Sage Journals: Discover world-class research

Abstract

RNA interference (RNAi) is a powerful tool to silence or minimize gene expression, and palate culture in vitro is an important technique for study of the palate development. Our previous study demonstrated that the gene expression of glucose-regulated protein-78 (Grp78) was downregulation in the all-trans retinoic acid-induced mouse models of cleft palate (CP) during embryogenesis. To find the role of Grp78, the small interfering RNA (siRNA) of this gene carried by fluorescent vector was injected with a microinjector, through which about 30 pmol siRNA was injected into the Institute of Cancer Research (ICR) mouse palate explants. After 6, 12, 24, 48, and 72 h, these palate explants were removed from culture to observe their fluorescent and Alcian blue-staining phenotypes, and the expression of the unfolded protein response (UPR) key members (Grp78, Inositol-responsive enzyme 1, protein kinase RNA-like endoplasmic reticulum kinase, activating transcription factor-6 and X-box binding protein-1) was measured. After cultured for 72 h, the partially or completely fused bilateral palates were observed in the control siRNA group, while CPs were found in the Grp78 siRNA group. In the Grp78 siRNA group, the relatively mRNA abundance of the key genes belonged to UPR at each time point was lower than that of the control siRNA group, and their protein expression also displayed the same change. By the system of RNAi strategies with mouse palate culture, we found the siRNA of Grp78 disturbed the fusion of mouse palate cultured in vitro.

Keywords

RNAi Grp78 palate fusion unfolded protein response

Introduction

Cleft lip and/or cleft palate (CP) is one of the most common congenital defect, and its incidence rate of human is about 1/700 live births.¹ The study of etiology and pathogenesis of congenital CP may therefore provide scientific clues for the early prevention and treatment. Nowadays, the analysis for gene functions is one of the most important ways to investigate the mechanism of CP during embryogenesis.^2,3

RNA interference (RNAi) refers to the introduction of homologous double-stranded RNA to specifically target a gene’s product, resulting in null or hypomorphic phenotypes, and it is actually an important body’s defense mechanism.^4,5 Gene knockdown technology using RNAi is currently reported in the study of gene functions not only in cells but in whole animals, embryos, and cultured mouse metaphase II oocytes and forelimbs in vitro.^6

–9 The palate cultivation technology has not only been used for quick screening of teratogens but more frequently used for the study of mechanisms of normal and abnormal palate development.^10,11 A combined use of RNAi and in vitro mouse palate culture technologies would facilitate functional investigations on various genes during embryonic palate development.

It is considered that dysregulation of some candidate genes or signaling pathway genes expression was related to CP,¹ and our previous study had showed the gene expression of glucose-regulated protein-78 (Grp78, a key regulator of the unfolded protein response (UPR)) was decreased in the all-trans retinoic acid (ATRA)-induced Institute of Cancer Research (ICR) mouse model of CP during embryogenesis.¹² In addition, we found that the UPR played essential roles in ATRA-induced malformation of ICR mouse embryonic limbs.^13

–16 Furthermore, the UPR and endoplasmic reticulum stress (ERS) were triggered in high glucose-induced neural tube defects of C57BL/6 J mouse embryo,¹⁷ and Grp78 played an essential role in Xenopus pronephros formation, which was mediated in part through retinoic acid (RA) signaling during early embryonic development.¹⁸ Grp78 was important to embryo development,^19,20 but there was little study investigated its effects on palate during embryogenesis except we found its downregulation in ATRA-induced mouse CP.¹²

The UPR refers to the adaption reaction induced by unfolded protein aggregates in endoplasmic reticulum (ER) to prevent proteins from further accumulation and has the capacity of disrupting or buffering abnormal protein synthesis activated by stress through stimulating protein folding, degrading misfolded proteins, and reducing protein synthesis. This sequence is initiated by the transfer of Grp78 from three primary responder ER membrane protein kinase RNA-like ER kinase (Perk), activating transcription factor 6 (Atf6), inositol-responsive enzyme 1 (Ire1), to the accumulating unfolded proteins.²¹ Ire1 performs an unconventional cytoplasmic splicing of X-box binding protein-1 (Xbp1) pre-mRNA, and then synthesize the active Xbp1, which activates UPR target genes to restore the ER homeostasis.²²

Given the above, Grp78 and UPR may be related to the malformation of embryos, and the combined use of RNAi and in vitro mouse organs culture technologies is benefit to investigate the gene function. Therefore, using RNAi technique, we analyzed the function of Grp78 and UPR in mouse palate development in vitro in this study.

