 µM treatments exhibited significant (p < 0.001) dose-dependent cytotoxicity in HepG2 cells. At a concentration of 100 µM after 24 h of treatment with SA, remarkable inhibitory effect (>80%) on the HepG2 cell growth was observed compared to untreated control cells (Figure 1(b)).

Figure 1.

Effect of SA treatment on HepG2 cells morphology (a), cell death (b). Cells were incubated with vehicle or SA at 25, 50, and 100 µM/L for 24 h. Data were presented as mean ± SEM of three individual experiments with n = 3. ***p < 0.001 versus control. SA: syringic acid; SEM: standard error of the mean.

Investigation of intracellular ROS generation

We supposed that cytotoxic effect of SA was largely mediated by ROS generation. Therefore, the mechanistic aspects of the cellular damage were examined by DCFH-DA assay in HepG2 cells for any generation of ROS upon SA treatments. Interestingly, SA treatment significantly increased intracellular ROS generation in a concentration-dependent manner (Figure 2(a)). The number of ROS-generated cell population was significantly (p < 0.001) increased in the experimental group when compared to untreated cells (Figure 2(b)). These data show that SA could induce the generation and accumulation of ROS in HepG2 cells.

Figure 2.

ROS inducing potentials of SA in HepG2 cells. Microscopic images showing enhanced fluorescence indicate the ROS generation in SA-treated groups (a). Graph showing amount of ROS generation and the percentage of fluorescence intensity measured using multimode reader (b). Values are presented as mean ± SEM, n = 3. ***p < 0.001 versus control. SA: syringic acid; ROS: reactive oxygen species; SEM: standard error of the mean.

SA-induced apoptotic-related membrane damage

In order to evaluate whether ROS induced changes in membrane integrity and DNA damage, we performed dual staining with AO/EB. AO is a vital dye and will stain both live and dead cells, and EB will stain only cells that have lost membrane integrity. Live cells will appear uniformly green. Early apoptotic cells will stain green and contain bright green dots in the nuclei as a consequence of chromatin condensation and nuclear fragmentation. Late apoptotic cells will also incorporate EB and therefore stain orange. In the present study, SA treatments for 24 h caused significant alterations in the morphology of HepG2 cells. Early apoptotic cells with marked yellow-green AO nuclear staining were detected in the experimental group treated with the low concentration of SA treatment (25 µM), while late apoptotic cells localized with red nuclear EB staining were detected in all the experimental groups except control (Figure 3(a)). Compared with control (4.00 ± 0.76%), 24 h of SA treatments at 25, 50, and 100 µM concentration in HepG2 cells resulted in 45.67 ± 3.53% (p < 0.001), 57.50 ± 1.73% (p < 0.001), and 75.17 ± 1.76% (p < 0.001) apoptotic cells, respectively (Figure 3(b)).

Figure 3.

Representative images of SA-treated HepG2 cells stained with ethidium bromide and acridine orange staining. White and yellow arrows indicate the early and late apoptotic cells (a) quantification of apoptotic cells (b). Values are expressed as mean ± SEM (n = 3). Apoptotic cells were individually calculated as percentage of apoptotic cells relative to the total number of cells in each random field and represented the average of three independent experiments. ***p < 0.001 versus control. SA: syringic acid; SEM: standard error of the mean.

SA-induced changes in apoptotic marker gene expressions

Further, to delineate the exact molecular mechanism behind the SA-induced apoptotic changes, we investigated the apoptotic marker gene expressions related to the intrinsic mitochondrial apoptotic pathway. In this study, p53 a tumor suppressor gene expression was significantly increased only in 50 (p < 0.01) and 100 µM (p < 0.001) of SA-treated HepG2 cells. In lower concentration, SA treatment in HepG2 cells did not show any significant change in p53 gene expression (Figure 4(a)).

Figure 4.

Relative mRNA expressions of apoptotic marker genes. Values are expressed as mean ± SEM (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001. SEM: standard error of the mean.

Anti- and proapoptotic genes such as Bcl-2/Bax play an important role in regulating caspase-mediated apoptosis by the mitochondrial pathway and therefore, we analyzed Bcl-2/Bax gene expressions. A significant downregulation of Bcl-2 (p < 0.001) expression (Figure 4(b)) with concomitant and concentration-dependent, that is, 50 (p < 0.01) and 100 µM (p < 0.001) upregulation of Bax was observed in SA-treated HepG2 cells (Figure 4(c)).

