Sage Journals: Discover world-class research

Abstract

Aim:

Concerns about the possible toxicity to environment and human health of titanium dioxide nanoparticles (TiO₂ NPs) are increasing. The aim of this study was to investigate the relationship between toxicology and autophage in vitro.

Methods:

RAW 264.7 cells were exposed to five concentrations (50, 100, 200, 300, and 400 μg/mL) and two particle size of TiO₂ NPs (30 and 100 nm) for 24 h.

Results:

The results showed that TiO₂ NPs decreased cell viability, phagocytic rate, and phagocytic index in a concentration-dependent manner, thereby inducing autophagy. TiO₂ NPs-induced autophagy was indicated by monodansyl cadaverine staining and transmission electron microscopy. TiO₂ NPs-induced messenger RNA expression of autophagy-related proteins LC3 and Beclin-1 was also significantly increased compared with those of the unexposed control cells. LC3 and Beclin-1 protein expression levels were markedly increased with the increase of TiO₂ NPs concentrations.

Conclusion:

These results suggest the possibility that TiO₂ NPs-induced toxicology probably plays a key role in autophagy in RAW 264.7 cells, and further exhaustive research on the harmful effects of these NPs in relevant organisms is needed for their safe application.

Keywords

Nanosized titanium dioxide cell damage autophage murine macrophage cells cytotoxicity

Introduction

Nanomaterials are engineered structures with at least one dimension of 100 nm or less.¹ There has been an enormous growth in the application of titanium dioxide nanoparticles (TiO₂ NPs) for photocatalyst,² cosmetics,³ sterilization, pharmaceuticals, food colorants,^4
–6 and recently biomaterials.^7,8 Therefore, potential widespread exposure may occur during both manufacturing and using. However, with the increasing application of TiO₂ NPs, possible toxicity to environment and human has to be addressed. TiO₂ has been classified by the International Agency for Research on Cancer (IARC) as an IARC Group 2B carcinogen.⁹ The toxic effects of TiO₂ NPs are due to their distinct properties, greater specific surface area, and smaller size with high number per given mass which can cause their higher chemical reactivity, penetrate in the living cells, and increase production of reactive oxygen species (ROS).¹⁰

Lungs are the main target organ of NPs. Studies suggested that TiO₂ NPs could cause pulmonary inflammation and cancer in rats and mice.^11,12 A number of studies reported that TiO₂ NPs can induce oxidative stress and DNA damage.^13,14 Moreover, owing to the generation of ROS, the anatase TiO₂ NPs could induce mitochondrial injury in A549 cells.¹⁵ In human and rat alveolar macrophages, the level of ROS was increased after exposure to nanosized TiO₂.¹⁶ A significant decrease in the level of glutathione was observed in rat alveolar macrophage following exposure to ultrafine TiO₂.¹⁷ Potential multiple effects of TiO₂ NPs and the possible adverse effects of TiO₂ NPs exposure need further clarification.

Both autophagy and apoptosis are programmed cell death, and the two are closely related.¹⁸ The occurrence of autophagy is associated with oxidative stress, and TiO₂ NPs can cause cell oxidative stress. However, there have been very few reports on the role of autophagy in the damage caused by TiO₂ NPs. This work aims to explore the mechanism of TiO₂ NP-related autophagy by employing murine macrophage cell line RAW 264.7.

Materials and methods

Characterization of TiO₂ NPs

Pure rutile TiO₂ NPs at 30 and 100 nm in diameter were purchased from Hangzhou Wan Jing New Material Co., Ltd (Hangzhou, China). The structure and morphology of the TiO₂ NPs were characterized by scanning electron microscopy (SEM) with an accelerating voltage of 20 kV. The X-ray diffraction (XRD) measurement was conducted using a Rigaku D/max 2550 PC diffractometer (Rigaku Inc., Tokyo, Japan) to confirm the crystal structure of the TiO₂ NPs.

TiO₂ particles were sterilized by heating to 120°C for 2 h and then were suspended in sterilized phosphate-buffered saline (PBS) at 5 mg/mL and sonicated for 30 min. After sonication, to prepare the end point concentrations, Dulbecco’s modified Eagle’s medium (DMEM)-F12 medium (Hyclone, GA, USA) was transferred to test tubes and diluted with the TiO₂ NP stock solution.