Materials and methods

Animals

ICR mice were purchased from Sino-British SIPER B/K Lab Animal Co., Ltd (certificate no. SCXK Shanghai 2003-0002, Shanghai, China). The mice were housed in an environment maintained at 21 ± 2°C and a relative humidity of 55 ± 10% with a 12-h light/12-h dark cycle. Male and female mice were paired at 10:00 p.m., and pregnancy was established by the presence of the vaginal plug the next morning, which was considered gestational day 0 (GD0). The use of animals in this study was approved by the Committee on Ethics of Biomedicine Research, Hunan Normal University in Changsha, China.

Medium and small interfering RNA preparation

BGJb medium (Gibco, Waltham, Massachusetts, USA) supplemented with 0.15 mg/ml glutamine (Sigma-Aldrich, St.Louis, Missouri), 6 mg/ml BSA (Sigma-Aldrich), 50 μg/ml streptomycin and 50 U/ml penicillin was used as the substrate of mouse palate culture, and before use they were sterilized by filtration.^11,23,24 The small interfering RNA (siRNA) oligonucleotide was synthesized by Genechem Inc. (Shanghai, China). The sequence used for the Grp78 siRNA group was 5′gaCCCTTACTCG GGCCAAATT3′, and the control siRNA group is an irrelevant siRNA with random nucleotides UUCUCCGAACGUGUCACGUTT. H1/Neo/green fluorescent protein (GFP)/NON, the vector for delivering the siRNA, could express a GFP which fluoresces at 510 nm when stimulated by an excitation wavelength of 470 nm.^9,25 The vector itself does not disturb the expression of any endogenous genes (including the target gene) in vertebrate cells.⁹ Thus, this vector was used as an indicator of successful transfection and as a negative control.

In vitro mouse palate culture and microinjection

The palate explants were cultivated according to the literature²⁶ with some minor modifications. In brief, on GD12, mice were killed by cervical vertebral dislocation, conceptuses were dissected out of the uteri, and all the embryos were placed in a petri dish containing sterile Hanks solution. Their heads of all embryos were cutoff from the necks; the upper and lower parts of the head were separated longitudinally along the stomodeum, and the lower part was discarded. Using fine forceps, the tongue, the whole brain tissue, and the superior and posterior skin of the upper part were dissected, with the midfacial explant preserved. The palate explants were randomized to the control and Grp78 siRNA groups.

The vector/siRNA was injected with a CellTram Oil microinjector (Eppendorf, German) equipped with a sterile femotip injection needle (Eppendorf), through which about 0.15 μl siRNA solution was injected into the palate through the middle upper lip, both sides of near the nose under a dissecting microscope. In the Grp78 siRNA group, each palate explant received about 30 pmol Grp78-targeting siRNA, and each explant in the control siRNA group was given the same dose nonsilencing control siRNA. By this siRNA microinjection, there had no other tissue effects. And after microinjection, three to four palate explants were placed in a 50-ml flask containing 9 ml BGJb and cultured in a rotating incubator (20–25 r/min) for 72 h at 37.5 ± 0.5°C. Mixed sterile filtration gas (O₂:CO₂:N₂/50:5:45) was filled into the flask for 2–5 min at 0, 24, and 48 h of cultivation.