Activation of caspases is a key event during apoptosis caused by various toxic agents. To confirm whether caspases are involved in apoptosis, we measured the caspases 9 and 3 gene expressions. In order to confirm the apoptosis is mediated through the intrinsic pathway, we analyzed the cytochrome c release and its downstream targets in the cytoplasm, that is, Apaf-1, caspases 9 and 3. The gene expressions of cytochrome c, Apaf-1, caspases 9 and 3 were significantly increased upon SA treatment in HepG2 cells (Figure 4(d) to (g)).

Discussion

SA has been in use as treatment for multifarious liver diseases and was proven to have a protective action against several drug- and chemical-induced hepatotoxicity in experimental animals.^20,21 In previous studies, SA has also shown cytotoxicity against human A549 lung, colorectal and T47D human breast cancer cell lines.^12,14,15 Pertaining to the liver, Zhang et al.²² have reported the antiproliferative activity of proso millet (reported to contain SA) against HepG2 cell line. The studies have shown IC₅₀ values of SA < 10⁻¹² M versus T47D breast, 479 × 10⁻⁸ to 605 × 10⁻⁸ M versus colorectal and 30 µM versus A549 lung cancer cell lines.^12,14,21 Breast cancer cell line exhibited higher sensitivity to SA compared to colorectal and lung cancer cell lines. In this study, SA potently inhibited the growth of HepG2 cells with the IC₅₀ of 40.54 µM. This might be due to the endogenous ROS accumulation which may inhibit cell growth via cytotoxicity.^23,24 The SA-like phenolic acids such as ferulic and caffeic acids have been shown to induce cytotoxicity via ROS accumulation in cancer cell lines.^25,26 This established pathogenetic mechanism might be the cause of the cytotoxic potential of SA observed in this study.

Accumulating evidence has suggested that excessive intracellular ROS generation may directly cause oxidative stress–induced morphological changes.^23,24,27,28 Therefore, we further explored the changes in the cell nuclei by AO/EB double fluorescent staining. The HepG2 cells treated with SA showed changes in the number of stained cells undergoing apoptosis indicating that SA may induce apoptosis. Further, intracellular ROS accumulation in HepG2 cells is recognized as one of the major causes of cancer cell apoptosis.^23,24 It could be inferred from the above studies that SA treatments could cause ROS-mediated apoptosis-related morphological changes in HepG2 cells.

The mitochondrial pathway is important for induction of apoptosis by chemotherapeutic agents.²⁹ p53 is a tumor suppressor gene and major orchestrator of the cellular response to a variety of stress types by regulating apoptosis, cell cycle arrest, senescence, DNA repair, and genetic stability.³⁰ p53 is activated in instances of DNA damage or when cells undergo stress, is translocated to the nucleus, induces proapoptotic gene expression (Bax), acts on the mitochondrial membrane, activates the effector caspases, and accelerates cell death.³¹ Induction of p53 gene expression has been shown to induce apoptosis via proapoptotic Bax gene expression and downregulation of antiapoptotic Bcl-2 gene expression in various cancer cells.^32,33 Further, p53 also induces apoptosis by caspase 9 activation via the release of mitochondrial cytochrome c. The activated caspase 9 in turn activates caspase 3 and is responsible for the degradation of many intracellular proteins resulting in the morphological and biochemical changes of apoptosis.³⁴ ROS plays a significant role in the mitochondrial membrane damage, thereby triggering a series of mitochondria-associated events including apoptosis. The apoptotic signal or any proapoptotic factors especially ROS directly act on mitochondria or through p53 and reduce the mitochondrial membrane potential (MMP) that is responsible for the release of cytochrome c from mitochondria into the cytosol.²⁹ Cytochrome c in the cytosol participates in the activation of caspase 9, which in turn activates executioner caspase 3 to induce cell apoptosis.^35

–37 Our gene expression analysis suggests that SA induces the mitochondrial pathway of apoptosis in HepG2 cells. SA promotes the gene expressions of p53, Bax and downregulates the expression of Bcl-2, which leads to loss of MMP and results in cytochrome c release from mitochondria and activation of Apaf-1, caspases 9 and 3 leading to apoptosis (Figure 5).

Figure 5.