Cell culture and viability assay

The murine macrophage cell line RAW 264.7 was obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). The cells were incubated in high glucose DMEM supplemented with 10% fetal bovine serum (Hyclone, GA, USA), 100 U/mL penicillin–streptomycin in a humidified atmosphere of 5% carbon dioxide (CO₂) at 37°C. The cell viability was measured by MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay at 6, 12, 18, and 24 h.¹⁹ The exponentially growing cells (about 5 × 10⁴ cells/well) were seeded into 96-well culture plates and incubated with various concentrations of nano-TiO₂ (50, 100, 200, 300, and 400 μg/mL) for 24 h. The supernatants were substituted with 90 μl fresh medium and 10 μl of MTT (1 mg/mL) solution. After 4 h of incubation at 37°C, the medium was aspirated and the formazan crystals were solubilized in 200 μl dimethyl sulfoxide. The optical density was measured spectrophotometrically (Bio-Rad 840, Hercules, California, USA) at 570 nm. Assays were performed in triplicate. The relative cell viability (%) related to control wells containing cells without NPs was calculated by [A]exposure/[A]control × 100, where [A]exposure is the absorbance of the treated sample and [A]control is the absorbance of the control sample.

Phagocytosis assays

Cultures of RAW 264.7 cells at a concentration of 3 × 10⁵ cells/mL were seeded into 6-well plates and treated or not treated with various concentrations (50, 100, 200, 300, and 400 µg/mL) of nano-TiO₂, then incubated at 37°C with an atmosphere of 5% CO₂. At the end of 24 h of incubation, the adherent cell monolayer was washed with PBS, and sorted fluorescent microsphere was added. After 2 h of incubation in dark place, the plate was washed 5× with PBS and fixed with 4% paraformaldehyde. Fluorescent phagocytosis was observed by confocal microscopy (TCSSP2; Leica Microsystems, Wetzlar, Germany) to acquire the phagocytic rate (% of macrophages containing at least one fluorescent microsphere) and the phagocytic index (the mean number of phagocytosed fluorescent microsphere).

TEM analysis of cellular organelles

The TiO₂ NP-treated cells were fixed in 2.5% glutaraldehyde with 1% osmium tetroxide (OsO₄) buffer at 4°C for 6 h. The fixed cells were dehydrated in serially diluted ethanol (30, 50, 70, 80, 90, and 100%). After dehydration, the samples were infiltrated with a 1:1 mixture of propylene oxide and epon at 70°C overnight. Ultrathin sections (about 50 mm) were sliced, mounted on a copper grid, stained with uranyl acetate and lead citrate, and monitored using a JEM 1010 Transmission electron microscope (TEM; JEOL, Tokyo, Japan).

Detection of autophagic vacuoles by staining of cells with MDC

The development of autophagic vacuoles was studied at five concentrations (50, 100, 200, 300, and 400 µg/mL) by staining cells with 50 μmol/L monodansyl cadaverine (MDC). Treated cells were washed with PBS (pH 7.2) to remove the culture medium. Then, cells were incubated with 50 μmol/L MDC in PBS at 37°C for 30 min and were washed four times with PBS again, observed by fluorescence microscopy immediately (excitation wavelength = 338 nm; emission wavelength = 500 nm).

Quantitative analysis of MAP-LC3 and Beclin-1 expression

RAW 264.7 cells were exposed to 50, 100, 200, 300, and 400 µg/mL of nano-TiO₂ suspension for 24 h. Then, RNA was extracted from cells using MiniBEST Universal RNA Extraction Kit (Takara, Kyoto, Japan). For each sample, RNA (100 ng) was reverse-transcribed using Prime Script TMRT reagent Kit with gDNA Eraser (Code no. RR047A, Takara), according to the manufacturer’s instructions. β-Actin (control) was used as normalization for total messenger RNA (mRNA) input and to confirm efficiency of complementary DNA (cDNA) synthesis. A relative quantitative real-time polymerase chain reaction analysis was performed on aliquots of the cDNA production, using SYBR Premix EX Taq™ II (Code no. RR820A, Takara) in the Bio-Rad-IQ5 Multicolor Real-time Detection System, following the manufacturer’s instructions. The primers were designed on the basis of published mRNA sequences of MAP1-LC3, Beclin-1, and β-actin. The primers were purchased from Sangon Biotech (Shanghai, China) (Table 1).