Sample collection and treatment

The palates were removed from culture at 6, 12, 24, 48, and 72 h and washed with phosphate-buffered saline to observe their phenotypes under a laser scanning confocal microscope (Leica, German). More than eight palates were used for Alcian blue staining. In brief, the palates were fixed in Bouin’s solution, stained with the 0.75% Alcian blue system, cleared in 30% acetic acid, dehydrated in an alcohol series, cleared in xylol, and kept under cedar oil.¹² Their phenotypes were observed with a stereomicroscope (Leica). Eight palates those surrounding tissue removed were taken from each dose group for measuring mRNA abundance, and another five palates were taken for protein abundance measuring.

Total RNA extraction and real-time fluorescent quantitative polymerase chain reaction

The harvested palates from the control and Grp78 siRNA groups were lysed in Trizol (Invitrogen, Carlsbad, California, USA). Total RNA was extracted according to the protocol of the kit and dissolved in nuclease-free water, cDNA was synthesized via reverse transcription of 1 µg total RNA following manufacturer’s instructions of the reverse transcription kit (Promega, Madison, Wisconsin, USA).

cDNA obtained was amplified with real-time fluorescent quantitative polymerase chain reaction (RT-PCR) on ABI 7900 PRISM system using ABI SYBR buffer (Applied Biosystems, Foster City, California, USA). Primers were designed with ABI Primer Express 3.0 according to ABI Primer Design Guidelines. All primers used in the present study were synthesized by Shanghai Invitrogen (China) using the sequences as listed in Table 1. The RT-PCR reaction system used is as follows: SYBR buffer 2.5 μl, cDNA 0.5 μl, upstream primer 0.3 μl, downstream primer 0.3 μl, Mili Q water 6.4 μl, under the reaction conditions: 95°C for 15 min, 40 cycles consisted of 95 °C for 5 s and 60°C for 1 min.

Table 1.

Primers for QRT-PCR.

Genes	Forward primer sequences (5′→3′)	Reverse primer sequences (5′→3′)
Grp78	TCATCGGACGCACTTGGAA	AACCACCTTGAATGGCAAGAA
Perk	GATGACTGCAATTACGCTATCAAGA	CCTTCTCCCGTGCCAACTC
Ire1	CATGAGGAACAAGAAGCACCACTA	TCGCTGTGTGAAGTACTGAATGAA
Xbp1	TGCCCCCCCGACATG	AGAAAGAAATGCTAAGGGCCATT
Atf6	CCCAAGCTCTCCGCATAGTC	TAAAATGCCCCATAACTGACCAA
β-actin	ACGGCCAGGTCATCACTATTG	CAAGAAGGAAGGCTGGAAAAGA

Grp78: glucose-regulated protein-78; Irel: inositol-responsive enzyme 1; Xbp1: X-box binding protein-1; Atf6: activating transcription factor 6; PCR: polymerase chain reaction; QRT: quantitative reverse transcription.

The threshold cycle (C_t ) value for the PCR amplification curve of the target genes was compared with C_t value for the internal reference gene (β-actin) to obtain ΔC_t , which was used to conduct relative quantitative analysis on the expression level of target gene. The target genes C_t values were normalized with subtracting the β-actin C_t value, and the relative mRNA expression abundance was calculated by the formula $Y = 2^{- Δ C_{t}}, where Δ C_{t} = C_{t_{target genes}} - C_{t_{β -}_{a c t i n}} .$ ²⁷

Western blotting

The palate explants harvested from the control and Grp78 siRNA groups were homogenized and centrifuged at 10,000 × g for 10 min at 4°C to clear the protein lysate. Then, the protein concentrations were quantitated using a modified Lowry protocol (DC protein assay; Bio-Rad Laboratories, Hercules, California, USA). Total protein was boiled for 5 min in SDS loading buffer containing dithiothreitol and then loaded about 25 μg of total protein per lane in an SDS-PAGE gel. Following electrophoresis, the separated proteins were blotted onto a polyvinylidene difluoride membrane, which was blocked overnight with 5% skimmed milk powder in TBS-T at 4°C. Blots were incubated overnight at 4°C with Grp78 primary antibody, which were diluted 1:1000 in blocking solution. The membranes were washed three times with TBST and incubated 1 h at 20°C with a secondary antibodies (goat anti-rabbit 1:1000, goat anti-mouse 1:10 000; Thermo Scientific Ltd, Waltham, Massachusetts, USA), and then, an ECL detection kit (Thermo Scientific Ltd) and an X-ray film were used to detect the blots according to the manufacturer’s protocols.