Probable cytotoxic mechanism of syringic acid in HepG2 cells. ROS: reactive oxygen species.

In conclusion, the present study demonstrated that SA has the ability to induce cytotoxicity in HepG2 cells by apoptosis via mitochondrial pathway involving p53, Bax, Bcl-2, cytochrome c, Apaf-1, caspases 3 and 9. However, the complete signaling pathway of apoptosis still requires further exploration. The outcome of this study could improve our understanding of the molecular mechanism of SA-induced apoptosis in HepG2 cells. Collectively, these findings provide important clues for further evaluating SA as a potential anticancer agent.

Supplemental material

Supplemental Material, dual_staining_Suppl - Syringic acid triggers reactive oxygen species–mediated cytotoxicity in HepG2 cells

Supplemental Material, dual_staining_Suppl for Syringic acid triggers reactive oxygen species–mediated cytotoxicity in HepG2 cells by S Gheena and D Ezhilarasan in Human & Experimental Toxicology

Supplemental material

Supplemental Material, ROS_SUPPL.pptx1 - Syringic acid triggers reactive oxygen species–mediated cytotoxicity in HepG2 cells

Supplemental Material, ROS_SUPPL.pptx1 for Syringic acid triggers reactive oxygen species–mediated cytotoxicity in HepG2 cells by S Gheena and D Ezhilarasan in Human & Experimental Toxicology

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

D Ezhilarasan

Supplemental material

Supplemental material for this article is available online.

References

Hartke

Johnson

Ghabril

. The diagnosis and treatment of hepatocellular carcinoma. Semin Diagn Pathol 2017; 34: 153–159.

World Cancer Report 2014. http://livercancerconnect.org. (accessed 24 February 2018).

Sanyal

Yoon

Lencioni

. The etiology of hepatocellular carcinoma and consequences for treatment. Oncologist 2010; 15(Suppl 4): 14–22.

Mauer

O’Kelley

Podda

. New treatment modalities for hepatocellular cancer. Curr Gastroenterol Rep 2015; 17: 442.

Iavarone

Cabibbo

Biolato

. Predictors of survival in patients with advanced hepatocellular carcinoma who permanently discontinued sorafenib. Hepatology 2015; 62: 784–791.

Induja

Ezhilarasan

Ashok Vardhan

. Evolvulus alsinoides methanolic extract triggers apoptosis in HepG2 cells. Avicenna J Phytomed 2018; 8(6): 504–512.

Espín

García-Conesa

Tomás-Barberán

. Nutraceuticals: facts and fiction. Phytochemistry 2007; 68: 2986–3008.

Miyata

. Pharmacological basis of traditional medicines and health supplements as curatives. J Pharmacol Sci 2007; 103: 127–131.

Thipparaboina

Mittapalli

Thatikonda

. Syringic acid: structural elucidation and co-crystallization. Cryst Growth Des 2016; 16: 4679−4687.

10.

Güven

Aras

Topaloğlu

. The protective effect of syringic acid on ischemia injury in rat brain. Turk J Med Sci 2015; 45: 233–240.

11.

Ham

Lee

Choi

. Anti-steatotic and anti-inflammatory roles of syringic acid in high-fat diet-induced obese mice. Food Funct 2016; 7: 689–697.

12.

Abaza

Al-Attiyah

Bhardwaj

. Syringic acid from Tamarix aucheriana possesses antimitogenic and chemo-sensitizing activities in human colorectal cancer cells. Pharm Biol 2013; 51: 1110–1124.

13.

Srinivasan

Muthukumaran

Muruganathan

. Antihyperglycemic effect of syringic acid on attenuating the key enzymes of carbohydrate metabolism in experimental diabetic rats. Biomed Prev Nutr 2014; 4: 595–602.

14.

Karthik

Vijayakumar

Natarajapillai

. Preliminary study on salubrious effect of syringic acid on apoptosis in human lung carcinoma A549 cells and Insilico analysis through docking studies. Asian J Pharm Clin Res 2014; 7: 46–49.

15.

Kampa

Alexaki

Notas

. Antiproliferative and apoptotic effects of selective phenolic acids on T47D human breast cancer cells: potential mechanisms of action. Breast Cancer Res 2004; 6(2): R63–R74.

16.

Safadi

Smock

. Expression of connective tissue growth factor in bone: its role in osteoblast proliferation and differentiation in vitro and bone formation in vivo. J Cell Physiol 2003; 196: 51–62.