Table 1.

RT-PCR primers used in the gene expression analysis.

Gene name	Primer sequence
β-Actin	CATCCGTAAAGACCTCTATGCCAAC (sense)
β-Actin	ATGGAGCCACCGATCCACA (antisense)
Map1LC3B	GCTCATCAAGATAATCAGACG (sense)
Map1LC3B	CTCTCACTCTCGTACACTTC (antisense)
Beclin-1	TGTGGAGTGGAATGAAATCA (sense)
Beclin-1	AGAACAGTATAACGGCAACT (antisense)

MAP-LC3 and Beclin-1 protein expression

Incubated cells at various concentrations (50, 100, 200, 300, and 400 µg/mL) of nano-TiO₂ for 24 h were harvested for repeated freezing and thawing. The expression of MAP-LC3 and Beclin-1 was detected by an enzyme-linked immunosorbent assay (ELISA) kit (Andygene, Richardson). The absorbance was read at 450 nm using a microtiter plate reader (Bio-Rad). The levels of MAP-LC3 and Beclin-1 were calculated with reference to standard curves prepared with purified MAP-LC3 and Beclin-1.

Statistical analysis

Data were analyzed with SPSS 17.0 for Windows (SPSS Inc., Chicago, IL, USA). Statistical analyses were performed by either one-way analysis of variance or Student’s t-test when applicable to evaluate differences between the control and the test sample. Each experiment was repeated at least three times. Significance level was set at p < 0.05, unless otherwise mentioned.

Results

Characterization of TiO₂ NPs

Rutile NPs displayed a typical rod-like crystal structure. TiO₂ NPs rutile at 30 nm in diameter displayed a size approximately between 30 nm and 50 nm. TiO₂ NPs rutile at 100 nm in diameter displayed a size approximately between 50 nm and 100 nm in SEM analysis (Figure 1). In addition, the XRD pattern showed that the TiO₂ NPs contained a pure rutile form (Figure 2). No significant difference was observed with the manufacturer’s specifications and previous reports on the characterization of the shape of the NPs.²⁰

Figure 1.

SEM image of TiO₂ NPs shape and size: (a) 30 nm particle size and (b) 100 nm particle size. SEM: scanning electron microscopy; TiO₂ NPs: titanium dioxide nanoparticles.

Figure 2.

XRD data of titanium dioxide nanoparticles (TiO₂ NPs). XRD data of rutile form of TiO₂ NPs.XRD: X-ray diffraction; TiO₂ NPs: titanium dioxide nanoparticles. (a): 30nm; (b): 100nm.

Effects of TiO₂ NPs on RAW 264.7 cells viability and phagocytosis function

Cell viability has been inhibited strongly in a dose- and time-dependent manner with 30 nm or 100 nm TiO₂ NPs (Figure 3(a) and (b)). Cell viability was significantly decreased (p < 0.05), with decreases of 61.8% and 55.26% for TiO₂ rutile at 30 nm in diameter and TiO₂ rutile at 100 nm in diameter in the treatment concentration of 400 µg/mL, respectively, when compared with the control. TiO₂ NPs at 30 nm in diameter treatments at 50, 100, 200, 300, and 400 µg/mL for 24 h was selected to conduct the subsequent experiments.

Figure 3.

Cell viability monitored by the MTT assay following 6, 12, 18, and 24 h exposure of TiO₂ NPs at different concentrations (50, 100, 200, 300, and 400 μg/mL). Data are shown as % viability compared with the untreated control and are presented as means ± SD of three separate experiments. *p < 0.05: vs. control. (a) 30 nm TiO₂ NPs and (b) 100 nm TiO₂ NPs. TiO₂ NPs: titanium dioxide nanoparticles.