Statistical analysis

Data were expressed as $\bar{X} \pm s_{d}$ and analyzed by multivariate analysis of variance using the SPSS 18.0 statistical software package. RT-PCR analysis was performed in duplicate and repeated a minimum of two times with independent RNA samples. The minimum level of significance was p < 0.05 for all tests.

Results

Effects of Grp78 knockdown on palate development

The palates in the control and Grp78 siRNA groups emitted homogenous green fluorescence after 6 h of culture, indicating that the H1/Neo/GFP/NON RNAi vector containing GFP and siRNA was successfully introduced into the palates. Both in the control and Grp78 siRNA groups, 22, 22, 39, 25, and 39 palate explants were isolated from embryos and cultured, respectively, for 6, 12, 24, 48, and 72 h. At each time point, we harvested 22, 22, 39, 24, and 36 palate explants in the control siRNA group and 22, 22, 38, 24, and 35 palate explants in the Grp78 siRNA group. After cultured for 72 h, the bilateral palates were partially or completely fused in the control siRNA group, while those in the Grp78 siRNA group were demerged or came closer but did not contact with each other (Figures 1 and 2).

Figure 1.

The fluorescence and the phenotypes of the palates. After cultured in vitro for 24 h (a and b) and 72 h (c and d), the bilateral palate shelves in the control siRNA group were contacted but not fused (left arrow in (a)) and perfect fusion (left arrow in (c)) separately, and those in the Grp78 siRNA group were demerged (right arrows in (b) and (d)). Grp78: glucose-regulated protein-78; siRNA: small interfering RNA.

Figure 2.

The fusion of palate shelves stained by Alcian blue. After cultured for 24 h, the palate shelves in the control siRNA group were contacted but not fused (left arrow in (a)), while those in the Grp78 siRNA group were demerged (right arrow in (b)). After cultured for 72 h, to perfect or partial fusion of the palate shelves as a well-developed standard, the CP ratio of the control siRNA group is 13.0% (3/23), and that of the Grp78 siRNA group is 77.3% (17/22), indicating that the CP ratio of the Grp78 siRNA group was significantly higher than that of the control siRNA group (p < 0.05; arrows in (c) and (d), respectively, indicated complete fusion palate shelf in the control siRNA group and demerge in the Grp78 siRNA group). siRNA: small interfering RNA; glucose-regulated protein-78; CP: cleft palate.

Effects of Grp78 siRNA on the gene and protein expression of Grp78, Atf6, Ire1, Perk, and Xbp1

The expression of Grp78, Atf6, Ire1, Perk, and Xbp1 in the control and Grp78 siRNA groups was confirmed during palate culture at 6, 12, 24, 48, and 72 h, and the similar trends of gene expression were observed between the control and Grp78 siRNA groups. At each time, the relative mRNA abundance and the protein expression of Grp78 in the Grp78 siRNA group were lower than that of the control siRNA group, indicating that the Grp78 siRNA was well distributed and effective for reducing Grp78 expression (Figures 3 and 4).

Figure 3.

The relative mRNA abundance of Grp78, Atf6, Ire1, Perk, and Xbp1 in the control siRNA and Grp78 siRNA groups at different cultured time (n = 8). Compared with the mRNA abundance of Grp78 in the control siRNA group and that of the Grp78 siRNA group was correspondingly 10.9, 46.4, 23.7, 8.9, and 35.5% at 6, 12, 24, 48, and 72 h. The abundance of Grp78, Atf6, Ire1, Perk, and Xbp1 at each time point was relatively lower than that of the control siRNA group. Note: ——: the control group; - - - -: the treatment group; #p < 0.05: lower than that of the control group, MANOVA. siRNA: small interfering RNA; Grp78: glucose-regulated protein-78; Irel: inositol-responsive enzyme 1; Xbp1: X-box binding protein-1; Atf6: activating transcription factor 6. MANOVA: multivariate analysis of variance.