17.

Akimoto

Iizuka

Kanematsu

. Anticancer effect of ginger extract against pancreatic cancer cells mainly through reactive oxygen species-mediated autotic cell death. PLoS One 2015; 10: e0126605.

18.

Gohel

McCarthy

Gronowicz

. Estrogen prevents glucocorticoid-induced apoptosis in osteoblasts in vivo and in vitro. Endocrinology 1999; 140: 5339–5347.

19.

Bonetta

. Prime time for real-time PCR. Nat Methods 2005; 2: 305–311.

20.

Itoh

Isoda

Kondoh

. Hepatoprotective effect of syringic acid and vanillic acid on CCl₄-induced liver injury. Biol Pharm Bull 2010; 33: 983–987.

21.

Ramachandran

Raja

. Protective effects of syringic acid against acetaminophen-induced hepatic damage in albino rats. J Basic Clin Physiol Pharmacol 2010; 21: 369–385.

22.

Zhang

Liu

Niu

. Phytochemical and antiproliferative activity of proso millet. PLoS One 2014; 9: e104058.

23.

Ezhilarasan

. Herbal therapy for cancer. In: Shanmugam

(ed) Understanding cancer therapies. Boca Raton: CRC Press, 2018. pp. 129–166.

24.

Cao

Liu

Jia

. Curcumin induces apoptosis through mitochondrial hyperpolarization and mtDNA damage in human hepatoma G2 cells. Free Radic Biol Med 2007; 43: 968–975.

25.

Rajendra

Karthikeyan

. Inhibitory effect of caffeic acid on cancer cell proliferation by oxidative mechanism in human HT-1080 fibrosarcoma cell line. Mol Cell Biochem 2011; 349(1-2): 11.

26.

Fong

Tang

. Inhibitory effect of trans-ferulic acid on proliferation and migration of human lung cancer cells accompanied with increased endogenous reactive oxygen species and β-catenin instability. Chin Med 2016; 11: 45.

27.

Yang

Zhong

Jiang

. Genotoxic effect of 6-gingerol on human hepatoma G2 cells. Chem Biol Interact 2010; 185: 12–17.

28.

Liu

. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res 2015; 21: 15–20.

29.

Curčić

Stanković

Mrkalić

. Antiproliferative and pro-apoptotic activities of methanolic extracts from Ligustrum vulgare L. as an individual treatment and in combination with palladium complex. Int J Mol Sci 2012; 13: 2521–2534.

30.

Ezhilarasan

Evraerts

Sid

. Silibinin induces hepatic stellate cell cycle arrest via enhancing p53/p27 and inhibiting Akt downstream signaling protein expression. Hepatobiliary Pancreat Dis Int 2017; 16(1): 80–87.

31.

Amaral

Xavier

Steer

. The role of p53 in apoptosis. Discov Med 2010; 9(45): 145–152.

32.

Gudkov

Komarova

. p53 and the carcinogenicity of chronic inflammation. Cold Spring Harb Perspect Med 2016; 6: pii: a026161.

33.

Chen

Fang

Zhang

. Blockage of glyoxalase I inhibits colorectal tumorigenesis and tumor growth via upregulation of STAT1, p53, and Bax and downregulation of c-Myc and Bcl-2. Int J Mol Sci 2017; 18(3): pii: E570.

34.

Mohamed

Abdelhamid

Almutairi

. Induction of apoptosis by pyrazolo[3,4-d]pyridazine derivative in lung cancer cells via disruption of Bcl-2/Bax expression balance. Bioorg Med Chem 2018; 26(3): 623–629.

35.

Ali

Yeap

Abu

. Synthetic curcumin derivative DK1 possessed G2/M arrest and induced apoptosis through accumulation of intracellular ROS in MCF-7 breast cancer cells. Cancer Cell Int 2017; 17: 30.

36.

Lakshmi

Ezhilarasan

Nagaich

. Acacia catechu ethanolic seed extract triggers apoptosis of SCC-25 cells. Pharmacogn Mag 2017; 13: S405–S411.

37.

Lakshmi

Ezhilarasan

Vijayaragavan

. Acacia catechu ethanolic bark extract induces apoptosis in human oral squamous carcinoma cells. J Adv Pharm Technol Res 2017; 8: 143–149.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.24 MB

0.77 MB