Both 30 and 100 nm TiO₂ NPs significantly decreased the phagocytic rate and phagocytic index compared with the control group (Table 2; p < 0.05) in a dose-dependent manner.

Table 2.

The results of phagocytic ability in RAW264.7 cells after 24 h of exposure to PM_2.5.^a

Concentration (µg/mL)	Phagocytic rate(%)		Phagocytic index(%)
Concentration (µg/mL)	30 nm	100 nm	30 nm	100 nm
0	59.33 ± 2.51	59.33 ± 2.51	155.33 ± 3.51	155.33 ± 3.51
50	36.67 ± 2.08^b	53.66 ± 3.05^c	60.33 ± 1.53^b	101.67 ± 3.05
100	38.33 ± 1.53^b	45.33 ± 2.51^c	47.33 ± 3.51^b	81.67 ± 3.79^c
200	35.67 ± 1.15^b	46.67 ± 2.08^c	43.67 ± 3.05^b	78.33 ± 1.53^c
300	34.00 ± 1.00^b	40.00 ± 1.00^c	47.67 ± 2.08^b	53.33 ± 1.53^c
400	33.33 ± 2.08^b	30.33 ± 1.53^b	46.33 ± 2.51^b	51.33 ± 2.51^c

PM: particulate matter with diameter <2.5 µm; SEM: standard error of mean.

^a Data represent the means ± SEM from three separate experiments.

^bp < 0.05: treatments significantly different from the untreated control are presented.

^cp < 0.01: treatments significantly different from the untreated control are presented.

TiO₂ NPs induce autophagy in murine macrophage cells

To determine whether autophagy was induced in TiO₂ NP-treated cells, the morphology of RAW 264.7 cells treated with or without TiO₂ NPs by TEM was observed. Untreated cells showed normal cytoplasm, organelles, and nucleus shape (Figure 4). The exposure of cells to 400 µg/mL TiO₂ NPs for 24 h resulted in the appearance of autophagocytic vacuoles containing extensively degraded cellular material or membranous structures. TiO₂ NPs-treated cells exhibited more MDC-labeled particles compared with untreated cells (Figure 5). The results demonstrated that the TiO₂ NPs induce autophage in murine macrophage cells.

Figure 4.

TEM images of autophagosomes in RAW 264.7 cells. Ultrastructure confirms autophagic vacuole (white arrow) generation in RAW 264.7 cells. Magnification of ultra-micrograph has been mentioned in each corresponding figure. (a and b) untreated RAW 264.7 cells. (c to f 264.7 cells treated with 100 μg/mL 30 nm TiO₂ NPs for 24 h. TEM: transmission electron microscope; TiO₂ NPs: titanium dioxide nanoparticles.

Figure 5.

Identification of autophagic vacuoles using MDC staining. RAW 264.7 cells were stained with MDC (0.05 mM) which specifically stains autophagic vacuoles, confirms autophagic vacuolation at 24 h of exposure to 30 nm TiO₂ NPs. (a) Control cells. (b) cells exposed to 100 μg/mL 30 nm TiO₂ NPs for 24 h. MDC: monodansyl cadaverine; TiO₂ NPs: titanium dioxide nanoparticles.

Increased expression of autophagic markers Beclin-1 and MAP-LC3 in RAW 264.7 cells

The expression levels of Beclin-1 and MAP-LC3 mRNA in exposed cells and unexposed cells are shown in Figure 6. The mRNA expression levels of MAP-LC3 were rising gradually with the increase of concentration. However, there was significance only in 300 and 400 µg/mL concentrations of TiO₂ NPs (p < 0.05) (Figure 6(a)). Beclin-1 mRNA in cells exposed to 100, 200, 300, and 400 µg/mL concentrations of TiO₂ NPs was significantly higher than in unexposed cells (p < 0.05) (Figure 6(b)).

Figure 6.