Figure 4.

Effects of siRNA on protein expression of Grp78, Atf6, Ire1, Perk, and Xbp1 in embryonic palates at different cultured time. The expression of Grp78, Atf6, Ire1, Perk, and Xbp1 in the control siRNA group was higher than that of the Grp78 siRNA group. Note: #p < 0.05: lower than that of the control group, MANOVA, n = 5. siRNA: small interfering RNA; Grp78: glucose-regulated protein-78; Irel: inositol-responsive enzyme 1; Xbp1: X-box binding protein-1; Atf6: activating transcription factor 6. MANOVA: multivariate analysis of variance.

As well, the relative mRNA abundance and the protein expression of the other four UPR members (Atf6, Ire1, Perk, and Xbp1) in the Grp78 siRNA group were lower than that in the control siRNA group (Figures 3 and 4).

Discussion

Now, RNAi is mostly used for the study of gene function of cells, tissues/organs, and embryos of various plants and animals.^28
–30 The palate is susceptible to experience malformation during embryonic development. It is therefore necessary to understand the gene function of this organ and reveal the mechanism of its malformation. The present model of combining RNAi and in vitro palate culture technologies by microinjection provides a simple and effective way of studying gene functions during palate development.

In the present study, the expression of GFP was observed within 6–72 h after injection, and siRNA-mediated inhibition of Grp78 expression was observed from 6 h to at least 72 h, suggesting that the combined use of RNAi and in vitro mouse palate culture by microinjection is feasible and effective, while failed fusion of the shelves was observed in Grp78 siRNA-treated palates as compared with the control siRNA palates, indicating that Grp78 may potentially play a critical role in the palate development during embryogenesis. This study showed that the combined use of RNAi and the in vitro mouse palate culture system would benefit the study of embryonic development.

Grp78 plays an essential role during mouse embryogenesis, because it is required for cell proliferation and protecting the inner cell mass from apoptosis during early mouse embryonic development.³¹ During mouse early heart organogenesis, Grp78 can be activated through cooperation between the cell type-specific transcription factors and ERS response elements binding factors.³² Meanwhile, known as the key members (Grp78, Atf6, Ire1, Perk, and Xbp1) of UPR have been implicated in embryogenesis, the inhibition of UPR may ultimately lead to malformation of embryo.^33

–36

Some studies found that Grp78 is closely related to the abnormal development of the embryos. Knockdown of Grp78 by morpholino antisense oligonucleotides attenuated RA signaling and induced Xenopus pronephros malformation.¹⁸ By inhibiting Grp78, Xbp1, and other members of ERS, punicalagin reduces high glucose-induced neural tube defects formation.¹⁹ Moreover, maternal Cd exposure during early mouse limb development significantly increased the incidences of forelimb ectrodactyly in fetuses, the reason may be Cd induced to upregulate the expression of GRP78.³⁶ But even so, there is no study about the role of Grp78 on CP mechanism.

Notable decrease was observed in both gene and protein expression of Grp78, Atf6, Ire1, Perk, and Xbp1 at 6, 12, 24, 48, and 72 h in the Grp78 siRNA group and reflected that the results of Grp78 inhibition were disruption to the palate development and the decrease of the other four gene expressions. Except for our previous study, we find little information about Grp78 and UPR signaling pathway in palate fusion, and why interference of Grp78 can induce the decrease of both genes and proteins expression of Atf6, Ire1, Perk, and Xbp1. However, we still presumed that inhibiting UPR by knockdown of Grp78 induced CP, because GRP78 is required for cell proliferation and protection from apoptosis in embryo fibroblast cells,³⁷ and impaired UPR may lead to apoptosis,³⁸ and moreover, targeting Grp78 with a highly specific monoclonal antibody suppressed AKT activation and increased apoptosis in the cPten(f/f) tumors. ³⁹

Because we still don’t know the mechanism of Grp78 during the CP of mouse, more detailed investigation will need to do. Even so, by the system of RNAi strategies with mouse palate culture in vitro, we demonstrated that Grp78 may contribute to the development of mouse palate.