The mRNA expression of autophagy-related genes. Cell lysates were used to perform real-time polymerase chain reaction experiments and evaluate the mRNA expression levels of (a) MAP-LC3 and (b) Beclin-1 after 24 h exposure to TiO₂ NPs at the concentration of 50, 100, 200, 300, and 400 µg/mL. Data are means ± SD of five independent experiments. *p < 0.05: vs. control. mRNA: messenger RNA; TiO₂ NPs: titanium dioxide nanoparticles; SD: standard deviation

In the study on concentration-dependent effects, all of the doses but 50 µg/mL were significantly enhanced in MAP-LC3 production (Figure 7(a)). In the experiment of Beclin-1 expression, lower doses were not significantly enhanced. However, 200, 300, and 400 µg/mL concentrations were increased significantly (Figure 7(b)).

Figure 7.

The protein levels of (a) MAP-LC3 and (b) Beclin-1 in RAW264.7 cells after exposed to TiO₂ NPs for 24 h at the concentration of 50, 100, 200, 300, and 400 µg/mL of TiO₂ NPs. *p < 0.05: vs. control. TiO₂ NPs: titanium dioxide nanoparticles.

Discussion

With the increasing applications of TiO₂ NPs in various commercial products, concerns about their risk to human health and the unfriendly environment are growing.⁷ There were reports of pulmonary inflammation and cancer in rats and mice.^11,12 However, the underlying mechanisms of these adverse effects have not been extensively characterized.^21,22 The current study showed that TiO₂ NPs inhibited cell viability and decreased cell phagocytosis in RAW 264.7 cells. TiO₂ NPs triggered autophage and increased the expression levels of autophage-related gene Beclin-1 and MAP-LC3.

The study demonstrated also that the phagocytic ability of RAW 264.7 macrophages was significantly impaired in 30 or 100 nm TiO₂ NPs with increasing concentration. Of greater interest was the potential for 30 nm more than 100 nm TiO₂ NPs. The impairment of rat alveolar macrophage phagocytosis and prolonged particle clearance after exposure to increasing doses (5, 50, and 250 mg/m³) of TiO₂ has been reported, that is, the potential for 29-nm TiO₂ NPs to impair phagocytosis more than 250 nm TiO₂ NPs.^23,24 The study has confirmed with the previous reports, indicating the decrease of phagocytic ability of RAW 264.7 macrophages after treatment with TiO₂ NPs. The structure and integrity of the cells has consequently resulted in the impairment of the cell phagocytosis. Furthermore, this study showed that, at an equal mass, the smaller particles caused more serious damage to the cells than the larger particles. Although the real reason has not been studied, the smaller particle size of TiO₂ NPs may adhere or penetrate the cell membrane more easily.

Autophagy is a catabolic process involving the degradation of cytoplasmic material, playing an important role in cellular homeostasis by the elimination of damaged organelle and aggregated proteins.^25,26 It is an important response mechanism under different kinds of cellular stress,²⁷ generally promoting counteracting apoptosis cell death and cell survival.²⁸ The levels of cellular LC3-II correspond to the number of autophagosomes, and thus, it is a suitable and well-characterized marker to assess autophagy. The levels of LC3 have showed a significant difference in 300 and 400 µg/mL concentrations of TiO₂ NPs. This could be due to the increased autophagic initiation and decreased autophagic degradation.^29,30 Beclin-1 levels appear to be one of the critical factors that affect the induction of autophagy.³¹ The Beclin-1 protein is also an important convergence point of autophagy and apoptosis; it interacts with antiapoptotic Bcl-2-like proteins.³² The study of Beclin-1 has showed that the 200, 300, and 400 µg/mL concentrations affected autophagy significantly.

Many studies have reported that TiO₂ NPs can induce toxic response by increasing the generation of malondialdehyde and ROS; downregulating Bcl-2; triggering mitochondrial alteration, inflammatory response and DNA damage, and subsequent apoptotic cell death.^33,34 Lopes et al.³⁵ indicated that exposure to TiO₂ NPs led to a dose-dependent increase in the autophagic effect under noncytotoxic conditions in human HaCaT cells, but the high-dose treatment appeared to impair the degradation of autophagic substrates more than the low-dose did over time. Autophagy can act in both cytoprotective and cell death functions. It plays a vital role in maintaining cell structure, functional integrity, and metabolism. Although more in-depth studies are needed to clarify the mechanism, our study demonstrated that the TiO₂ NPs induce autophage in murine macrophage cells by TEM and MDC staining.

Conclusions

In summary, the study has demonstrated that TiO₂ NPs reduced cellular ability in RAW 264.7 macrophage cell line. It also showed that TiO₂ NP decreased cell viability, phagocytic rate, and phagocytic index in a concentration-dependent manner, thereby inducing autophagy. The results have supported strongly that TiO₂ NPs can induce RAW 264.7 cell toxicology and autophage.

Footnotes

Authors' contributions

All authors contributed to the writing of the manuscript and gave approval to the final version of the manuscript.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

X Dai

References

Buzea

Pacheco

Robbie

. Nanomaterials and nanoparticles: sources and toxicity. Biointerphases 2007; 2(4): MR17–MR71.

Sun

Meng

Loong

. Removal of natural organic matter from water using a nano-structured photocatalyst coupled with filtrating membrane. Water Sci Technol 2004; 49(1): 103–110.

Marta

Gabriela

Marcin

. Singlet oxygen generation in the presence of titanium dioxide materials used as sunscreens in suntan lotions. J Photochem Photobiol A 2010; 213: 158–163.

Chen

Mao

. Titanium dioxide nanomaterials: synthesis, properties, modifications, and applications. Chem Rev 2007; 107(7): 2891–2959.

Jin

Zhu

Wang

. Cytotoxicity of titanium dioxide nanoparticles in mouse fibroblast cells. Chem Res Toxicol 2008; 21(9): 1871–1877.

Vamanu

Cimpan

Hol

. Induction of cell death by TiO₂ nanoparticles: studies on a human monoblastoid cell line. Toxicol Vitro 2008; 22(7): 1689–1696.

Gravina

Maghni

Welman

. Protective role against hydrogen peroxide and fibroblast stimulation via Ce-doped TiO₂ nanostructured materials. Biochim Biophys Acta 2016; 1860(2): 452–464.

Hou

Deng

. 808 nm Light-triggered and hyaluronic acid-targeted dual-photosensitizers nanoplatform by fully utilizing Nd(3+)-sensitized upconversion emission with enhanced anti-tumor efficacy. Biomaterials 2016; 101: 32–46.

Cobalt in hard metals and cobalt sulfate, gallium arsenide, indium phosphide and vanadium pentoxide. Monographs on the evaluation of carcinogenic risks to humans. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. et al. IARC Monogr Eval Carcinog Risks Hum 2006; 86: 1–294.

10.

Hussain

Boland

Baeza-Squiban

. Oxidative stress and proinflammatory effects of carbon black and titanium dioxide nanoparticles: role of particle surface area and internalized amount. Toxicology 2009; 260(1–3): 142–149.

11.

Falck

Lindberg

Suhonen

. Genotoxic effects of nanosized and fine TiO₂ . Hum Exp Toxicol 2009; 28(6–7): 339–352.

12.

Renwick

Brown

Clouter

. Increased inflammation and altered macrophage chemotactic responses caused by two ultrafine particle types. Occup Environ Med 2004; 61(5): 442–447.

13.

Cui

Liu

. Gene expression in liver injury caused by long-term exposure to titanium dioxide nanoparticles in mice. Toxicological Sci 2012; 128(1): 171–185.

14.

Meena

Rani

Pal

. Nano-TiO₂-induced apoptosis by oxidative stress-mediated DNA damage and activation of p53 in human embryonic kidney cells. Appl Biochem Biotech 2012; 167(4): 791–808.

15.

Tang

Wang

Jin

. Mitochondrial injury induced by nanosized titanium dioxide in A549 cells and rats. Environ Toxicol Phar 2013; 36(1): 66–72.

16.

Rahman

Norwood

Hatch

. Evidence that exposure of particulate air pollutants to human and rat alveolar macrophages leads to differential oxidative response. Biochem Biophys Res Commun 1997; 240(3): 669–672.

17.

Afaq

Abidi

Matin

. Cytotoxicity, pro-oxidant effects and antioxidant depletion in rat lung alveolar macrophages exposed to ultrafine titanium dioxide. J Appl Toxicol 1998; 18(5): 307–312.

18.