Footnotes

Author contribution

The first two authors contributed equally to this work.

Declaration of Conflicting Interests

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in the manuscript entitled “RNAi of Grp78 may disturb the fusion of ICR mouse palate cultured in vitro”. The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

References

Dixon

Marazita

Beaty

. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet 2011; 12: 167–178.

Nakajima

Ito

Tanaka

. Functional role of TGF-β receptors during palatal fusion in vitro. Arch Oral Biol 2014; 59(11): 1192–1204.

Yumoto

Thomas

Lane

. TGF-β-activated kinase 1 (Tak1) mediates agonist-induced Smad activation and linker region phosphorylation in embryonic craniofacial neural crest-derived cells. J Biol Chem 2013; 288(19): 13467–13480.

Choong

Baba

Mochizuki

. Gene therapy for neurological disorders. Expert Opin Biol Ther 2016; 16(2): 143–159.

Kalantari

Chiang

CM,

Corey

. Regulation of mammalian transcription and splicing by Nuclear RNAi. Nucleic Acids Res 2016; 44(2): 524–537.

Cui

Dai

Marcho

. Towards functional annotation of the preimplantation transcriptome: an RNAi screen in mammalian embryos. Sci Rep 2016; 6: 37396.

Kim

Park

Balaban

. A functional genomic screen for cardiogenic genes using RNA interference in developing drosophila embryos. Proc. Natl. Acad Sci U S A 2004; 101: 159–164.

Amanai

Shoji

Yoshida

. Injection of mammalian metaphase II oocytes with short interfering RNAs to dissect meiotic and early mitotic events. Biol Reprod 2006; 75: 891–898.

Zhu

Wan

. Combined use of RNAi strategies with in vitro mouse limb bud culture. J Exp Zool B Mol Dev Evol 2010; 314: 412–416.

10.

Xiao

Chen

. IRF6 is the mediator of TGFβ3 during regulation of the epithelial mesenchymal transition and palatal fusion. Sci Rep 2015; 5: 12791.

11.

Lei

Zhang

Wei

. G-protein α-subunit Gsα is required for craniofacial morphogenesis. PLoS One 2016; 11(2): e0147535.

12.

Zhu

Ren

Wan

. Gene expression of Hsp70, Hsp90 and Hsp110 families in normal palate and cleft palate during mouse embryogenesis. Toxicol Ind Health 2013; 29: 915–930.

13.

Zhu

Yin

. All-trans-retinoic acid induces short forelimb malformation during mouse embryo development by inhibiting chondrocyte maturation rather than by evoking excess cell death. Toxicol Lett 2012; 211: 172–186.

14.

Yan

Wei

Ren

. Gene expression of Hsps in normal and abnormal embryonic development of mouse hindlimbs. Hum Exp Toxicol 2015; 34(6): 563–574.

15.

Zhu

Zhou

Zhu

. Gene expression of Hsp70, Hsp90, and Hsp110 families in normal and abnormal embryonic development of mouse forelimbs. Drug Chem Toxicol. 2012; 35(4): 432–444.

16.

Zhu

Wan

. Gene expression of sHsps, Hsp40 and Hsp60 families in normal and abnormal embryonic development of mouse forelimbs. Toxicol Lett 2010; 193(3): 242–251.

17.

Dong

. High glucose-repressed CITED2 expression through miR-200b triggers the unfolded protein response and endoplasmic reticulum stress. Diabetes 2016; 65: 149–163.

18.

Shi

Wang

. Heat shock 70-kDa protein 5 (Hspa5) is essential for pronephros formation by mediating retinoic acid signaling. J Biol Chem 2015; 290: 577–589.

19.

Zhong

Reece

EA,

Yang

. Punicalagin exerts protective effect against high glucose-induced cellular stress and neural tube defects. Biochem Biophys Res Commun 2015; 467(2): 179–184.