Ouyang

Shi

Zhao

. Programmed cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis. Cell Prolif 2012; 45(6): 487–498.

19.

Denizot

Lang

. Rapid colorimetric assay for cell growth and survival: modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 1986; 89(2): 271–277.

20.

Warheit

Hansen

Yuen

. Inhalation of high concentrations of low toxicity dusts in rats results in impaired pulmonary clearance mechanisms and persistent inflammation. Toxicol Appl Pharmacol 1997; 145(1): 10–22.

21.

Zhang

Yang

. Toxicology of nanosized titanium dioxide: an update. Arch Toxicol 2015; 89(12): 2207–2217.

22.

Engin

Nikitovic

Neagu

. Mechanistic understanding of nanoparticles’ interactions with extracellular matrix: the cell and immune system. Fibre Toxicol 2017; 14(1): 22.

23.

Renwick

Donaldson

Clouter

. Impairment of alveolar macrophage phagocytosis by ultrafine particles. Toxicol Appl Pharm 2001; 172(2): 119–127.

24.

Abounit

Scarabelli

McCauley

. Autophagy in mammalian cells. World J Biol Chem 2012; 3(1): 1–6.

25.

Klionsky

. The molecular machinery of autophagy: unanswered questions. J Cell Sci 2005; 118(Pt 1): 7–18.

26.

Mizushima

. Autophagy: process and function. Genes Dev 2007; 21(22): 2861–2873.

27.

Boya

Gonzalez-Polo

Casares

. Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol 2005; 25(3): 1025–1040.

28.

Klionsky

Cuervo

Seglen

. Methods for monitoring autophagy from yeast to human. Autophagy 2007; 3(3): 181–206.

29.

Kroemer

Mariño

Levine

. Autophagy and the integrated stress response. Mol Cell 2010; 40(2): 280–293.

30.

Miracco

Cosci

Oliveri

. Protein and mRNA expression of autophagy gene Beclin 1 in human brain tumours. Int J Oncol 2007; 30(2): 429–436.

31.

Liang

Kleeman

Jiang

. Protection against fatal Sindbis virus encephalitis by Beclin, a novel Bcl-2-interacting protein. J Virol 1998; 72(11): 8586–8596.

32.

Xue

Luo

Yang

. A mechanism for nano-titanium dioxide-induced cytotoxicity in HaCaT cells under UVA irradiation. Biosci Biotech Biochem 2015; 79(8): 1384–1390.

33.

Azim

Darwish

Rizk

. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: possible role of some antioxidants. Exp Toxicol Pathol 2015; 67(4): 305–314.

34.

Ali

Alarifi

. Impairment of DNA in a freshwater gastropod (Lymnea luteola l.) after exposure to titanium dioxide nanoparticles. Arch Environ Contam Toxicol 2015; 68(3): 543–552.

35.

Lopes

Loitto

Audinot

. Dose-dependent autophagic effect of titanium dioxide nanoparticles in human HaCaT cells at non-cytotoxic levels. J Nanobiotech 2016; 14: 22

Titanium dioxide nanoparticles induce in vitro autophagy

Abstract

Aim:

Methods:

Results:

Conclusion:

Keywords

Introduction

Materials and methods

Characterization of TiO2 NPs

Cell culture and viability assay

Phagocytosis assays

TEM analysis of cellular organelles

Detection of autophagic vacuoles by staining of cells with MDC

Quantitative analysis of MAP-LC3 and Beclin-1 expression

MAP-LC3 and Beclin-1 protein expression

Statistical analysis

Results

Characterization of TiO2 NPs

Effects of TiO2 NPs on RAW 264.7 cells viability and phagocytosis function

TiO2 NPs induce autophagy in murine macrophage cells

Increased expression of autophagic markers Beclin-1 and MAP-LC3 in RAW 264.7 cells

Discussion

Conclusions

Footnotes

Authors' contributions

Declaration of Conflicting Interests

Funding

ORCID iD

References

Characterization of TiO₂ NPs

Characterization of TiO₂ NPs

Effects of TiO₂ NPs on RAW 264.7 cells viability and phagocytosis function

TiO₂ NPs induce autophagy in murine macrophage cells