20.

Nistal

Pastrián

González-Peramato

. Inhibin bodies: a new marker for immature Sertoli cells. Histopathology 2011; 58(7): 1019–1027.

21.

Lin

Yasumura

. IRE1 signaling affects cell fate during the unfolded protein response. Science 2007; 318: 944–949.

22.

Guo

Feng

. Inositol-requiring enzyme 1α is required for gut development in Xenopus lavies embryos. World J Gastroenterol 2013; 19: 227–234.

23.

Ito

Yeo

Chytil

. Conditional inactivation of Tgfbr2 in cranial neural crest causes cleft palate and calvaria defects. Development 2003; 130(21): 5269–5280.

24.

Shiota

Kosazuma

Klug

. Development of the fetal mouse palate in suspension organ culture. Acta Anat (Basel) 1990; 137(1): 59–64.

25.

Zhang

Jiang

Feng

. Yin Yang-1 suppresses differentiation of hepatocellular carcinoma cells through the downregulation of CCAAT/enhancer-binding protein alpha. J Mol Med (Berl) 2012; 90(9): 1069–1077.

26.

al-Obaidi

Kastner

Merker

. Development of a suspension organ culture of the fetal rat palate. Arch Toxicol 1995; 69: 472–479.

27.

Stams

den Boer

Beverloo

. Sensitivity to L-asparaginase is not associated with expression levels of asparagine synthetase in t(12;21)+ pediatric ALL. Blood 2003; 101: 2743–2747.

28.

Lin

Song

Zhao

. Targeting th17 cells with small molecules and small interference RNA. Mediators Inflamm 2015; 2015: 290657.

29.

Abdurakhmonov

Ayubov

Ubaydullaeva

. RNA interference for functional genomics and improvement of cotton (Gossypium sp.). Front Plant Sci 2016; 7: 202.

30.

Sarisozen

Salzano

Torchilin

. Recent advances in siRNA delivery. Biomol Concepts 2015; 6(5–6): 321–341.

31.

Luo

Mao

Lee

. GRP78/BiP is required for cell proliferation and protecting the inner cell mass from apoptosis during early mouse embryonic development. Mol Cell Biol 2006; 26: 5688–5697.

32.

Mao

Tai

Bai

. In vivo regulation of Grp78/BiP transcription in the embryonic heart: role of the endoplasmic reticulum stress response element and GATA-4. J Biol Chem 2006; 281: 8877–8887.

33.

Han

Zhou

Zhang

. IRE1α dissociates with BiP and inhibits ER stress-mediated apoptosis in cartilage development. Cell Signal 2013; 25: 2136–2146.

34.

Russell

Norman

. Endoplasmic reticulum (ER) stress in cumulus-oocyte complexes impairs pentraxin-3 secretion, mitochondrial membrane potential (DeltaPsi m), and embryodevelopment. Mol Endocrinol 2012; 26: 562–573.

35.

Wang

. Altered expression of Armet and Mrlp51 in the oocyte, preimplantation embryo, and brain of mice following oocyte in vitro maturation but postnatal brain development and cognitive function are normal. Reproduction 2011; 142: 401–408.

36.

Wang

. Cadmium-induced teratogenicity: association with ROS-mediated endoplasmic reticulum stress in placenta. Toxicol Appl Pharmacol 2012; 259: 236–247.

37.

Jeon

Choi

Lee

. GRP78 is required for cell proliferation and protection from apoptosis in chicken embryo fibroblast cells. Poult Sci 2016; 95(5): 1129–1136.

38.

Wang

Sun

Chen

. Impaired unfolded protein response in the degeneration of cochlea cells in a mouse model of age-related hearing loss. Exp Gerontol 2015; 70: 61–70.

39.

Lin

Shen

Yoo

. Targeting the glucose-regulated protein-78 abrogates Pten-null driven AKT activation and endometrioid tumorigenesis. Oncogene 2015; 34(43): 5418–5426.